miRTarBase - #MIRT728384 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AFF4   
Synonyms AF5Q31, CHOPS, MCEF
Description AF4/FMR2 family member 4
Transcript NM_014423   
Expression
Putative miRNA Targets on AFF4
3'UTR of AFF4
(miRNA target sites are highlighted)
>AFF4|NM_014423|3'UTR
   1 ACTGAACACATTCTCGTTGCCTCTGATTTTCTCCACAACACTGTGTCACATCACGAAGGAAAACTGCCATAACATACCAC
  81 CTAGTCGACACTAAGAATGAGGAATAGTTTTCTCCTCGTTGGTTCATGTGTTGTTGTTTTTGATAATCCAAAGCGATCAT
 161 GTCAGTTGGCCCTTTAATATTTCCAATGTGAAAGATTATTTAAATGCTTTTAAATCTGCAGCACATTGATAAGATGGTTT
 241 CCGTGAGCTATGATAAGATTGAAATTCCAGTTGCAATTCATAACTAATGAATTGAAATTTTATTTATTTTAATTTTTTTA
 321 AGTTCCCAGATTGGGGCTAGTTTAAGACTTAGTTATTTCTGCCTATAAATTTACTCTGTTGAATATTTAGCATAAATTTA
 401 ATGTAGACATTTTTATTTATATACCTTGGGAGCTTTATTACCTAATATCTTTTTGTGGTAGCTGTTCTAAGAGTAAGAAT
 481 TGGTTCGTCTAAAATAAGGACATATTCTTTCTACACCTGCTACCTGACCTGATATTTGAAATCTTAACTCCAATTTTATT
 561 ATTGTGGAATTTACAGTTAGTATTAAGGATATTCTTCTACACATGAAAAAATCACTTAAATATGAGAAAATGGCATTCTA
 641 CATGTATGTACTATGAAATGTGTCTGATTTGGTATGCATTATTTCAAAAACTGTGAATGTGTGTTAATAACACTACAGCA
 721 ATCACACAGTGACTATAGCTTGCATTTAATGCATTACAAAAGAGGGAGGACAAACTTTCTAGAAGAAGCATTTCATGTTG
 801 AAGGGTTTCATAAAAGGACAATCCTGAACGTTACGGATTTTATTAAAACCATATGTTATTTTTTGTTGCTAATCATTTGA
 881 CACTTAATCGAAACAGAATAAGTTACTGTGGAAAAAAGGATGATCCAACTCCTGAGGATTGCCGCCTGTGTGTCTTTAAT
 961 TGATTATCTTTGATAGTTAGAGTTATTTTTCAGATTTTTCCCCCTCATACTGGATTGTGATGCTCTGATATGAGCATGCA
1041 ATGACTGATACAGAAATAGGCTGGAGCTTCGGTGTGTGCTTTTGCTATACAGCTTACAGTTCTAATGCCTGATGTAGAGA
1121 TGATGAATTTCTCCTTTTTAAACCTATCTTCTGTTTACTCCTTTTGCATTATGAAGGCCCTCTTCAATGATGTATGTTTC
1201 TGATGGAATCAGAAAATTTCACACTAGAAAAGTGTACCTAACTTGATTCAGTGTGAGCTCTTGGGACAGGGAGTGGAGCC
1281 AGGGGTAGAGCTTAAAGAAGCTGGCTCTGTAAGAGTTGTATATCAAAGTACCTTTTGCTACAAGGTGCATATAGAAGTCT
1361 AAGATAAGAAATGTACCCTCTATACTTTATTTTTCATGCCCCTATCATGTTTGGTGTGCCTTAAATCTTACCTTTAAATG
1441 AAGACTCTATGGATTGTTTACAAATGAAGTTTTACACTAGGACCAGATCGTCCATACATGATTGGTCTTCTACAATAATA
1521 ATGTTCAATTCTTTCATTTTAAATCTTTCTTTAGGGTCATATAAAGATTAGTTCTTTCAGAAAAGCTATTGCTTTGGTAC
1601 ATGACTTAGTCTAACCAGTTGGGTAATGCTGCTTTGAAAAATAGTTTGTCCCTCTCCCCATTCCAAAAATGAATCCATTC
1681 AGTCAGAAAAAAAGATTATCCTACTATTTGTAGATGATTGCTAAGGCTTGAAATAGGAAAGGGGAAAGAAGGGATAGAAA
1761 AGTTTCAAGTCCAGTAGTGCAGTGAATCCTTTGTGTTTGAGACTTTTTTACACTTATTTCTGAAGTTAGTGAACTTTCAT
1841 TGTCCCTGTGGCCTCATATTTATAGAGCTTCTTAACTGTTTTGTACCTCAGATTGTTTTTAGATGTCATTGAAGATTGAG
1921 ATGTACAAATTATGTTGAATTTAACCTGTTTCTCTTGGAGAAATTGCCTCTGATATCTTTCTAACTTAATCTTAGTGTGT
2001 TCTAGGAACAGTTTTCCATAAGAGGACAACTTCTCAATGATCATGATAGTTATTTAGTAAGAAATAATGGTTGTTAATCA
2081 AATACATGTTATGTCTTGTCCTTCTCTGATTTTTCTGACTTGGATTCCTTAATTTGCAGTGATGTCTTAGAAATGGAAAA
2161 AGTATCCTCTGGGCTTTCAGACTTTCAGCAACAACAGCCAGTGGGATACCTCTGAGTTCTTGTGTTCTAGTCTCTTGTAT
2241 GTCCTGAAAGGCAGCAGGAGCATTTTTGGGGTCACACTGATATTTTGTTAAAGCAGAGTTTCCTGCATGGTTTATGGTGC
2321 TGCTCTAATATTTTCTCTTTAAAACTGTGTCAATTTTTGGAGAATGAATTTTTCAACCTTTTCATTGTGGAGGATTTTTC
2401 CCACAAGGTAGTAATGGGCAATGGATCAAAATCCTATCATAAATGATTGAATTTTCAATGTCATAGTGTGTGGAAATACT
2481 ACTCCCTTTCCTCCATGTCTATCTTCTTAGATGTTCTGTCTTTGTCATCATCTGCTCCAGCACATACTTTGGACTCCTTT
2561 ACAGGTGACCTTCCCCCCTCCCTCCTCAATAGGTGTCCTCAGTGTTTTCTAAGCATTTAAAACTGAATTTGACAAGTGGC
2641 TAAAAACTTAGTCTGAGACTTGTACTTAGTATATGGTTAATTATAGAAACAACAACTATTTTAAACAGTTACTCTGTTGA
2721 CTGCTCTTTATGACTACACTTGTATGCCAGGAGGCAGCAGCCTATACACCATTAGACTCTTTACAAGCAACCAACGAACC
2801 AATTGCAGTGGTTGCAGTTGTCACAGTAGTCTTGCCTGGGCCAGACTGGGCTGGGCTGTGGGAAGCATTCCCCTTCAGGG
2881 GAGTTTCCACAGCTCAGCCCAGGCTCCAGTCTGGCTAGAGAGCATCCAGCCCATTCCTTGCCTCAGTGCCACCTTTTTCT
2961 GGGCAAGTAGCCAAGAAGTGACTTTATATGCAGTGAGTACTTCAGATAAACTTACAGCTACAGCTGCCGAAGAGTGGAGA
3041 AGGTTGACCACCATTTATTTAATTCTCTAGTGTAAAAACAATTGAGAGCAGTGTGCGTGAGCCCACAGACACCTGTGTTT
3121 CTGGGAGCTCTGGCAGTGGCGGATTCATAGGCACTTGGGCTGCACTTTGAATGACACACTTGGCTTTATTAGATTCACTA
3201 GTTTTTAAAAAATTGTTGTTCGTTTCTTTTCATTAAAGGTTTAATCAGACAGATCAGACAGCATAATTTTGTATTTAATG
3281 ACAGAAACGTTGGTACATTTCTTCATGAATGAGCTTGCATTCTGAAGCAAGAGCCTACAAAAGGCACTTGTTATAAATGA
3361 AAGTTCTGGCTCTAGAGGCCAGTACTCTGGAGTTTCAGAGCAGCCAGTGATTGTTCCAGTCAGTGATGCCTAGTTATATA
3441 GAGGAGGAGTACACTGTGCACTCTTCTAGGTGTAAGGGTATGCAACTTTGGATCTTAAAATTCTGTACACATACACACTT
3521 TATATATATGTATGTATGTATGAAAACATGAAATTAGTTTGTCAAATATGTGTGTGTTTAGTATTTTAGCTTAGTGCAAC
3601 TATTTCCACATTATTTATTAAATTGATCTAAGACACTTTCTTGTTGACACCTTGAATATTAATGTTCAAGGGTGCAATGT
3681 GTATTCCTTTAGATTGTTAAAGCTTAATTACTATGATTTGTAGTAAATTAACTTTTAAAATGTATTTGAGCCCTTCTGTA
3761 GTGTCGTAGGGCTCTTACAGGGTGGGAAAGATTTTAATTTTCCAGTTGCTAATTGAACAGTATGGCCTCATTATATATTT
3841 TGATTTATAGGAGTTTGTGTCTGGGTCCCAGGAACATCTACTGGGGATGACTGTTAGGCAGCTTGTGATGATGTTTTTTA
3921 AAAAACCTAAGTAACTTGGGGAGACAGAGCATTTCAAACCCATATAGACACCTATCATACCTGTATATCCCCTAATACAT
4001 GGAACATAAATTTCATTTCAGCTTTATGCATTAATGTATTGAAGAGGCAGGCTTTTTTTCCAGTAATAATACTGTACATC
4081 TAAGGTTGCTATTCAGTAAAACTAATAGAAGAGATAATTATTGAATACCTTGGAATATGTAGTGAGAAGAGGCCAAATTT
4161 TTCATGTTTGTGAGCATGTCTTTCAGATACTCGCTAATGGAGAAATTCACTTTAGACCTCTAGACCCCAAAACCAAGTTA
4241 GCAAGTGACAAAAAGTAAATTATTAATAGTCTGTAAAGTGGATGCTGGTCTTACAAAGCTCCTATTCACATGAACCCTAT
4321 GGTTAATTAGAAAGAACTTGCTGTCTCCAGAAAAGGGAATGGAAATAATAACTATGTATCTTCTTTTCATGTAATTTGGT
4401 CACAGAATAAGGTATTCAAGTTAAGTCTAATCCAAGTCTTAGAGATCTTTAAGTATCCTAAAATAGCAGCCTAAGTAGTC
4481 ATCATGTAAAGAAGTTGACTTTCAGGAATGTCAGCATTGACCTCTCCTTGCCACTGTTACTCAGCTAAACATAACTTGCC
4561 ATTCTTAAAAATAAAAAAGCTCCCACCCAGAAACTCTAGTGATACTCAGTTTTGACCTCTTACTGCTTCCATGTGGGACT
4641 TCTTTTCAGCTTTTAACCATTGGAATTTTCTACCTGCTATGTTCCTCTCTGGAAAATATCAATTTGGAAATGCTGCCTTT
4721 CAAATCAATGCCATGATCATCCATATTGTTGAGTTTGTTGTTGGTGTTCCAGAAGTGTCCCCATTTTACAACTTTATGCA
4801 CACACCTGGCAAATCATTAACATGAGCATTCAACAGTACTGGGATGGGTGGGGTGGGGGTAGGGGGCTCACCAACAGAAC
4881 TGGCCAGTTGACATTGCCTGAAAAGGCACCACCTTTAAGGGCCAGTTGTGGGGTTGGTAAGCACAGTTATGAAAATTTCT
4961 ATCTAGCCTCCGTTTTGAATGGTTTTAAGAAATTTTGTATATGGAGGATGGAAATGCTTATATATTTATTGAAAATCCTT
5041 TTATTTGAAATTAAAATTATTTGGTATATAATTGTTTGATATTTGGGGAGGGTTTTGGAGGGGAGATAATGTCACTGATA
5121 AATTAAAAGCCTGTTGATTTTGCAGAAAGGTACTGTTAGTGACTGATAAGGATGCCTTTGTTTTGTACATGAACCAAATC
5201 TTTGTTTTACATTTCTTTTATCCAAAATATTTAGGCATCTGACATTTTCAACCAGAATTTCAATTATATACTGTGATTTT
5281 TATTTGTTGCAATACATTACAATTTCAGAGGTACTTTGGGGCTCAAAAGCTAGGATTTCTAAGTCAGTATGTGCATTTCA
5361 CACGATAAAGCTGTTAATGGTGAGCAAAGTATTATATACTAACTAGATTTTTCCACATCTGTATAGTATATTATATGTAT
5441 TTTGTGGTATTGAGAGTATAGAAAGTTTAGAGTGTCAAACATGCGTTTAATGTGTATTTTTAAACAAATTTATGGCAATT
5521 AAAATATTTGGAGACAAGGGTATCACATTTCAATTTGTAAAGATCTTTTTAACTCTACTGTGTCATTAAGATGCTTTGTA
5601 CAATGCCAAACCATAGTTGGAGAAACTAAGTTTAATAAATATCAAATAGATTTTCTGTATTAAAGTTACTGAACACTGTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU-AAUAC---ACGACGAu 5'
            | ||||| ||: |   ||||||| 
Target 5' gtCTAACCAGTTGGGTAATGCTGCTt 3'
1609 - 1634 160.00 -13.30
2
miRNA  3' guguuugguAAUA-CACGACGAu 5'
                   |||| |||||||| 
Target 5' ctgcatggtTTATGGTGCTGCTc 3'
2303 - 2325 157.00 -14.70
3
miRNA  3' gugUUUGGU----AAU---ACACGACGAu 5'
             ||||||    |||   | ||:|||| 
Target 5' ttaAAACCATATGTTATTTTTTGTTGCTa 3'
843 - 871 145.00 -14.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30149081 52 COSMIC
COSN30189979 58 COSMIC
COSN30124694 81 COSMIC
COSN30106347 84 COSMIC
COSN26564607 89 COSMIC
COSN30148948 99 COSMIC
COSN30122677 165 COSMIC
COSN6863539 185 COSMIC
COSN1307399 213 COSMIC
COSN1307398 220 COSMIC
COSN1307397 239 COSMIC
COSN31490046 334 COSMIC
COSN31540645 481 COSMIC
COSN8491860 486 COSMIC
COSN29806444 579 COSMIC
COSN29809297 586 COSMIC
COSN4843538 824 COSMIC
COSN31584817 887 COSMIC
COSN15662513 944 COSMIC
COSN15804127 1015 COSMIC
COSN28449539 1107 COSMIC
COSN15832474 1121 COSMIC
COSN15828891 1141 COSMIC
COSN5589476 1317 COSMIC
COSN22390635 1398 COSMIC
COSN6863538 1415 COSMIC
COSN30165881 1531 COSMIC
COSN2070645 1599 COSMIC
COSN30540657 1620 COSMIC
COSN31490570 1696 COSMIC
COSN28646734 1820 COSMIC
COSN26698955 1923 COSMIC
COSN17182855 1925 COSMIC
COSN9925923 2169 COSMIC
COSN6863537 2266 COSMIC
COSN21627955 2328 COSMIC
COSN26115404 2345 COSMIC
COSN28651446 2421 COSMIC
COSN2070643 2464 COSMIC
COSN26670450 2601 COSMIC
COSN15661399 2702 COSMIC
COSN29308958 2705 COSMIC
COSN5158231 3158 COSMIC
COSN2070641 3166 COSMIC
COSN17897842 3196 COSMIC
COSN5589475 3202 COSMIC
COSN2070639 3213 COSMIC
COSN31608596 3709 COSMIC
COSN20101811 3847 COSMIC
COSN1307395 3978 COSMIC
COSN2070637 4038 COSMIC
COSN31585007 4067 COSMIC
COSN24977114 4381 COSMIC
COSN26638058 4629 COSMIC
COSN31486903 4647 COSMIC
COSN29320382 4663 COSMIC
COSN1307393 4704 COSMIC
COSN2070635 4752 COSMIC
COSN2070633 4832 COSMIC
COSN2070631 4846 COSMIC
COSN2070629 4947 COSMIC
COSN2070627 4956 COSMIC
COSN6863535 5055 COSMIC
COSN15725617 5214 COSMIC
COSN31486867 5249 COSMIC
COSN17037933 5267 COSMIC
COSN30169720 5476 COSMIC
COSN2070625 5508 COSMIC
COSN31528773 5516 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs375967092 10 dbSNP
rs760394538 14 dbSNP
rs371660889 16 dbSNP
rs1439571042 19 dbSNP
rs202005193 21 dbSNP
rs765177837 23 dbSNP
rs759395221 27 dbSNP
rs368107532 33 dbSNP
rs756504730 35 dbSNP
rs770779042 40 dbSNP
rs1223382119 41 dbSNP
rs949285193 42 dbSNP
rs750786793 45 dbSNP
rs990466012 54 dbSNP
rs937689010 55 dbSNP
rs143386016 64 dbSNP
rs774965156 65 dbSNP
rs1468564679 78 dbSNP
rs184033059 83 dbSNP
rs1186218452 86 dbSNP
rs767716843 87 dbSNP
rs1473426498 92 dbSNP
rs1167805421 98 dbSNP
rs1232184918 102 dbSNP
rs1210575734 105 dbSNP
rs928193714 106 dbSNP
rs139233793 107 dbSNP
rs982424936 117 dbSNP
rs1314511781 118 dbSNP
rs762338359 119 dbSNP
rs1261005929 123 dbSNP
rs1026450104 126 dbSNP
rs781770655 130 dbSNP
rs941839153 131 dbSNP
rs1340932931 139 dbSNP
rs1228488839 143 dbSNP
rs546506262 154 dbSNP
rs752012748 155 dbSNP
rs1212518543 157 dbSNP
rs1258739629 159 dbSNP
rs1443290818 171 dbSNP
rs963472895 175 dbSNP
rs1193119968 179 dbSNP
rs1329384482 186 dbSNP
rs1017669243 200 dbSNP
rs1189268662 204 dbSNP
rs1394502120 225 dbSNP
rs1433125453 228 dbSNP
rs1174465005 230 dbSNP
rs1402658244 235 dbSNP
rs986207895 240 dbSNP
rs1316217951 242 dbSNP
rs577456956 243 dbSNP
rs890493639 245 dbSNP
rs772526794 250 dbSNP
rs1030289756 251 dbSNP
rs569370320 253 dbSNP
rs554403189 259 dbSNP
rs1368099950 269 dbSNP
rs998076694 270 dbSNP
rs1256167534 274 dbSNP
rs1346227852 276 dbSNP
rs902440135 277 dbSNP
rs1204916654 279 dbSNP
rs967615815 289 dbSNP
rs1189725587 291 dbSNP
rs1252452595 294 dbSNP
rs1042198989 311 dbSNP
rs1201351855 312 dbSNP
rs1373262198 312 dbSNP
rs1378418039 313 dbSNP
rs1020514486 314 dbSNP
rs1156570469 326 dbSNP
rs1390503234 329 dbSNP
rs1455052529 332 dbSNP
rs199585016 344 dbSNP
rs1011756458 348 dbSNP
rs893283463 361 dbSNP
rs1334778186 363 dbSNP
rs1032521084 365 dbSNP
rs946564621 378 dbSNP
rs893547073 383 dbSNP
rs1458006123 388 dbSNP
rs1209918556 399 dbSNP
rs1273090539 401 dbSNP
rs1347144619 402 dbSNP
rs1467249378 405 dbSNP
rs1054915332 407 dbSNP
rs190942600 408 dbSNP
rs1268380257 417 dbSNP
rs937657919 419 dbSNP
rs113481875 424 dbSNP
rs1179875534 426 dbSNP
rs1413912303 440 dbSNP
rs571675769 445 dbSNP
rs1164200738 449 dbSNP
rs1415579657 462 dbSNP
rs1459033592 466 dbSNP
rs1293586086 476 dbSNP
rs927574880 482 dbSNP
rs1395088993 486 dbSNP
rs803218 487 dbSNP
rs1309403810 495 dbSNP
rs1352776339 502 dbSNP
rs202240945 504 dbSNP
rs1184193979 505 dbSNP
rs949336078 510 dbSNP
rs897753892 511 dbSNP
rs1247564285 512 dbSNP
rs114364786 517 dbSNP
rs146862909 522 dbSNP
rs1241082767 524 dbSNP
rs143888481 528 dbSNP
rs1194310583 529 dbSNP
rs1254231920 530 dbSNP
rs1483300615 542 dbSNP
rs919521657 550 dbSNP
rs1186925703 551 dbSNP
rs1182703649 557 dbSNP
rs941875877 592 dbSNP
rs909016203 599 dbSNP
rs973579240 603 dbSNP
rs1460011447 604 dbSNP
rs963543613 606 dbSNP
rs1213037939 612 dbSNP
rs1370753600 612 dbSNP
rs1312677821 614 dbSNP
rs532505273 615 dbSNP
rs1289959096 620 dbSNP
rs1313991507 630 dbSNP
rs770599923 631 dbSNP
rs954797928 640 dbSNP
rs1030301010 641 dbSNP
rs1329129959 643 dbSNP
rs999278284 651 dbSNP
rs923301139 653 dbSNP
rs760185176 658 dbSNP
rs1277926415 664 dbSNP
rs1484076858 679 dbSNP
rs1248869420 684 dbSNP
rs1417873250 687 dbSNP
rs540632361 696 dbSNP
rs1314832288 697 dbSNP
rs778347660 699 dbSNP
rs1390202959 707 dbSNP
rs1433748793 711 dbSNP
rs758676658 719 dbSNP
rs868721255 725 dbSNP
rs1171288386 727 dbSNP
rs1020569842 728 dbSNP
rs1467890744 734 dbSNP
rs1304003280 736 dbSNP
rs539763439 738 dbSNP
rs1299948764 740 dbSNP
rs1021317749 745 dbSNP
rs1010732137 751 dbSNP
rs1299443063 752 dbSNP
rs957803131 765 dbSNP
rs1034503504 766 dbSNP
rs540259667 767 dbSNP
rs1165512587 776 dbSNP
rs748120627 778 dbSNP
rs1210441658 780 dbSNP
rs1001920151 786 dbSNP
rs1024644074 789 dbSNP
rs186263898 789 dbSNP
rs1428824114 791 dbSNP
rs1435345050 801 dbSNP
rs1263575488 810 dbSNP
rs778976898 814 dbSNP
rs1344913120 819 dbSNP
rs1184474888 828 dbSNP
rs565240083 830 dbSNP
rs138401696 834 dbSNP
rs1389540805 834 dbSNP
rs1246828963 835 dbSNP
rs1369987601 850 dbSNP
rs768901149 851 dbSNP
rs1357956174 855 dbSNP
rs1230173439 856 dbSNP
rs568433548 859 dbSNP
rs749374640 868 dbSNP
rs1480745079 871 dbSNP
rs919506073 879 dbSNP
rs1038395875 880 dbSNP
rs1201170999 887 dbSNP
rs749738940 889 dbSNP
rs548737178 890 dbSNP
rs1471804224 898 dbSNP
rs1162054335 907 dbSNP
rs910684209 910 dbSNP
rs887647135 912 dbSNP
rs1461043651 922 dbSNP
rs1321686273 923 dbSNP
rs369402055 928 dbSNP
rs578106504 932 dbSNP
rs1293853334 937 dbSNP
rs803219 944 dbSNP
rs1297773841 957 dbSNP
rs954767286 963 dbSNP
rs143636330 976 dbSNP
rs923372417 977 dbSNP
rs1348452155 981 dbSNP
rs1256510077 986 dbSNP
rs1288984453 991 dbSNP
rs73788216 991 dbSNP
rs1226476206 992 dbSNP
rs1291404952 994 dbSNP
rs1321751170 996 dbSNP
rs967815287 999 dbSNP
rs181555355 1001 dbSNP
rs1305050895 1003 dbSNP
rs750545263 1004 dbSNP
rs1184770422 1005 dbSNP
rs1252920135 1006 dbSNP
rs1472761489 1006 dbSNP
rs1040460825 1010 dbSNP
rs1161936272 1013 dbSNP
rs946046161 1028 dbSNP
rs1302541540 1033 dbSNP
rs913224337 1035 dbSNP
rs560641399 1041 dbSNP
rs990832842 1047 dbSNP
rs781635573 1050 dbSNP
rs1308422223 1061 dbSNP
rs1354506549 1064 dbSNP
rs957640237 1069 dbSNP
rs540491154 1070 dbSNP
rs190267739 1071 dbSNP
rs370605966 1072 dbSNP
rs1427593769 1076 dbSNP
rs1272112285 1079 dbSNP
rs1471055833 1088 dbSNP
rs1033485223 1090 dbSNP
rs757594230 1110 dbSNP
rs1205347412 1113 dbSNP
rs1002057312 1121 dbSNP
rs1442155944 1123 dbSNP
rs1429495595 1124 dbSNP
rs980300272 1131 dbSNP
rs1200977094 1151 dbSNP
rs906265500 1157 dbSNP
rs148933852 1158 dbSNP
rs752100221 1159 dbSNP
rs544673513 1160 dbSNP
rs1169419622 1162 dbSNP
rs1481888010 1166 dbSNP
rs1401256345 1177 dbSNP
rs1412518020 1182 dbSNP
rs1336170590 1191 dbSNP
rs1359661435 1191 dbSNP
rs1250008059 1192 dbSNP
rs1294774608 1194 dbSNP
rs748445980 1201 dbSNP
rs1013259330 1203 dbSNP
rs565689577 1214 dbSNP
rs1305720089 1216 dbSNP
rs897527527 1232 dbSNP
rs759100509 1238 dbSNP
rs961715342 1250 dbSNP
rs753397548 1251 dbSNP
rs541570555 1253 dbSNP
rs910820224 1254 dbSNP
rs560563302 1255 dbSNP
rs765736810 1257 dbSNP
rs1377284484 1266 dbSNP
rs1289045900 1272 dbSNP
rs708457 1274 dbSNP
rs1402564487 1276 dbSNP
rs556185390 1279 dbSNP
rs1390266982 1281 dbSNP
rs1435150403 1284 dbSNP
rs772043567 1285 dbSNP
rs1324882641 1298 dbSNP
rs1328983547 1301 dbSNP
rs1234888043 1304 dbSNP
rs1276975026 1306 dbSNP
rs967490839 1307 dbSNP
rs1346098743 1309 dbSNP
rs745656513 1311 dbSNP
rs1228338467 1313 dbSNP
rs375306571 1321 dbSNP
rs1461245811 1323 dbSNP
rs1040512686 1324 dbSNP
rs761673268 1325 dbSNP
rs80086203 1332 dbSNP
rs1178231457 1334 dbSNP
rs990163152 1338 dbSNP
rs1201229953 1341 dbSNP
rs1378013673 1342 dbSNP
rs768702794 1367 dbSNP
rs749124515 1368 dbSNP
rs1156907171 1374 dbSNP
rs1033621068 1375 dbSNP
rs186251731 1376 dbSNP
rs1457364856 1377 dbSNP
rs534067458 1381 dbSNP
rs1181851602 1383 dbSNP
rs1002026295 1385 dbSNP
rs971003906 1388 dbSNP
rs775645819 1398 dbSNP
rs1195589739 1399 dbSNP
rs1462095816 1401 dbSNP
rs1346588494 1403 dbSNP
rs1409599660 1406 dbSNP
rs1024725192 1409 dbSNP
rs980738083 1412 dbSNP
rs1229484807 1417 dbSNP
rs1264970750 1420 dbSNP
rs1265367527 1433 dbSNP
rs993616527 1437 dbSNP
rs1268277889 1440 dbSNP
rs1202067942 1443 dbSNP
rs971550669 1447 dbSNP
rs917400982 1448 dbSNP
rs1179732345 1451 dbSNP
rs1323055671 1455 dbSNP
rs991892625 1460 dbSNP
rs1241217266 1461 dbSNP
rs75378933 1465 dbSNP
rs1366225027 1466 dbSNP
rs1458971209 1467 dbSNP
rs1163519027 1480 dbSNP
rs1369548632 1481 dbSNP
rs1015055719 1485 dbSNP
rs1005887799 1489 dbSNP
rs878913789 1490 dbSNP
rs180976860 1498 dbSNP
rs746148580 1500 dbSNP
rs951778388 1505 dbSNP
rs1028925822 1507 dbSNP
rs1341739609 1509 dbSNP
rs114873524 1510 dbSNP
rs1181256400 1519 dbSNP
rs531695139 1528 dbSNP
rs1425104378 1544 dbSNP
rs1187659951 1555 dbSNP
rs57421764 1557 dbSNP
rs755057364 1557 dbSNP
rs1024050655 1558 dbSNP
rs1447320615 1567 dbSNP
rs569253060 1569 dbSNP
rs555455577 1585 dbSNP
rs1372847663 1588 dbSNP
rs1462787563 1599 dbSNP
rs1302842744 1600 dbSNP
rs1050668068 1601 dbSNP
rs1398246024 1608 dbSNP
rs1054906007 1612 dbSNP
rs1364496086 1613 dbSNP
rs933487632 1616 dbSNP
rs1454828482 1617 dbSNP
rs1459461705 1624 dbSNP
rs901968873 1626 dbSNP
rs1041897300 1630 dbSNP
rs55732952 1652 dbSNP
rs905829717 1653 dbSNP
rs1200926449 1658 dbSNP
rs146472926 1664 dbSNP
rs760643311 1671 dbSNP
rs1463143655 1679 dbSNP
rs914681127 1680 dbSNP
rs1190157065 1681 dbSNP
rs1390398447 1682 dbSNP
rs1429542587 1687 dbSNP
rs1175813534 1693 dbSNP
rs990132587 1697 dbSNP
rs1044681332 1706 dbSNP
rs1245402185 1714 dbSNP
rs950284138 1729 dbSNP
rs917450021 1736 dbSNP
rs1432945592 1741 dbSNP
rs1322879738 1742 dbSNP
rs937355295 1771 dbSNP
rs757684398 1779 dbSNP
rs926520527 1786 dbSNP
rs1298970063 1788 dbSNP
rs1461058256 1789 dbSNP
rs1224101151 1796 dbSNP
rs980725605 1799 dbSNP
rs970675363 1801 dbSNP
rs1206979086 1804 dbSNP
rs940154536 1816 dbSNP
rs1348716730 1817 dbSNP
rs803220 1820 dbSNP
rs1239399286 1825 dbSNP
rs1360014048 1837 dbSNP
rs1316920956 1847 dbSNP
rs971907365 1856 dbSNP
rs144103236 1858 dbSNP
rs1381585484 1867 dbSNP
rs1015940299 1870 dbSNP
rs1411865779 1872 dbSNP
rs758908215 1875 dbSNP
rs1455760701 1878 dbSNP
rs1005851393 1882 dbSNP
rs1029060350 1907 dbSNP
rs974699394 1909 dbSNP
rs1318634681 1914 dbSNP
rs1436060478 1915 dbSNP
rs888743747 1917 dbSNP
rs1383543438 1920 dbSNP
rs965942029 1921 dbSNP
rs1369515197 1923 dbSNP
rs1405325331 1933 dbSNP
rs753102503 1935 dbSNP
rs1018837416 1952 dbSNP
rs1010074608 1957 dbSNP
rs1284379717 1969 dbSNP
rs1320539814 1976 dbSNP
rs1387581376 1978 dbSNP
rs1218991244 1983 dbSNP
rs1266809204 1983 dbSNP
rs998211518 1985 dbSNP
rs765939116 1987 dbSNP
rs1251469771 1988 dbSNP
rs1471916244 1991 dbSNP
rs755547610 1995 dbSNP
rs530323499 2001 dbSNP
rs561388191 2008 dbSNP
rs1408874677 2009 dbSNP
rs1444320355 2010 dbSNP
rs1404808909 2012 dbSNP
rs1000673889 2017 dbSNP
rs1351822635 2018 dbSNP
rs1425475439 2020 dbSNP
rs541435121 2022 dbSNP
rs1348349520 2030 dbSNP
rs1411610432 2033 dbSNP
rs1377855957 2037 dbSNP
rs1195674767 2053 dbSNP
rs1291647820 2070 dbSNP
rs1445474602 2079 dbSNP
rs1359723861 2085 dbSNP
rs1261165106 2092 dbSNP
rs752442946 2094 dbSNP
rs1042301798 2098 dbSNP
rs1223250719 2100 dbSNP
rs767060852 2103 dbSNP
rs1233963803 2104 dbSNP
rs1472542988 2117 dbSNP
rs1387096755 2119 dbSNP
rs950020432 2120 dbSNP
rs896074523 2133 dbSNP
rs1355448008 2138 dbSNP
rs1204844119 2139 dbSNP
rs946212423 2142 dbSNP
rs189320402 2153 dbSNP
rs1445652928 2155 dbSNP
rs184378846 2162 dbSNP
rs182331648 2166 dbSNP
rs927315661 2167 dbSNP
rs981430423 2172 dbSNP
rs1294913467 2174 dbSNP
rs189289176 2180 dbSNP
rs1216676781 2181 dbSNP
rs1274084853 2182 dbSNP
rs184372397 2184 dbSNP
rs930388427 2185 dbSNP
rs1301913781 2186 dbSNP
rs1461808437 2186 dbSNP
rs921653934 2186 dbSNP
rs767278265 2190 dbSNP
rs201262951 2194 dbSNP
rs974411482 2201 dbSNP
rs1168293163 2219 dbSNP
rs965661167 2221 dbSNP
rs972322486 2224 dbSNP
rs1338601669 2229 dbSNP
rs1406228724 2234 dbSNP
rs1433712121 2239 dbSNP
rs961871689 2243 dbSNP
rs1424573548 2245 dbSNP
rs1015971512 2250 dbSNP
rs1366933938 2262 dbSNP
rs376094028 2280 dbSNP
rs1227617506 2283 dbSNP
rs1271171973 2288 dbSNP
rs1344691315 2290 dbSNP
rs1169978103 2296 dbSNP
rs984545395 2305 dbSNP
rs953125112 2314 dbSNP
rs1474560867 2316 dbSNP
rs1265508717 2317 dbSNP
rs550176448 2321 dbSNP
rs988696534 2335 dbSNP
rs1028645508 2346 dbSNP
rs534131340 2372 dbSNP
rs966713231 2384 dbSNP
rs1194116663 2387 dbSNP
rs1245963516 2402 dbSNP
rs1476902431 2404 dbSNP
rs1178587191 2413 dbSNP
rs143672867 2415 dbSNP
rs1020505385 2418 dbSNP
rs42395 2421 dbSNP
rs1386444019 2423 dbSNP
rs895793233 2424 dbSNP
rs1273490318 2436 dbSNP
rs893268295 2439 dbSNP
rs1322444619 2443 dbSNP
rs369258318 2458 dbSNP
rs1037276355 2464 dbSNP
rs1004855024 2465 dbSNP
rs1277105702 2483 dbSNP
rs537871460 2493 dbSNP
rs79020539 2501 dbSNP
rs1228243756 2502 dbSNP
rs932799829 2505 dbSNP
rs1280785931 2508 dbSNP
rs1289430567 2520 dbSNP
rs1449716919 2522 dbSNP
rs1201334680 2523 dbSNP
rs1001651587 2526 dbSNP
rs905931616 2529 dbSNP
rs1391618192 2530 dbSNP
rs921680603 2533 dbSNP
rs1046169101 2538 dbSNP
rs191886522 2541 dbSNP
rs1453812551 2544 dbSNP
rs762980292 2547 dbSNP
rs1408503141 2553 dbSNP
rs1388115270 2556 dbSNP
rs1426096932 2562 dbSNP
rs1305341225 2565 dbSNP
rs528331022 2570 dbSNP
rs139163363 2575 dbSNP
rs1337684058 2577 dbSNP
rs1239849397 2579 dbSNP
rs1481528274 2579 dbSNP
rs546780091 2583 dbSNP
rs1224958750 2587 dbSNP
rs956148372 2589 dbSNP
rs1482592319 2593 dbSNP
rs1427335493 2601 dbSNP
rs1202983528 2602 dbSNP
rs1252571719 2630 dbSNP
rs1419212826 2633 dbSNP
rs1186237189 2647 dbSNP
rs940602591 2650 dbSNP
rs909085141 2653 dbSNP
rs1163769573 2662 dbSNP
rs979006078 2663 dbSNP
rs984576321 2665 dbSNP
rs969893703 2680 dbSNP
rs953155744 2686 dbSNP
rs1297025977 2695 dbSNP
rs530193196 2712 dbSNP
rs1233331159 2713 dbSNP
rs769970194 2721 dbSNP
rs965705875 2725 dbSNP
rs1435931160 2743 dbSNP
rs1256184060 2749 dbSNP
rs561250237 2750 dbSNP
rs151175527 2760 dbSNP
rs1315956328 2762 dbSNP
rs1341279080 2765 dbSNP
rs1203963454 2767 dbSNP
rs1014280753 2776 dbSNP
rs531224152 2781 dbSNP
rs562491593 2785 dbSNP
rs1253486023 2787 dbSNP
rs1260745641 2791 dbSNP
rs42540 2796 dbSNP
rs957599154 2802 dbSNP
rs1033204841 2806 dbSNP
rs1389158779 2809 dbSNP
rs1001682653 2820 dbSNP
rs1447229021 2824 dbSNP
rs1374693963 2825 dbSNP
rs905962742 2827 dbSNP
rs888705237 2829 dbSNP
rs1281843312 2832 dbSNP
rs1462965547 2833 dbSNP
rs1302756433 2852 dbSNP
rs776896255 2853 dbSNP
rs1045784246 2854 dbSNP
rs559386205 2855 dbSNP
rs771152519 2858 dbSNP
rs1364748777 2865 dbSNP
rs1376690380 2877 dbSNP
rs1380673514 2886 dbSNP
rs1297493323 2899 dbSNP
rs1307808073 2899 dbSNP
rs897194381 2907 dbSNP
rs1261177077 2909 dbSNP
rs1325143748 2912 dbSNP
rs1203773869 2916 dbSNP
rs1246810513 2926 dbSNP
rs1463293296 2927 dbSNP
rs1037433304 2951 dbSNP
rs545610637 2966 dbSNP
rs1187858451 2983 dbSNP
rs1264358415 2986 dbSNP
rs899971080 2987 dbSNP
rs1176058051 2990 dbSNP
rs576870553 2997 dbSNP
rs188630185 3015 dbSNP
rs1177246317 3019 dbSNP
rs796366240 3023 dbSNP
rs944419243 3026 dbSNP
rs911598491 3027 dbSNP
rs184603649 3028 dbSNP
rs1335583376 3029 dbSNP
rs909115671 3039 dbSNP
rs1175470813 3041 dbSNP
rs1048899409 3048 dbSNP
rs574654858 3057 dbSNP
rs1347326629 3068 dbSNP
rs1224000181 3069 dbSNP
rs1266970059 3070 dbSNP
rs192880053 3074 dbSNP
rs925880098 3081 dbSNP
rs1217553161 3085 dbSNP
rs1160291115 3095 dbSNP
rs142128818 3096 dbSNP
rs747164115 3097 dbSNP
rs1183931989 3099 dbSNP
rs1199159292 3101 dbSNP
rs966183865 3103 dbSNP
rs1481723432 3104 dbSNP
rs1200719876 3110 dbSNP
rs912929097 3114 dbSNP
rs538124600 3116 dbSNP
rs1411389335 3127 dbSNP
rs114249944 3130 dbSNP
rs377495635 3137 dbSNP
rs957630235 3139 dbSNP
rs1033235961 3140 dbSNP
rs980276155 3141 dbSNP
rs187681819 3153 dbSNP
rs1024893357 3158 dbSNP
rs1014376447 3160 dbSNP
rs1405540097 3161 dbSNP
rs897219322 3167 dbSNP
rs865802217 3168 dbSNP
rs1370630055 3179 dbSNP
rs1015599882 3185 dbSNP
rs1316196202 3193 dbSNP
rs1015619850 3202 dbSNP
rs1219741519 3213 dbSNP
rs1490936390 3221 dbSNP
rs537543194 3221 dbSNP
rs778139584 3221 dbSNP
rs758637972 3222 dbSNP
rs1469004425 3232 dbSNP
rs748742103 3232 dbSNP
rs1179033129 3239 dbSNP
rs1408759008 3246 dbSNP
rs1161883466 3254 dbSNP
rs1423485477 3254 dbSNP
rs1386908505 3265 dbSNP
rs1380863373 3278 dbSNP
rs931818428 3289 dbSNP
rs1307408619 3297 dbSNP
rs1352697946 3305 dbSNP
rs1444209019 3313 dbSNP
rs900370763 3318 dbSNP
rs374161986 3320 dbSNP
rs779260515 3325 dbSNP
rs1377748914 3328 dbSNP
rs1243376831 3348 dbSNP
rs912951540 3356 dbSNP
rs1431738348 3363 dbSNP
rs1362121895 3369 dbSNP
rs1247193015 3372 dbSNP
rs1347092218 3374 dbSNP
rs1272660700 3388 dbSNP
rs1207182423 3389 dbSNP
rs1436611410 3389 dbSNP
rs1233577367 3390 dbSNP
rs1156978385 3391 dbSNP
rs988491958 3398 dbSNP
rs997093472 3400 dbSNP
rs1245188942 3410 dbSNP
rs538795000 3412 dbSNP
rs1019790647 3413 dbSNP
rs926197003 3416 dbSNP
rs1163984053 3417 dbSNP
rs1171033146 3429 dbSNP
rs755720592 3430 dbSNP
rs970291213 3434 dbSNP
rs1024505925 3437 dbSNP
rs1411337795 3439 dbSNP
rs748166671 3444 dbSNP
rs1052850652 3447 dbSNP
rs934333613 3452 dbSNP
rs904176816 3453 dbSNP
rs1337830696 3461 dbSNP
rs1216874660 3465 dbSNP
rs1183129600 3466 dbSNP
rs749891914 3469 dbSNP
rs767079872 3472 dbSNP
rs535566529 3481 dbSNP
rs961502969 3491 dbSNP
rs1322999939 3500 dbSNP
rs879476266 3511 dbSNP
rs1212974266 3514 dbSNP
rs148607862 3516 dbSNP
rs1244970991 3522 dbSNP
rs1016065983 3523 dbSNP
rs546643861 3526 dbSNP
rs948638670 3529 dbSNP
rs1240190620 3530 dbSNP
rs915780229 3530 dbSNP
rs1005515699 3532 dbSNP
rs1187103117 3541 dbSNP
rs1428499129 3543 dbSNP
rs1293057685 3545 dbSNP
rs888407450 3548 dbSNP
rs536471057 3556 dbSNP
rs992630507 3561 dbSNP
rs1215425016 3568 dbSNP
rs938480605 3569 dbSNP
rs1364303088 3570 dbSNP
rs996082331 3576 dbSNP
rs1271080269 3578 dbSNP
rs1345437920 3579 dbSNP
rs1222175895 3585 dbSNP
rs900402541 3587 dbSNP
rs1366267151 3599 dbSNP
rs1040227855 3603 dbSNP
rs182831998 3605 dbSNP
rs982856378 3606 dbSNP
rs1448576369 3610 dbSNP
rs891553707 3612 dbSNP
rs1267870421 3619 dbSNP
rs1052817563 3620 dbSNP
rs1428767938 3620 dbSNP
rs1429429629 3625 dbSNP
rs1469180988 3630 dbSNP
rs1156509271 3636 dbSNP
rs1386703428 3639 dbSNP
rs1400862543 3641 dbSNP
rs1299223080 3643 dbSNP
rs1365285589 3644 dbSNP
rs1403686597 3655 dbSNP
rs1285713139 3666 dbSNP
rs1346304342 3668 dbSNP
rs1421126685 3673 dbSNP
rs935735273 3677 dbSNP
rs1353149834 3678 dbSNP
rs925644825 3688 dbSNP
rs952850522 3691 dbSNP
rs1026967493 3702 dbSNP
rs1250705648 3711 dbSNP
rs1268962382 3714 dbSNP
rs979753264 3725 dbSNP
rs976108709 3726 dbSNP
rs552403820 3750 dbSNP
rs764029107 3755 dbSNP
rs1008418304 3756 dbSNP
rs762622558 3762 dbSNP
rs892609585 3764 dbSNP
rs993025049 3765 dbSNP
rs550900133 3766 dbSNP
rs1305549574 3767 dbSNP
rs1392096102 3769 dbSNP
rs765070984 3770 dbSNP
rs867889471 3774 dbSNP
rs1326959453 3778 dbSNP
rs984208386 3780 dbSNP
rs998598542 3787 dbSNP
rs904228327 3789 dbSNP
rs531217124 3790 dbSNP
rs562394045 3803 dbSNP
rs754647577 3806 dbSNP
rs532461267 3811 dbSNP
rs573188031 3816 dbSNP
rs1042723879 3818 dbSNP
rs1285233739 3825 dbSNP
rs1338705961 3833 dbSNP
rs143899516 3835 dbSNP
rs948358344 3842 dbSNP
rs1437870062 3845 dbSNP
rs192634524 3847 dbSNP
rs11377197 3849 dbSNP
rs398093752 3849 dbSNP
rs938529467 3851 dbSNP
rs1165866672 3853 dbSNP
rs759456889 3860 dbSNP
rs1356060676 3861 dbSNP
rs1369364356 3863 dbSNP
rs1461967051 3893 dbSNP
rs776693220 3905 dbSNP
rs908356384 3908 dbSNP
rs1398814194 3926 dbSNP
rs1447597042 3928 dbSNP
rs1168167274 3933 dbSNP
rs983293459 3936 dbSNP
rs770956282 3946 dbSNP
rs560309062 3951 dbSNP
rs760905341 3962 dbSNP
rs891663973 3967 dbSNP
rs534981724 3971 dbSNP
rs1052933487 3973 dbSNP
rs919954812 3974 dbSNP
rs999976634 3977 dbSNP
rs1306680790 3982 dbSNP
rs904255825 3990 dbSNP
rs1267208379 3991 dbSNP
rs1339552661 3998 dbSNP
rs1044103019 4008 dbSNP
rs1178273293 4008 dbSNP
rs1481856323 4020 dbSNP
rs1256533160 4021 dbSNP
rs1183799769 4025 dbSNP
rs77265799 4039 dbSNP
rs1257352407 4041 dbSNP
rs1198293331 4042 dbSNP
rs1191741309 4050 dbSNP
rs975418439 4059 dbSNP
rs1265103839 4060 dbSNP
rs1466543942 4060 dbSNP
rs948361026 4060 dbSNP
rs917515165 4066 dbSNP
rs540293172 4072 dbSNP
rs574716576 4082 dbSNP
rs773403722 4095 dbSNP
rs940282326 4106 dbSNP
rs143312823 4111 dbSNP
rs1303611776 4113 dbSNP
rs987038183 4127 dbSNP
rs957116903 4138 dbSNP
rs1297380961 4151 dbSNP
rs1391885484 4168 dbSNP
rs1341055806 4175 dbSNP
rs1222779140 4177 dbSNP
rs984239280 4178 dbSNP
rs1329008125 4190 dbSNP
rs575784971 4192 dbSNP
rs1484658083 4193 dbSNP
rs952820017 4197 dbSNP
rs1203763490 4207 dbSNP
rs1264257300 4210 dbSNP
rs544227503 4211 dbSNP
rs1199297856 4218 dbSNP
rs975450609 4225 dbSNP
rs575484904 4233 dbSNP
rs1481455983 4234 dbSNP
rs965721836 4242 dbSNP
rs1177987710 4244 dbSNP
rs968506436 4247 dbSNP
rs748461246 4261 dbSNP
rs1402167231 4269 dbSNP
rs1464050306 4272 dbSNP
rs747167967 4281 dbSNP
rs1290445046 4290 dbSNP
rs558530999 4305 dbSNP
rs1360877268 4310 dbSNP
rs1404300031 4314 dbSNP
rs1021756051 4326 dbSNP
rs1376557650 4330 dbSNP
rs1160529687 4334 dbSNP
rs1012557016 4337 dbSNP
rs1305593725 4337 dbSNP
rs1009265135 4343 dbSNP
rs1314799509 4346 dbSNP
rs1240686616 4372 dbSNP
rs894114208 4374 dbSNP
rs1488802051 4375 dbSNP
rs1222482774 4376 dbSNP
rs955929267 4376 dbSNP
rs1031533494 4378 dbSNP
rs1191849381 4386 dbSNP
rs879249654 4391 dbSNP
rs1407298353 4402 dbSNP
rs868471325 4409 dbSNP
rs1002725603 4422 dbSNP
rs1161515796 4425 dbSNP
rs1380755176 4425 dbSNP
rs1178359237 4427 dbSNP
rs1423753895 4469 dbSNP
rs1461950450 4476 dbSNP
rs141024173 4484 dbSNP
rs1198943917 4485 dbSNP
rs1044134501 4488 dbSNP
rs1344476729 4496 dbSNP
rs1000784192 4497 dbSNP
rs1012586910 4521 dbSNP
rs1392810512 4530 dbSNP
rs769057995 4540 dbSNP
rs572875368 4554 dbSNP
rs553066125 4555 dbSNP
rs1245713829 4561 dbSNP
rs536332203 4564 dbSNP
rs920024674 4574 dbSNP
rs1039786522 4582 dbSNP
rs887341342 4583 dbSNP
rs1048560043 4588 dbSNP
rs1306841136 4595 dbSNP
rs931450565 4597 dbSNP
rs1239091899 4601 dbSNP
rs1180809891 4606 dbSNP
rs1239034012 4612 dbSNP
rs1444168206 4618 dbSNP
rs542046925 4619 dbSNP
rs1386810766 4623 dbSNP
rs975945141 4629 dbSNP
rs944130541 4638 dbSNP
rs912584836 4642 dbSNP
rs1393905485 4646 dbSNP
rs988141311 4654 dbSNP
rs1400914826 4655 dbSNP
rs1169622201 4658 dbSNP
rs1352327633 4661 dbSNP
rs1288898444 4673 dbSNP
rs771131685 4679 dbSNP
rs912550113 4685 dbSNP
rs1381586663 4687 dbSNP
rs955959871 4696 dbSNP
rs1455825400 4699 dbSNP
rs1449962368 4702 dbSNP
rs1313402245 4704 dbSNP
rs987091918 4711 dbSNP
rs1378945328 4713 dbSNP
rs1229462361 4715 dbSNP
rs1031564563 4721 dbSNP
rs956971226 4721 dbSNP
rs1445687383 4728 dbSNP
rs978599723 4733 dbSNP
rs1200608880 4741 dbSNP
rs1258751757 4749 dbSNP
rs1461057494 4751 dbSNP
rs567551106 4756 dbSNP
rs1239032969 4760 dbSNP
rs1022794283 4771 dbSNP
rs1387459586 4774 dbSNP
rs1013113444 4788 dbSNP
rs1185752933 4791 dbSNP
rs1467055988 4792 dbSNP
rs979629500 4798 dbSNP
rs1404655418 4800 dbSNP
rs749286687 4801 dbSNP
rs895552315 4804 dbSNP
rs1467953269 4810 dbSNP
rs749745543 4814 dbSNP
rs1361321808 4819 dbSNP
rs1003858165 4836 dbSNP
rs1489240631 4839 dbSNP
rs1283719504 4840 dbSNP
rs1239335763 4844 dbSNP
rs1359946091 4845 dbSNP
rs1285697982 4846 dbSNP
rs1220951265 4848 dbSNP
rs1242196229 4849 dbSNP
rs1339459237 4850 dbSNP
rs1322880376 4851 dbSNP
rs1295690184 4854 dbSNP
rs1021340211 4855 dbSNP
rs1240099431 4855 dbSNP
rs1383346730 4855 dbSNP
rs887371034 4859 dbSNP
rs1162087861 4860 dbSNP
rs1428037965 4860 dbSNP
rs1298180987 4867 dbSNP
rs1479163132 4871 dbSNP
rs1173760800 4874 dbSNP
rs1425441989 4882 dbSNP
rs1399717565 4892 dbSNP
rs17166305 4896 dbSNP
rs1343785614 4902 dbSNP
rs1035315093 4905 dbSNP
rs931565065 4907 dbSNP
rs1472606861 4912 dbSNP
rs1345024701 4923 dbSNP
rs1221774871 4928 dbSNP
rs1276620026 4930 dbSNP
rs1346012504 4937 dbSNP
rs1373805945 4950 dbSNP
rs537386380 4953 dbSNP
rs1039861676 4961 dbSNP
rs755706173 4962 dbSNP
rs944144833 4965 dbSNP
rs1489820625 4968 dbSNP
rs912626125 4972 dbSNP
rs1047382452 4974 dbSNP
rs1156420062 4994 dbSNP
rs756779927 4999 dbSNP
rs1476922509 5006 dbSNP
rs1262534924 5017 dbSNP
rs988561370 5022 dbSNP
rs1159562695 5051 dbSNP
rs1490480372 5059 dbSNP
rs752143774 5066 dbSNP
rs1207785110 5074 dbSNP
rs566099754 5079 dbSNP
rs924526140 5085 dbSNP
rs866640008 5090 dbSNP
rs1355660923 5099 dbSNP
rs968615093 5104 dbSNP
rs571919442 5105 dbSNP
rs1290709996 5108 dbSNP
rs147288072 5109 dbSNP
rs1051105245 5127 dbSNP
rs754650344 5128 dbSNP
rs991319473 5128 dbSNP
rs1179298653 5131 dbSNP
rs924237434 5133 dbSNP
rs1439851760 5139 dbSNP
rs960076097 5143 dbSNP
rs1035414441 5159 dbSNP
rs1384946260 5171 dbSNP
rs758270606 5175 dbSNP
rs1456882748 5176 dbSNP
rs1165475532 5178 dbSNP
rs1391627355 5181 dbSNP
rs980066040 5187 dbSNP
rs946932297 5188 dbSNP
rs916726949 5197 dbSNP
rs772002964 5201 dbSNP
rs1314176116 5225 dbSNP
rs1026603047 5232 dbSNP
rs1338457123 5235 dbSNP
rs1246993677 5236 dbSNP
rs991235851 5243 dbSNP
rs995745320 5263 dbSNP
rs532159340 5267 dbSNP
rs900066189 5282 dbSNP
rs1259381327 5285 dbSNP
rs958439213 5292 dbSNP
rs1182570232 5321 dbSNP
rs1040295905 5340 dbSNP
rs1242960059 5341 dbSNP
rs1035367298 5363 dbSNP
rs1169929722 5364 dbSNP
rs1464232392 5368 dbSNP
rs765012155 5371 dbSNP
rs1200173014 5380 dbSNP
rs1480728850 5383 dbSNP
rs187714354 5387 dbSNP
rs891212753 5391 dbSNP
rs1196659774 5395 dbSNP
rs1466375258 5409 dbSNP
rs1399877903 5419 dbSNP
rs539703850 5419 dbSNP
rs1397582143 5423 dbSNP
rs1313075830 5431 dbSNP
rs1325812409 5433 dbSNP
rs951095118 5437 dbSNP
rs1025573275 5444 dbSNP
rs1317957663 5448 dbSNP
rs1052491380 5450 dbSNP
rs935399825 5454 dbSNP
rs183117669 5457 dbSNP
rs1018113501 5468 dbSNP
rs1256897171 5470 dbSNP
rs1257244039 5472 dbSNP
rs1006695858 5473 dbSNP
rs1192092123 5480 dbSNP
rs1043731835 5483 dbSNP
rs529811154 5484 dbSNP
rs1478183647 5485 dbSNP
rs1175734465 5490 dbSNP
rs1376139674 5492 dbSNP
rs915804980 5494 dbSNP
rs1051160559 5497 dbSNP
rs991742078 5505 dbSNP
rs1303232015 5507 dbSNP
rs1347761914 5508 dbSNP
rs935361773 5509 dbSNP
rs902497274 5510 dbSNP
rs1044003657 5511 dbSNP
rs1340657644 5519 dbSNP
rs959865455 5523 dbSNP
rs1222386797 5524 dbSNP
rs946954152 5525 dbSNP
rs1336761210 5527 dbSNP
rs561107435 5531 dbSNP
rs1333736157 5535 dbSNP
rs1233492881 5536 dbSNP
rs1444867555 5538 dbSNP
rs1256997418 5540 dbSNP
rs1399754823 5542 dbSNP
rs1177250442 5544 dbSNP
rs544403586 5561 dbSNP
rs916780721 5565 dbSNP
rs1488164426 5571 dbSNP
rs1215153789 5580 dbSNP
rs1265988433 5586 dbSNP
rs1423137235 5589 dbSNP
rs1488862886 5602 dbSNP
rs1198835198 5609 dbSNP
rs1170798991 5610 dbSNP
rs990954389 5620 dbSNP
rs1477639559 5630 dbSNP
rs1363083253 5631 dbSNP
rs1233275220 5640 dbSNP
rs1180224344 5643 dbSNP
rs939480986 5649 dbSNP
rs1456181737 5655 dbSNP
rs759418703 5660 dbSNP
rs928374828 5665 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.344 7.3e-4 0.268 7.2e-3 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.645 1.1e-3 -0.559 5.2e-3 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.506 1.1e-2 0.499 1.3e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.438 1.4e-2 0.580 1.2e-3 25 Click to see details
GSE38226 Liver fibrosis -0.431 2.6e-2 -0.336 6.8e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.494 4.3e-2 -0.396 9.0e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.354 4.9e-2 0.393 3.2e-2 23 Click to see details
GSE21849 B cell lymphoma 0.266 8.2e-2 0.198 1.5e-1 29 Click to see details
GSE19783 ER- ER- breast cancer 0.142 1.1e-1 0.146 1.0e-1 79 Click to see details
GSE17306 Multiple myeloma -0.172 1.2e-1 -0.230 5.6e-2 49 Click to see details
GSE27834 Pluripotent stem cells -0.253 1.7e-1 -0.238 1.9e-1 16 Click to see details
GSE28544 Breast cancer -0.184 1.9e-1 -0.582 1.4e-3 24 Click to see details
GSE19350 CNS germ cell tumors 0.258 2.1e-1 0.035 4.6e-1 12 Click to see details
GSE14794 Lymphoblastoid cells 0.082 2.2e-1 0.096 1.8e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.159 2.2e-1 0.088 3.4e-1 25 Click to see details
GSE19536 Breast cancer 0.066 2.6e-1 0.057 2.9e-1 100 Click to see details
GSE32688 Pancreatic cancer 0.119 2.6e-1 0.306 4.4e-2 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.118 2.9e-1 0.040 4.3e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.028 4.1e-1 0.058 3.2e-1 64 Click to see details
GSE17498 Multiple myeloma 0.006 4.9e-1 -0.013 4.7e-1 40 Click to see details
GSE17498 Multiple myeloma 0.006 4.9e-1 -0.013 4.7e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.837 0 -0.800 0 9 Click to see details
STAD -0.442 0.01 -0.497 0 32 Click to see details
THCA -0.28 0.02 -0.346 0 59 Click to see details
KICH 0.234 0.13 0.243 0.12 25 Click to see details
LUAD 0.345 0.14 0.524 0.04 12 Click to see details
KIRC 0.116 0.17 0.133 0.14 68 Click to see details
UCEC 0.228 0.17 0.147 0.27 19 Click to see details
PCPG -0.812 0.2 -1.000 0.5 3 Click to see details
PAAD 0.568 0.22 0.000 0.5 4 Click to see details
PRAD 0.1 0.24 0.007 0.48 50 Click to see details
ESCA 0.197 0.28 -0.136 0.35 11 Click to see details
LUSC -0.094 0.29 -0.127 0.22 38 Click to see details
HNSC 0.087 0.29 0.192 0.11 42 Click to see details
COAD -0.228 0.29 -0.524 0.09 8 Click to see details
CESC 0.542 0.32 0.500 0.33 3 Click to see details
BRCA -0.037 0.37 -0.016 0.44 84 Click to see details
KIRP -0.059 0.37 -0.078 0.34 32 Click to see details
LIHC -0.011 0.47 -0.070 0.32 49 Click to see details
BLCA 0.012 0.48 0.112 0.33 18 Click to see details
BLCA 0.012 0.48 0.112 0.33 18 Click to see details
BLCA 0.012 0.48 0.112 0.33 18 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3