miRTarBase - #MIRT728330 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AP3M1   
Synonyms -
Description adaptor related protein complex 3 mu 1 subunit
Transcript NM_012095   
Other Transcripts NM_207012   
Expression
Putative miRNA Targets on AP3M1
3'UTR of AP3M1
(miRNA target sites are highlighted)
>AP3M1|NM_012095|3'UTR
   1 GAAGAGGCCAAAATTCCTCAGGACCAGTTTGTTTTCCAAGTGTCATTACGATGTATCACTATTAGGTACCAAGTGAGTGG
  81 GAATACATATTCTAGTTAAAGCATTTGTGTCTAGCTACACACCGCTAACAAAGTTACTTAGTTATCAATGTAGGATTCTT
 161 AAGGAGCTTTAAGCTAAGGAAACCTTTTAGTGACTTAGCTTATTTTGTATCTTTTCACTTAGGAAGATTTTGGAGGTGAT
 241 TTTTTTCCATAGGAGGATACCATCTGGCGGCTGCACATTGTAACAGTAAAGGCAGAAAGCTGTAGTGATAACCTCTCTCC
 321 TAAAAGAGTTAACTGGTCTCATCCAGCAGAAGCTATCTTAAATCTGTGATGTGTCAGGTGCAGCCAAATATCACACCTTC
 401 TGATCTTAGCCATCCCAAACCAGTATCTGTCCCGAGAGGAAATTCCCCCCACCCCCAGAAGTTTACAGAAAACTGCCTCT
 481 TCAAGTGTTTGCCTTATTCAGCTTTTCACTTGTGCCATTAAGCAAGCACTGTAGCAAAAGCCACTTCCACATGGCCCTGG
 561 CAGGGAGCACTGCTGCTCCATGCTCCATTCTCACTGTACTTGGTATTGTATTTTTTATAAATAAGATTTTTATGTAAAGC
 641 TTAGAATTTGATTTACAGGGACCTTGCTGCAGTAAATACCATCTCAATTTTGTGCCACTGGTTCAGCTGTTAGCACAGTA
 721 AAAAAATCATTTGTATCAAAGGGGCAAATGCTTTATTAAGGTAGTAAAAGGGAACATTACTTCTGCTTTTAGGAAGTTAC
 801 TGCAAGCACAAGCATTTGTGCTTTTAAGCAAATTAAAGTAGTAAAAGAAAAACTTAAGTGAAACCTTTGCCATCTTCATG
 881 TTTTATAATATAAAGCTTACCCAACACCAGTTAAGCCATGGTTAACCTAAATGCCTCATGCCCCAGTTCAGCAAAAGGAG
 961 GAAAATGTGCCTGCCTCACAGTCATCAGTCTTTTTAAATCTTTTTTGTTGTTGTTCTTAAGGGTTTGAATTTGTCTGCAT
1041 TCCTTGTCTTTAGGGGAAATTCCCTTTTCATATTGTGTGCTTCCCAAAGCTATAGTCATAGATTTCTTCCAGAAACTATT
1121 GTCATAATTGTCACTGGAGTGCTTAAATATACGTACTATACTGACAAAATACATGGAAGTGAGTTATAATGAGGCAGAAA
1201 CAAAATCCTCGGTAACATTGATGATACTCTACCGATCACCGTGGTTTTGGAAAGTCAGTCAACAGTTGTATTATTGCACT
1281 CAATTTCATTGTGACATTTTATTTAACTTCTTCATCTTGGTGGTCCTTGCCCAGTTATTTTGCCTCATTAGACATCAAGA
1361 AATGGAGAAAGACTGAAAGTTAATATCTTAAGTGCTTGTTCTTCATGTTTCCTTCTTGTTATTTATGCTATTCTCTTTGT
1441 GGCTCCATTCTTCTTTCAATCTTCTCAGCTTATAACCGTCTTTCCCTTATGCTAAGGATAGCCCTTACACTCATCCCATC
1521 TATGCTGTCAAGGGCTGCTGGTTGGTGCTGGTACAAGGAGCCCACTCAGCAGTTTTCTTACCTTTGCCTGCCCTGCCTTT
1601 CATGGAATAAGAAAGGCAACGTTTTGCAGCTTCCAAATTTCTGAAGAAACTAATCTCAGATTGGCAGTTAAAGTCAAAAT
1681 GTTGCCAAATATTTATTCCTTTTGCCTAAGTTTGGCTACCCGGTTCAATTGCTTTTTATTTTTAATGTCTTGACTCTTCA
1761 GAGTTCGTACCTCAAAAGAACAATGAGAACATTTGCTTTGCTTTCTGCTGAATCCCTAATCTCAACAATCTATACCTGGA
1841 CTGTCCAGTTCTCCTCCTGTGCTATCTTCTCTTCTATCCAAGTAGAATGTACGCCAGGAGCTCCTTCCCTCTAGCAATTT
1921 CTACTAAAATGTCCAAGTAGAATGTTTCCTTTTACAATCAAATTACTGTATTTATTAATTTGCTAGAATCCAGTAAATCA
2001 TTTTGGTAGCTCTGGCTGTGCTATCAATAAAAAGATGAAAGCAACAAGTTGATTTTTTTTAGGTCTACTATTGATTGAAC
2081 ATTCTCCAATGGGCAAGGCTCATTGTCAAAGCAGGGTGAACATGATCAGATTTTCTTCTGCATCATCACACAAGCTGCGA
2161 GTGTTGCTGCAAAGCACTTCTCAGTACTCCTTCCCTAACCTCAGTATGTTAATAGCCATTCATACTTGGCTTAAGCATCA
2241 CCATTCTGGCCACAGTCTGAGAGATTAGTGATCAAAGCTCCCTTCCCTATCACTACCACCACCTACTGATAACAAAGATT
2321 TCTGAATACTTAGTAGTAGTAAAATATTTTTCAAGCACAGAGTTACAGCTAATCCTGGATCACTTGTTCTAAATTCATAA
2401 GGGAGTATATCAAGAGCAAATGAAGTAAATGATTCTTTCCTGCGTGTGGGAGTCACCATCATTTTATTCAAAGGGAGTTC
2481 CTGTGATAGGTTCATTCCTTAAGTGGTGCTACAGAAGGACCCTAGGAAAATGCTGATCTTGTCCTGAGAGGCAACTGATT
2561 TGAGAAAATGATTATACTACAGCAGGAAGGCAGCACCAGTGAACATATGGTAAATGGCAAAAACAAGACAGTTTTAGAAA
2641 CTGCTAATTCAGTAGCAGCCTTGGCCTTTCCCTTAACTCAAGCAGGCTGGAATCTGTCTTTATAGTCGGCAACTTTCCAA
2721 GATAAAGCAGTGATAATAGCAGTTGGCAACACTAAATATCAATATCATCACCCTTTAATGACATGTTACCCCTTTCAGAT
2801 CTAGAAAATCAGGGAAAAAGTGATGTCCCAACTCTACTCTAAAAACCTGCTCCTACTATTTTAGTCAGTGTTTCTTTAAG
2881 GAAGAAGAGGACTATGTCCCCAAAAGCTAACTCTGTTTTATAGCCCTGGTGGATCCCTGAAAACCCTATTTATTCTATAC
2961 TGGGCTTTGGAATATGAAAAATGGACCTGTGTGGCCGGGCGTGGTGGATCACACCTGTAATCCCAGCACTTTGGGAGGTC
3041 AAGGTGGGCGGATCACTTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACTCCATCTCTACTAAAAATAC
3121 AAAAATTAGCCAGGCATGGTGGCGCACACCTGTAATCCCAGCTACATGGGAGGCTGAGGCAGGAGAATTGCTTGAACCCG
3201 GGAGGCAGAGGTTGCAGTGAGCTGAGATTGCACCACTGCACTGCAGCCTGGGCAACAGAGCAAGTCTCTGTCTTGCAGCA
3281 GGGGGAAGGACCTGTGGTACTCCTACAAACTTAACAACTTTAGCTTTTCGGGGAACAGTGGTGGTCTCCACAGATAGCTA
3361 GAATCTTCTAAGATGAAAATAAACTGTTTCATCCAGCTGCTTTCTGCCTGTTAACCTTTGCCACTTCCATTCCTTCAAGT
3441 GTGTAATCCCCAGGGTTGTCTTGTATTACACACATCCTTGTTAAGTAAATATACCACTGTTGATTTCTTCTTCCAGTGCA
3521 ACATTTGGATTAAATAAAAATCTTTAGTTTCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||:|::  | |||:|||| 
Target 5' caCAAGCTGCGA-GTGTTGCTg 3'
2149 - 2169 143.00 -17.80
2
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' ctggcagggagcacTGCTGCTc 3'
557 - 578 140.00 -11.10
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|||:| || | ||:||:| 
Target 5' ttTAAATC-TTTTTTGTTGTTg 3'
993 - 1013 131.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31597989 49 COSMIC
COSN30517267 50 COSMIC
COSN31514098 60 COSMIC
COSN30174795 154 COSMIC
COSN8720388 349 COSMIC
COSN20107289 433 COSMIC
COSN17548717 727 COSMIC
COSN31486383 952 COSMIC
COSN7068436 1152 COSMIC
COSN17076263 1323 COSMIC
COSN20921749 1874 COSMIC
COSN15668334 2036 COSMIC
COSN24050514 2161 COSMIC
COSN32085132 2360 COSMIC
COSN5290664 2401 COSMIC
COSN25574656 2603 COSMIC
COSN10072565 2736 COSMIC
COSN1500449 3188 COSMIC
COSN22787118 3455 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760582250 4 dbSNP
rs377517231 11 dbSNP
rs1272577077 17 dbSNP
rs771577717 19 dbSNP
rs745326128 20 dbSNP
rs1385725355 24 dbSNP
rs778562599 30 dbSNP
rs770581238 31 dbSNP
rs1431647804 34 dbSNP
rs749659855 38 dbSNP
rs1283286564 47 dbSNP
rs374966750 49 dbSNP
rs756633811 50 dbSNP
rs377762958 51 dbSNP
rs762688784 52 dbSNP
rs970003636 56 dbSNP
rs1470797970 58 dbSNP
rs1177180807 61 dbSNP
rs1447724143 63 dbSNP
rs1402580145 67 dbSNP
rs917235584 70 dbSNP
rs555037034 77 dbSNP
rs148177038 81 dbSNP
rs944877705 87 dbSNP
rs1465580529 93 dbSNP
rs188602460 102 dbSNP
rs765354909 106 dbSNP
rs557914584 111 dbSNP
rs1423618974 122 dbSNP
rs759718423 123 dbSNP
rs60894146 124 dbSNP
rs967994053 125 dbSNP
rs1178890009 130 dbSNP
rs1441115913 132 dbSNP
rs920595912 135 dbSNP
rs1240844813 137 dbSNP
rs995854320 144 dbSNP
rs1483281483 148 dbSNP
rs1358985331 173 dbSNP
rs184307043 174 dbSNP
rs962614464 179 dbSNP
rs547980430 182 dbSNP
rs770973823 183 dbSNP
rs1015495114 184 dbSNP
rs1438510764 185 dbSNP
rs982647715 188 dbSNP
rs1008683575 190 dbSNP
rs1286409879 203 dbSNP
rs1446976457 209 dbSNP
rs535743850 229 dbSNP
rs1241195023 247 dbSNP
rs147523157 247 dbSNP
rs1184530797 256 dbSNP
rs141700296 258 dbSNP
rs139251573 261 dbSNP
rs930784447 262 dbSNP
rs1013090558 264 dbSNP
rs958456349 268 dbSNP
rs879114540 269 dbSNP
rs948955244 271 dbSNP
rs917288084 277 dbSNP
rs1033102565 290 dbSNP
rs1454573620 302 dbSNP
rs992780726 310 dbSNP
rs1381826386 312 dbSNP
rs1242857804 315 dbSNP
rs1272094066 317 dbSNP
rs956156257 325 dbSNP
rs924649713 328 dbSNP
rs1256247399 340 dbSNP
rs999892779 352 dbSNP
rs191405240 354 dbSNP
rs1204931521 355 dbSNP
rs902830492 366 dbSNP
rs868070271 371 dbSNP
rs968254885 378 dbSNP
rs1441096488 386 dbSNP
rs1195822249 404 dbSNP
rs564235793 405 dbSNP
rs1374373289 407 dbSNP
rs1042030239 411 dbSNP
rs1009144512 412 dbSNP
rs1470900380 415 dbSNP
rs974679594 415 dbSNP
rs1337370138 425 dbSNP
rs1207591387 427 dbSNP
rs34725483 433 dbSNP
rs3830382 434 dbSNP
rs79821899 434 dbSNP
rs1327184154 436 dbSNP
rs386371831 436 dbSNP
rs201890718 439 dbSNP
rs1430347505 442 dbSNP
rs551832450 445 dbSNP
rs527787427 449 dbSNP
rs932078226 452 dbSNP
rs1163625463 456 dbSNP
rs773802648 474 dbSNP
rs920661176 486 dbSNP
rs760630555 491 dbSNP
rs964617628 499 dbSNP
rs559238300 504 dbSNP
rs1207207072 511 dbSNP
rs1262941831 513 dbSNP
rs1038179906 517 dbSNP
rs1192539573 522 dbSNP
rs1260384417 533 dbSNP
rs1482166204 544 dbSNP
rs1257590644 561 dbSNP
rs1481106325 568 dbSNP
rs1176558574 575 dbSNP
rs940720356 579 dbSNP
rs907880563 580 dbSNP
rs1263780590 590 dbSNP
rs1218582938 603 dbSNP
rs1356990697 613 dbSNP
rs1263971257 614 dbSNP
rs1419293663 620 dbSNP
rs772593484 623 dbSNP
rs565510747 624 dbSNP
rs1314891930 625 dbSNP
rs1026455458 631 dbSNP
rs994584227 642 dbSNP
rs917075188 645 dbSNP
rs1241896595 650 dbSNP
rs1261651886 656 dbSNP
rs1340497070 664 dbSNP
rs1299327800 671 dbSNP
rs1044541329 675 dbSNP
rs573821842 679 dbSNP
rs991306562 687 dbSNP
rs1199433920 698 dbSNP
rs562052442 701 dbSNP
rs1266122784 708 dbSNP
rs1431363661 711 dbSNP
rs1183952470 721 dbSNP
rs949007124 725 dbSNP
rs1402314562 727 dbSNP
rs896038302 727 dbSNP
rs1367621042 728 dbSNP
rs1425600608 733 dbSNP
rs1293013554 744 dbSNP
rs958768639 752 dbSNP
rs1364026934 754 dbSNP
rs1393626874 755 dbSNP
rs1308281865 756 dbSNP
rs543029058 758 dbSNP
rs1292599395 759 dbSNP
rs1458055596 770 dbSNP
rs1376857927 773 dbSNP
rs1369732662 776 dbSNP
rs576154406 783 dbSNP
rs145833586 785 dbSNP
rs1361130949 799 dbSNP
rs879235555 812 dbSNP
rs1222851953 813 dbSNP
rs1032784406 818 dbSNP
rs1264316918 821 dbSNP
rs999942355 822 dbSNP
rs1487246613 833 dbSNP
rs1197059569 835 dbSNP
rs967068764 841 dbSNP
rs73280501 843 dbSNP
rs1009155900 847 dbSNP
rs1195748350 849 dbSNP
rs979282638 849 dbSNP
rs534166080 850 dbSNP
rs915115349 852 dbSNP
rs1164410376 853 dbSNP
rs890688354 855 dbSNP
rs1488950586 882 dbSNP
rs769321611 885 dbSNP
rs1216936744 889 dbSNP
rs1445288708 893 dbSNP
rs1317369810 904 dbSNP
rs1279390664 905 dbSNP
rs996388762 915 dbSNP
rs1018852005 918 dbSNP
rs1329736851 937 dbSNP
rs1228511466 938 dbSNP
rs899311077 943 dbSNP
rs1319584267 944 dbSNP
rs1300973893 945 dbSNP
rs1037831620 946 dbSNP
rs940772814 950 dbSNP
rs950465169 955 dbSNP
rs1369084061 966 dbSNP
rs769310568 967 dbSNP
rs1387678042 970 dbSNP
rs1461566668 973 dbSNP
rs907891989 979 dbSNP
rs1181103795 990 dbSNP
rs1411818919 997 dbSNP
rs1392494061 998 dbSNP
rs1025962654 999 dbSNP
rs1046344531 1000 dbSNP
rs995035117 1005 dbSNP
rs898911427 1007 dbSNP
rs1407499331 1013 dbSNP
rs949981638 1023 dbSNP
rs1301464743 1033 dbSNP
rs1464711810 1035 dbSNP
rs149064829 1041 dbSNP
rs991795606 1046 dbSNP
rs958602567 1048 dbSNP
rs1479391427 1051 dbSNP
rs879878830 1068 dbSNP
rs1376964908 1074 dbSNP
rs925770932 1085 dbSNP
rs1264888043 1090 dbSNP
rs1312710507 1092 dbSNP
rs867095251 1093 dbSNP
rs934914259 1098 dbSNP
rs374552820 1115 dbSNP
rs1187368396 1116 dbSNP
rs745451956 1118 dbSNP
rs1269818693 1134 dbSNP
rs978514512 1136 dbSNP
rs545559405 1142 dbSNP
rs554037916 1144 dbSNP
rs1258741982 1151 dbSNP
rs536080654 1152 dbSNP
rs780574046 1153 dbSNP
rs1019979745 1156 dbSNP
rs987106723 1171 dbSNP
rs921312932 1173 dbSNP
rs1347357913 1181 dbSNP
rs974594536 1181 dbSNP
rs1298378517 1183 dbSNP
rs943156234 1188 dbSNP
rs1397518726 1192 dbSNP
rs954512988 1193 dbSNP
rs1368193943 1195 dbSNP
rs756734253 1200 dbSNP
rs1276201790 1201 dbSNP
rs996829704 1210 dbSNP
rs899367643 1211 dbSNP
rs751520694 1218 dbSNP
rs918952931 1226 dbSNP
rs777500282 1234 dbSNP
rs1487432951 1237 dbSNP
rs3812627 1240 dbSNP
rs1224740927 1241 dbSNP
rs552856982 1249 dbSNP
rs1477971400 1258 dbSNP
rs963100897 1269 dbSNP
rs886504262 1280 dbSNP
rs1046449074 1281 dbSNP
rs1013051227 1282 dbSNP
rs1332835221 1290 dbSNP
rs373183132 1294 dbSNP
rs189262733 1296 dbSNP
rs1417538386 1305 dbSNP
rs144904849 1321 dbSNP
rs1173085867 1322 dbSNP
rs895134512 1323 dbSNP
rs1035842592 1326 dbSNP
rs1435642976 1329 dbSNP
rs1467394957 1330 dbSNP
rs1361788916 1331 dbSNP
rs1272949996 1355 dbSNP
rs1375480864 1367 dbSNP
rs1055747614 1370 dbSNP
rs1308276261 1376 dbSNP
rs1351776823 1386 dbSNP
rs1225055937 1387 dbSNP
rs1439276062 1389 dbSNP
rs1290657669 1394 dbSNP
rs937220433 1405 dbSNP
rs1451062166 1408 dbSNP
rs925811049 1411 dbSNP
rs868021822 1412 dbSNP
rs903425776 1415 dbSNP
rs1219508640 1418 dbSNP
rs1238989988 1425 dbSNP
rs1180643856 1429 dbSNP
rs1043455203 1430 dbSNP
rs1011563336 1435 dbSNP
rs1278624539 1437 dbSNP
rs537836370 1441 dbSNP
rs1165133399 1458 dbSNP
rs978568406 1461 dbSNP
rs1404200599 1466 dbSNP
rs899933316 1473 dbSNP
rs1201462837 1474 dbSNP
rs77201605 1477 dbSNP
rs552155180 1478 dbSNP
rs913014830 1480 dbSNP
rs527753290 1491 dbSNP
rs944086899 1497 dbSNP
rs1284963024 1519 dbSNP
rs1354029476 1522 dbSNP
rs1226623811 1529 dbSNP
rs1275282072 1531 dbSNP
rs1319201100 1571 dbSNP
rs1310977924 1574 dbSNP
rs1198609271 1581 dbSNP
rs1445259202 1592 dbSNP
rs868750759 1595 dbSNP
rs1339304241 1603 dbSNP
rs1334758755 1605 dbSNP
rs987201721 1613 dbSNP
rs527355064 1618 dbSNP
rs560653272 1620 dbSNP
rs184380198 1621 dbSNP
rs929222731 1623 dbSNP
rs975032605 1626 dbSNP
rs560306775 1639 dbSNP
rs1425201583 1643 dbSNP
rs758238153 1656 dbSNP
rs1169813820 1659 dbSNP
rs368973450 1662 dbSNP
rs1420060612 1663 dbSNP
rs1454314366 1666 dbSNP
rs1016407312 1677 dbSNP
rs973496292 1681 dbSNP
rs1005034570 1689 dbSNP
rs1446171275 1691 dbSNP
rs886587892 1694 dbSNP
rs962985649 1714 dbSNP
rs529116157 1721 dbSNP
rs1160512354 1722 dbSNP
rs1218119971 1723 dbSNP
rs1256674665 1729 dbSNP
rs1471855964 1739 dbSNP
rs1014077244 1740 dbSNP
rs1278431009 1746 dbSNP
rs1236921367 1748 dbSNP
rs895155152 1749 dbSNP
rs1441482231 1752 dbSNP
rs1185024968 1754 dbSNP
rs1264908958 1759 dbSNP
rs1055494912 1767 dbSNP
rs1192302221 1772 dbSNP
rs561832167 1775 dbSNP
rs769564082 1784 dbSNP
rs1216414113 1785 dbSNP
rs1401286714 1786 dbSNP
rs959777917 1793 dbSNP
rs149869240 1800 dbSNP
rs531648433 1806 dbSNP
rs1341398488 1822 dbSNP
rs949630575 1827 dbSNP
rs1226201830 1830 dbSNP
rs945887246 1832 dbSNP
rs1347927084 1835 dbSNP
rs1355063236 1841 dbSNP
rs998997623 1848 dbSNP
rs1343254018 1851 dbSNP
rs567197082 1859 dbSNP
rs913068739 1867 dbSNP
rs1488419728 1872 dbSNP
rs780515181 1876 dbSNP
rs1021850560 1879 dbSNP
rs1474331418 1881 dbSNP
rs1260493313 1888 dbSNP
rs987254081 1891 dbSNP
rs6688 1892 dbSNP
rs1234820091 1893 dbSNP
rs1199561178 1902 dbSNP
rs780733722 1908 dbSNP
rs974793128 1909 dbSNP
rs1400455964 1948 dbSNP
rs963677651 1949 dbSNP
rs1362152396 1954 dbSNP
rs1361349286 1958 dbSNP
rs909490052 1965 dbSNP
rs1419392896 1967 dbSNP
rs983663430 1969 dbSNP
rs1296415844 1976 dbSNP
rs1008350909 1977 dbSNP
rs950918363 1984 dbSNP
rs891177559 1995 dbSNP
rs1025062863 2005 dbSNP
rs1301138632 2009 dbSNP
rs140398345 2020 dbSNP
rs1241548400 2024 dbSNP
rs1310522533 2034 dbSNP
rs1353962599 2040 dbSNP
rs1239023803 2052 dbSNP
rs929130433 2056 dbSNP
rs919179849 2061 dbSNP
rs1163956650 2064 dbSNP
rs766386841 2067 dbSNP
rs574491065 2070 dbSNP
rs941932668 2077 dbSNP
rs1001302361 2089 dbSNP
rs193218236 2093 dbSNP
rs991106337 2103 dbSNP
rs1370449627 2112 dbSNP
rs1043035474 2114 dbSNP
rs1458413547 2118 dbSNP
rs1293027824 2119 dbSNP
rs569256894 2121 dbSNP
rs1010151386 2132 dbSNP
rs1389185142 2143 dbSNP
rs1449733120 2154 dbSNP
rs542051107 2155 dbSNP
rs79682050 2156 dbSNP
rs556487985 2158 dbSNP
rs369534073 2159 dbSNP
rs978007168 2178 dbSNP
rs1218966160 2199 dbSNP
rs1323153562 2207 dbSNP
rs1051995592 2208 dbSNP
rs1264414205 2212 dbSNP
rs3180427 2221 dbSNP
rs1200496722 2235 dbSNP
rs751474313 2241 dbSNP
rs1211176108 2243 dbSNP
rs772689559 2251 dbSNP
rs1457122528 2253 dbSNP
rs1277497964 2258 dbSNP
rs1258458511 2259 dbSNP
rs1219108950 2260 dbSNP
rs147500597 2267 dbSNP
rs1272818677 2275 dbSNP
rs1366834539 2276 dbSNP
rs1018297031 2280 dbSNP
rs758135855 2284 dbSNP
rs1008193968 2285 dbSNP
rs1038760352 2286 dbSNP
rs1349572373 2289 dbSNP
rs1400258548 2291 dbSNP
rs1324445295 2293 dbSNP
rs879483046 2293 dbSNP
rs1304977422 2295 dbSNP
rs891222574 2297 dbSNP
rs1025697630 2300 dbSNP
rs1396319640 2302 dbSNP
rs762329139 2306 dbSNP
rs188860202 2310 dbSNP
rs576944686 2314 dbSNP
rs1258555163 2322 dbSNP
rs950928449 2329 dbSNP
rs558491207 2333 dbSNP
rs1483682102 2339 dbSNP
rs1181544710 2340 dbSNP
rs1254357847 2342 dbSNP
rs1422231413 2342 dbSNP
rs1189892100 2343 dbSNP
rs918103133 2355 dbSNP
rs746248611 2363 dbSNP
rs1477898938 2368 dbSNP
rs1464576663 2378 dbSNP
rs894361113 2392 dbSNP
rs1178685662 2397 dbSNP
rs1360152200 2411 dbSNP
rs1466211572 2414 dbSNP
rs1301850401 2415 dbSNP
rs559979238 2430 dbSNP
rs992706765 2433 dbSNP
rs938334289 2439 dbSNP
rs928278135 2442 dbSNP
rs372335704 2443 dbSNP
rs1303104646 2444 dbSNP
rs371449108 2454 dbSNP
rs143479959 2457 dbSNP
rs139939962 2473 dbSNP
rs780848524 2475 dbSNP
rs1217421232 2483 dbSNP
rs1218494693 2488 dbSNP
rs1262655268 2488 dbSNP
rs964293444 2490 dbSNP
rs1426514143 2499 dbSNP
rs1367956264 2502 dbSNP
rs1010161387 2506 dbSNP
rs1392861655 2507 dbSNP
rs770459903 2520 dbSNP
rs548710648 2523 dbSNP
rs1359397443 2535 dbSNP
rs1374804247 2541 dbSNP
rs1428061483 2541 dbSNP
rs746498728 2548 dbSNP
rs1330809903 2555 dbSNP
rs1026046621 2557 dbSNP
rs994301339 2562 dbSNP
rs184258926 2577 dbSNP
rs1241202482 2580 dbSNP
rs1285373623 2584 dbSNP
rs997791009 2596 dbSNP
rs1356851715 2600 dbSNP
rs568207763 2608 dbSNP
rs1488473376 2609 dbSNP
rs1192139335 2611 dbSNP
rs192235248 2615 dbSNP
rs898565519 2619 dbSNP
rs61863611 2624 dbSNP
rs1005968737 2626 dbSNP
rs941748045 2629 dbSNP
rs758325996 2631 dbSNP
rs878922685 2639 dbSNP
rs564405724 2643 dbSNP
rs1350389678 2646 dbSNP
rs1435757334 2654 dbSNP
rs1195139665 2659 dbSNP
rs1047361456 2667 dbSNP
rs1323608933 2668 dbSNP
rs1378901788 2678 dbSNP
rs1232368337 2679 dbSNP
rs1437397142 2692 dbSNP
rs752562244 2696 dbSNP
rs757491089 2705 dbSNP
rs918192639 2707 dbSNP
rs1348825996 2708 dbSNP
rs1230089195 2712 dbSNP
rs1290761092 2719 dbSNP
rs1321609586 2725 dbSNP
rs1212417575 2734 dbSNP
rs938582518 2747 dbSNP
rs906909218 2752 dbSNP
rs992404581 2755 dbSNP
rs1231900581 2756 dbSNP
rs1468336480 2759 dbSNP
rs1491148178 2759 dbSNP
rs1491122719 2760 dbSNP
rs1481324268 2762 dbSNP
rs778583580 2764 dbSNP
rs1162643110 2766 dbSNP
rs1235664649 2768 dbSNP
rs945824740 2770 dbSNP
rs1330493022 2783 dbSNP
rs753901981 2785 dbSNP
rs774853185 2788 dbSNP
rs1450509807 2790 dbSNP
rs1284831467 2800 dbSNP
rs1312579300 2809 dbSNP
rs1282146485 2810 dbSNP
rs1237649631 2812 dbSNP
rs1351842319 2813 dbSNP
rs6480718 2814 dbSNP
rs1260472618 2816 dbSNP
rs754033936 2820 dbSNP
rs1198399922 2836 dbSNP
rs11818769 2841 dbSNP
rs979933822 2850 dbSNP
rs766589778 2855 dbSNP
rs559980635 2858 dbSNP
rs369118550 2859 dbSNP
rs563570062 2859 dbSNP
rs1447887240 2873 dbSNP
rs955810255 2878 dbSNP
rs75145986 2881 dbSNP
rs1478144515 2886 dbSNP
rs1167074491 2889 dbSNP
rs1394127486 2897 dbSNP
rs918627213 2898 dbSNP
rs1335050478 2899 dbSNP
rs756315700 2900 dbSNP
rs1379369228 2901 dbSNP
rs1280245524 2902 dbSNP
rs1158802668 2913 dbSNP
rs1279634946 2913 dbSNP
rs1012275294 2915 dbSNP
rs78354727 2915 dbSNP
rs962769957 2915 dbSNP
rs1420363879 2925 dbSNP
rs1347517799 2928 dbSNP
rs958556703 2931 dbSNP
rs79916214 2932 dbSNP
rs1485149341 2938 dbSNP
rs1208093482 2939 dbSNP
rs1264750306 2945 dbSNP
rs1488563430 2950 dbSNP
rs1192319169 2955 dbSNP
rs1371296139 2957 dbSNP
rs1181240615 2964 dbSNP
rs1030701191 2969 dbSNP
rs1394685893 2971 dbSNP
rs997432493 2984 dbSNP
rs907080731 2991 dbSNP
rs1361310684 2994 dbSNP
rs1259498970 2996 dbSNP
rs186973198 2997 dbSNP
rs577108423 3000 dbSNP
rs368382481 3001 dbSNP
rs1274699887 3003 dbSNP
rs887498713 3008 dbSNP
rs1231686516 3015 dbSNP
rs1010295038 3022 dbSNP
rs892903561 3023 dbSNP
rs1054234328 3027 dbSNP
rs1259501515 3032 dbSNP
rs1047456459 3033 dbSNP
rs558853921 3037 dbSNP
rs1199303665 3047 dbSNP
rs533941154 3049 dbSNP
rs566898771 3050 dbSNP
rs1160634768 3051 dbSNP
rs896150718 3059 dbSNP
rs1453064624 3060 dbSNP
rs942407812 3064 dbSNP
rs1393500677 3065 dbSNP
rs763337128 3070 dbSNP
rs1057152919 3072 dbSNP
rs182701684 3073 dbSNP
rs12416053 3076 dbSNP
rs1353985014 3090 dbSNP
rs1237682858 3106 dbSNP
rs1258502509 3107 dbSNP
rs1358345018 3108 dbSNP
rs1356717381 3117 dbSNP
rs926787684 3120 dbSNP
rs934265946 3132 dbSNP
rs1180283882 3134 dbSNP
rs1398543990 3137 dbSNP
rs1360220407 3139 dbSNP
rs979574911 3142 dbSNP
rs1238958734 3143 dbSNP
rs6480717 3144 dbSNP
rs374345967 3147 dbSNP
rs1458494155 3149 dbSNP
rs1454984770 3152 dbSNP
rs1366318316 3178 dbSNP
rs564244232 3186 dbSNP
rs1467454415 3188 dbSNP
rs532870275 3194 dbSNP
rs774842891 3199 dbSNP
rs549984308 3200 dbSNP
rs972775536 3201 dbSNP
rs914019117 3207 dbSNP
rs1304206860 3212 dbSNP
rs4746174 3216 dbSNP
rs1233404019 3221 dbSNP
rs1272400472 3228 dbSNP
rs955390746 3230 dbSNP
rs1200293383 3231 dbSNP
rs570755460 3236 dbSNP
rs976406141 3239 dbSNP
rs1194248222 3243 dbSNP
rs964632855 3246 dbSNP
rs1263571440 3247 dbSNP
rs959443245 3248 dbSNP
rs1424402592 3250 dbSNP
rs1486997443 3252 dbSNP
rs1263883811 3253 dbSNP
rs1034195426 3272 dbSNP
rs552542751 3285 dbSNP
rs1479125606 3288 dbSNP
rs1017866998 3289 dbSNP
rs527598135 3295 dbSNP
rs1354371197 3306 dbSNP
rs1295667589 3311 dbSNP
rs10824075 3314 dbSNP
rs1403916218 3316 dbSNP
rs1414806066 3321 dbSNP
rs1340325528 3325 dbSNP
rs772713179 3329 dbSNP
rs1020593267 3330 dbSNP
rs1296233710 3336 dbSNP
rs1306663952 3336 dbSNP
rs1224974874 3340 dbSNP
rs771508580 3343 dbSNP
rs1483732647 3346 dbSNP
rs1210244409 3347 dbSNP
rs547139795 3353 dbSNP
rs1388203869 3358 dbSNP
rs765541839 3358 dbSNP
rs1194974183 3361 dbSNP
rs892829177 3363 dbSNP
rs993200488 3365 dbSNP
rs1457975122 3372 dbSNP
rs1427044494 3374 dbSNP
rs1178706845 3376 dbSNP
rs1378992128 3388 dbSNP
rs1395962543 3391 dbSNP
rs547897998 3395 dbSNP
rs1054119962 3406 dbSNP
rs1056095720 3412 dbSNP
rs1289308559 3413 dbSNP
rs938283141 3414 dbSNP
rs529763649 3418 dbSNP
rs1212568838 3420 dbSNP
rs1303219635 3424 dbSNP
rs1348828660 3429 dbSNP
rs1233903334 3437 dbSNP
rs1424217282 3440 dbSNP
rs1278488866 3441 dbSNP
rs76454996 3443 dbSNP
rs1431220622 3449 dbSNP
rs1241990668 3452 dbSNP
rs1051272859 3454 dbSNP
rs533653446 3455 dbSNP
rs1268546289 3458 dbSNP
rs1454431670 3459 dbSNP
rs934127940 3462 dbSNP
rs1190766090 3463 dbSNP
rs750617799 3465 dbSNP
rs946893917 3476 dbSNP
rs897416572 3492 dbSNP
rs914062903 3504 dbSNP
rs544380855 3505 dbSNP
rs1295044973 3507 dbSNP
rs1275081032 3514 dbSNP
rs1371402389 3514 dbSNP
rs1301441980 3533 dbSNP
rs1379418083 3537 dbSNP
rs1052527163 3541 dbSNP
rs528707955 3543 dbSNP
rs941614996 3546 dbSNP
rs922611475 3547 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.413 5.2e-5 0.310 2.2e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.638 1.2e-3 0.696 3.3e-4 20 Click to see details
GSE19350 CNS germ cell tumors 0.64 1.2e-2 0.357 1.3e-1 12 Click to see details
GSE21849 B cell lymphoma 0.391 1.8e-2 0.482 4.1e-3 29 Click to see details
GSE28260 Renal cortex and medulla -0.568 2.1e-2 -0.560 2.3e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.36 4.6e-2 -0.242 1.3e-1 23 Click to see details
GSE19783 ER- ER- breast cancer 0.187 4.9e-2 0.129 1.3e-1 79 Click to see details
GSE38226 Liver fibrosis -0.356 5.7e-2 -0.266 1.2e-1 21 Click to see details
GSE19536 Breast cancer 0.125 1.1e-1 0.121 1.2e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.146 1.2e-1 -0.109 2.0e-1 64 Click to see details
GSE14794 Lymphoblastoid cells 0.096 1.8e-1 0.074 2.4e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.203 2.3e-1 0.109 3.4e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.141 2.8e-1 -0.051 4.2e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.08 3.6e-1 0.114 3.0e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.058 3.8e-1 0.143 2.2e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.048 4.1e-1 -0.083 3.5e-1 25 Click to see details
GSE28544 Breast cancer 0.042 4.2e-1 0.278 9.4e-2 24 Click to see details
GSE17306 Multiple myeloma 0.026 4.3e-1 0.044 3.8e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.015 4.7e-1 0.023 4.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.015 4.7e-1 0.023 4.6e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD 0.346 0.01 0.230 0.05 50 Click to see details
STAD -0.425 0.01 -0.579 0 32 Click to see details
CHOL -0.717 0.01 -0.733 0.01 9 Click to see details
BLCA -0.251 0.16 -0.112 0.33 18 Click to see details
KICH -0.208 0.16 -0.308 0.07 25 Click to see details
KIRC 0.114 0.18 0.095 0.22 68 Click to see details
HNSC -0.134 0.2 -0.119 0.23 42 Click to see details
BRCA 0.088 0.21 0.080 0.23 84 Click to see details
UCEC 0.165 0.25 0.044 0.43 19 Click to see details
THCA -0.087 0.26 -0.178 0.09 59 Click to see details
KIRP 0.104 0.29 0.016 0.47 32 Click to see details
PAAD 0.402 0.3 0.600 0.2 4 Click to see details
CESC 0.55 0.31 0.500 0.33 3 Click to see details
COAD -0.166 0.35 -0.452 0.13 8 Click to see details
LUSC 0.049 0.39 -0.035 0.42 38 Click to see details
PCPG -0.333 0.39 -0.500 0.33 3 Click to see details
LUAD -0.076 0.41 0.007 0.49 12 Click to see details
ESCA 0.047 0.45 0.136 0.35 11 Click to see details
LIHC 0.002 0.49 0.009 0.48 49 Click to see details
LIHC 0.002 0.49 0.009 0.48 49 Click to see details
LIHC 0.002 0.49 0.009 0.48 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*