miRTarBase - #MIRT728265 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATP13A3   
Synonyms AFURS1
Description ATPase 13A3
Transcript NM_024524   
Expression
Putative miRNA Targets on ATP13A3
3'UTR of ATP13A3
(miRNA target sites are highlighted)
>ATP13A3|NM_024524|3'UTR
   1 CAGTGAATCAGTCTCAGTGGTATTGCTGATAGCAGTATTCAGGAATATGTGATTTTAGGAGTTTCTGATCCTGTGTGTCA
  81 GAATGGCACTAGTTCAGTTTATGTCCCTTCTGATATAGTAGCTTATTTGACAGCTTTGCTCTTCCTTAAAATAAAAACAG
 161 AAAAATATATCGTCCTAACAGTTAAATTAACAATCAATCCATAAAGTCCTATATCTTCATTCAGCAACCCAAATATTACA
 241 TACATTTCCAGAATTTTCTTGATTGTTACTTTCAGTGATATTCTTTATATTGGGTACAGGAGAAGTTTGGTGTTTGGTAG
 321 GTTTTTCAACATTAGTTTTTGAGACTAGTTTACCTCTTCACATTTATGCTCACAACCCTCTTGTTAGAAAAGTCTGTGTT
 401 TATATACAGGCTGTAAGTTTGTGATTGATAAAAAGAAGATGAGTGTTAATTAGCCTCCAGTGAAAATATACTGAAAGCCT
 481 GTTTTCATTTGATTCCAATGTTTCTTCCAAAGAATTCTGTATAAACATATGCCAATTCCCTATGATGGTCTAGAGTTAGG
 561 AATGAGTGTTTATGGTGTTGCTTATAGAACAACTCAGGTAATCTCCATTTCTGGTTTTATATTTTCTGTACAAACTGCCT
 641 GGGTTTTATTTTTCTAATCAGCAAGGTGCTTCACTGCCTTCTTGAGACGCCTCTCAAAGCTCTTAAATGGCTCCTGTGCT
 721 ATGTGTGGTGTTGGCAGTCTAATTTGCTTCTGTTAAATGTTGTAGAACCTTTTTCACTAGGAAATAAGATTCATTTCTTT
 801 CGGCAGTAGATGTAGATTCATCTTTTAACGTTTCTTCAAATTTGTTTCTGTCAGGCTTTGTGTTATTTTAAATGGTTTTT
 881 TAAAATTTTCTTCTATGTTTTCAATTACCTAAAGACATAGGATAATAGTTTTTTTTAAGTTAGAATTTTACCTCATAAAA
 961 TTTTTTGAGGTTTGATGTATGTCTCTGTCTTATCAATAATGAGGCTTAAAAAATACTGGATTTGAATGGCTGCCGTTTTT
1041 TCAAAGCAATATGAATTTGATGAGTTTGTTTTATGCCATTAGGTGGCGCCAGAGGTCAGAACATGTCTATTTTGAATTGG
1121 ATCGTTACAAATGAGCATATTTGATGCGGAAATTTCTGGGAGAAAAAAAATTGAGGAAATAAAGTTAAAAAATTGACATT
1201 CATTGAGCCAAAAGAGATGTGGAGAAACATTTTTCACCTTTCTGTTTGGCCTGATTAACATTTAAATTCTTGCCAAAATT
1281 AAGGTAACTTTTAAAAAACACCTTTTATAGGTGGATCCAGCAGTCTGGCAACGCCCACAGTTACCACAACACAGAAAACT
1361 GATCGTGCTATAAAATGGACGCTAAACTATGAAAACAGTGTGACATTGTTCTCTGTTCTTCCAGAGCCAGTAACATGCTT
1441 GCTCGTGCTTTCTACTTCTAGCTGATCATTCTTTTCCCAACATATATTTACAAATTTACCAAATTTTACCTAGAATTTTA
1521 GGACCAAATGGTTCTCACTCTTTATGCTGCAAAGACCTGGATGATGTTTGGTAACTATAGAAAAATAGAAATTACACTCA
1601 GGATCACTGTTACTGCTATTGCCACTGATGATTCCTGCAAAAATATAATCGAAGTTTTCCATCAAATGTATAATATGCTA
1681 TTAATACACATTAGATGATAACAGTTGTTCCATGAATGATTCTATGAAGCTATGCATCTTAGACCTCTTGAGCTGTGAAT
1761 TAGCACTATTTTCTATAGTTACTTATTCTCTGGATCATTTTATAATTTCCATATTAATTTCAAATATGCTCGTGTTATTC
1841 TTCAGTGATTTCCACAATTGTGCATTTTATTCTTTGGTTTAAGTACTGAAGCATATAATGAAAGTAATTGCTAAGTAGCA
1921 GCTTAAAAATTCAATTATCCGATTGTATTTAACATCTTTAAGAGCATGATCATAAAGAGCTATTTTTGACACCCCCCCCC
2001 CACTTTTTTAACATTTAGAGTTAGTAAGGGTTTTATATCTCTTCTGTCCATATTGTTTTCAAAGGAATGAGGTGTTTAGG
2081 TGGCTGGAAAAGCATTTGTAGGAAGTTAGATTTGAATATAGACAAGGTGGGTTATTCACGTTGAGAATGTTATTTGAAGA
2161 ATGCCTGTGAAGCCAGGTGTGGGTTCTACTCAGTGCCATAGATAGACTGAGTCTTCTCTCGTAGGTTACCATTACATAGT
2241 AATTTTGATTCTGAATTTCACATTAAATTATTTGAGTTTATACAGACCTAAATTTTAAAATCTGTACATATATTATTTTG
2321 ATGTATTAAGATGAATATTGCTGATTTAAATTTTATTTATGCACATACTTAAAGGACAGAAATGTCTGGGAAAGTAATTG
2401 TTAAATAATGATATGTAACTTTTTAACTTTTTAAATAAATAACAAGATTTTTAATGTGTGTCTCCCTCAGGGTTGTTTAA
2481 AGTTTTTTTTCTCCCTCAAGTATAAATAGTGGTAACTATATGTTTTGTATCTTCTAGCACCAACTGCTGTAAAGCAATGC
2561 TGCAAATAATGCTTGAATACAAGTGGCTAAGCCAACAACAGAATAAATACTTTTATAGTAGTTTTATAATCCTGAAATTC
2641 GAAAGCTTTCCCAATTGCACTTGCATCTAAACAAAACTGTTGCAGTTTTTACTCTATTTATTTTGTTCCCCATGTTTATG
2721 AAAGTCCTGCACAGTTTCAAAGGCATGGTAAATAATATATCAATGTTTATGTAGTCTGTTACAGAAACAGCTATAGATAA
2801 CATTATCCAGTGAAGAGCAAAATTCAAGCTTTAGAAAATATTCATGCATGCAATTTTGACATATCTAAAAATAGGTTTTT
2881 GTATATTTATGGTGGGAGGTGGTTGGGAACTTTTAACAAAATGGGGTGTTAATTTTTGTACAGTCTGTGGGCATTTACAC
2961 ATTTTTAATGTATTAAAATTTGGTAATTATGTGTACATTAAATTAATAAAAGTTACTTCTAGTTATGATTTGTGAATTCC
3041 CTAAGACCTTGGATTTTTTTAAGTAACTTTATATCAGAAATGATACTGCATCTTTATATTTTTAAAATTGTATTGCTGCT
3121 CAAGAATGGTACCCTCTTGTCAAAAAGGCATACATTCATAATTGTACATTCAGCATTGTAAATAATCTTATGAAACCTTT
3201 TTTGATTGAAGCTATTCAAAATAAAAATTTTAATGAATGAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
3281 AAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||::: ||| ||||||| 
Target 5' ttaAAATTG-TAT-TGCTGCTc 3'
3102 - 3121 157.00 -9.00
2
miRNA  3' guGUUUGGUAAUA-CACGACGAu 5'
            ::|::  |||| |||:|||| 
Target 5' aaTGAGTGTTTATGGTGTTGCTt 3'
561 - 583 144.00 -10.50
3
miRNA  3' guguuUGGUAAUACACGACGau 5'
               ||: || | ||||||  
Target 5' ttctcACTCTT-TATGCTGCaa 3'
1532 - 1552 132.00 -7.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31502261 2 COSMIC
COSN18717881 17 COSMIC
COSN31523001 86 COSMIC
COSN30466830 93 COSMIC
COSN31486221 117 COSMIC
COSN30126386 171 COSMIC
COSN30121810 258 COSMIC
COSN23563175 512 COSMIC
COSN5042429 657 COSMIC
COSN7758805 785 COSMIC
COSN7599522 1159 COSMIC
COSN7599521 1468 COSMIC
COSN20074765 1507 COSMIC
COSN28636693 1567 COSMIC
COSN30174512 1627 COSMIC
COSN1939620 1670 COSMIC
COSN26555606 1687 COSMIC
COSN30092422 1734 COSMIC
COSN30560288 1739 COSMIC
COSN30584444 1791 COSMIC
COSN19706108 1828 COSMIC
COSN30171142 1845 COSMIC
COSN28677715 1922 COSMIC
COSN31539595 1929 COSMIC
COSN19543970 1958 COSMIC
COSN20090978 1991 COSMIC
COSN20099555 1991 COSMIC
COSN15664019 1992 COSMIC
COSN20090977 2002 COSMIC
COSN23286164 2035 COSMIC
COSN25724324 2337 COSMIC
COSN1939618 2405 COSMIC
COSN22836421 2447 COSMIC
COSN9717947 2577 COSMIC
COSN27043670 2604 COSMIC
COSN16947219 2727 COSMIC
COSN22373505 2750 COSMIC
COSN22028745 2834 COSMIC
COSN17654842 2932 COSMIC
COSN16944769 3030 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1256640422 4 dbSNP
rs1450547406 5 dbSNP
rs1379294464 7 dbSNP
rs374940660 10 dbSNP
rs761847595 11 dbSNP
rs925867412 12 dbSNP
rs753912223 13 dbSNP
rs1168093686 15 dbSNP
rs1406830763 20 dbSNP
rs764363138 21 dbSNP
rs760872928 23 dbSNP
rs775785167 34 dbSNP
rs770792579 35 dbSNP
rs987785787 37 dbSNP
rs1282783421 38 dbSNP
rs762864781 40 dbSNP
rs773246248 43 dbSNP
rs769894341 45 dbSNP
rs1472880705 49 dbSNP
rs974617739 56 dbSNP
rs745921952 78 dbSNP
rs1219925922 88 dbSNP
rs1344069374 90 dbSNP
rs1176386007 92 dbSNP
rs1251757476 95 dbSNP
rs1374314171 103 dbSNP
rs1432392123 105 dbSNP
rs925051708 107 dbSNP
rs1226613319 116 dbSNP
rs776893419 147 dbSNP
rs1305764946 165 dbSNP
rs1303485043 168 dbSNP
rs979633494 169 dbSNP
rs1371689766 170 dbSNP
rs1221154677 171 dbSNP
rs1405678466 172 dbSNP
rs1302316879 177 dbSNP
rs1347451379 184 dbSNP
rs1276902293 191 dbSNP
rs529796953 191 dbSNP
rs375311582 193 dbSNP
rs1009088431 197 dbSNP
rs1412014603 205 dbSNP
rs950515947 211 dbSNP
rs1023899503 223 dbSNP
rs1191396973 224 dbSNP
rs1394040502 228 dbSNP
rs34928166 231 dbSNP
rs1025992925 232 dbSNP
rs1169891506 233 dbSNP
rs1370655723 240 dbSNP
rs994976598 242 dbSNP
rs1025541190 244 dbSNP
rs1353109963 245 dbSNP
rs1167762889 248 dbSNP
rs1438985361 250 dbSNP
rs546026679 256 dbSNP
rs994116518 264 dbSNP
rs1446147295 265 dbSNP
rs1370475856 272 dbSNP
rs1299893192 275 dbSNP
rs1343017128 277 dbSNP
rs1213914350 279 dbSNP
rs1270865257 279 dbSNP
rs899303042 281 dbSNP
rs1252175661 293 dbSNP
rs1055346004 294 dbSNP
rs1390220683 297 dbSNP
rs1474830008 308 dbSNP
rs1165669026 315 dbSNP
rs1417915329 317 dbSNP
rs1407609718 319 dbSNP
rs111562842 329 dbSNP
rs1480495606 345 dbSNP
rs1051717979 346 dbSNP
rs934168465 349 dbSNP
rs867505103 354 dbSNP
rs572140093 371 dbSNP
rs1250967707 375 dbSNP
rs1046373275 377 dbSNP
rs1268497248 382 dbSNP
rs1358330437 383 dbSNP
rs1240823377 391 dbSNP
rs945344363 392 dbSNP
rs1272284404 396 dbSNP
rs914002047 396 dbSNP
rs769606088 407 dbSNP
rs745473796 410 dbSNP
rs780875022 411 dbSNP
rs1053836332 412 dbSNP
rs201874130 421 dbSNP
rs527873297 425 dbSNP
rs79761598 426 dbSNP
rs1446073125 432 dbSNP
rs979171927 439 dbSNP
rs974686443 450 dbSNP
rs943282742 453 dbSNP
rs541927710 460 dbSNP
rs574507399 462 dbSNP
rs1166340994 467 dbSNP
rs1322949346 469 dbSNP
rs1417590187 477 dbSNP
rs969557615 478 dbSNP
rs1161841911 480 dbSNP
rs911775547 481 dbSNP
rs142965231 482 dbSNP
rs1342389250 483 dbSNP
rs1415286547 493 dbSNP
rs987168195 498 dbSNP
rs566991551 500 dbSNP
rs1229934633 510 dbSNP
rs370348334 521 dbSNP
rs1336633756 527 dbSNP
rs1203060749 530 dbSNP
rs1026024434 532 dbSNP
rs1442562550 534 dbSNP
rs994047812 535 dbSNP
rs1474514704 538 dbSNP
rs777945474 540 dbSNP
rs866219239 542 dbSNP
rs963550023 558 dbSNP
rs1033794082 565 dbSNP
rs1157085255 573 dbSNP
rs1017362496 582 dbSNP
rs1006951781 583 dbSNP
rs1303954666 590 dbSNP
rs186240701 592 dbSNP
rs1002890202 593 dbSNP
rs1469813644 601 dbSNP
rs1029774385 603 dbSNP
rs758790737 605 dbSNP
rs1236427126 616 dbSNP
rs1173723061 626 dbSNP
rs748895872 645 dbSNP
rs1025617849 655 dbSNP
rs998343885 662 dbSNP
rs1473361777 668 dbSNP
rs1277611714 671 dbSNP
rs1009577688 672 dbSNP
rs1364067557 674 dbSNP
rs1180786010 676 dbSNP
rs1417118326 679 dbSNP
rs892432639 680 dbSNP
rs779701570 688 dbSNP
rs751073323 689 dbSNP
rs1179907901 692 dbSNP
rs1379524218 696 dbSNP
rs1454897098 699 dbSNP
rs1173036651 705 dbSNP
rs1393406239 709 dbSNP
rs936725966 715 dbSNP
rs558157041 719 dbSNP
rs1395490379 721 dbSNP
rs904381303 722 dbSNP
rs1460877950 723 dbSNP
rs1325282146 724 dbSNP
rs1371224644 726 dbSNP
rs903490971 730 dbSNP
rs1038905704 737 dbSNP
rs1300598601 743 dbSNP
rs943168922 751 dbSNP
rs1261319334 758 dbSNP
rs1230254189 763 dbSNP
rs1252466170 764 dbSNP
rs755809937 769 dbSNP
rs1194397635 770 dbSNP
rs1255313274 774 dbSNP
rs1351631386 775 dbSNP
rs1279216689 776 dbSNP
rs947771531 789 dbSNP
rs911823286 792 dbSNP
rs370067535 801 dbSNP
rs1460430809 811 dbSNP
rs1316261717 813 dbSNP
rs757127967 814 dbSNP
rs74437536 819 dbSNP
rs962966910 820 dbSNP
rs1016872770 829 dbSNP
rs1382239594 830 dbSNP
rs985851017 833 dbSNP
rs1385181461 843 dbSNP
rs1225942848 850 dbSNP
rs954103085 853 dbSNP
rs1336009507 860 dbSNP
rs1213288907 864 dbSNP
rs973153768 873 dbSNP
rs963078056 881 dbSNP
rs1187140334 882 dbSNP
rs1261151128 887 dbSNP
rs1426636469 891 dbSNP
rs547892407 895 dbSNP
rs1029751381 898 dbSNP
rs879538062 902 dbSNP
rs980975043 904 dbSNP
rs1369985358 910 dbSNP
rs971268330 911 dbSNP
rs998276458 913 dbSNP
rs763757548 914 dbSNP
rs1025226586 917 dbSNP
rs1287760440 924 dbSNP
rs891938045 928 dbSNP
rs1010231102 931 dbSNP
rs1381018825 937 dbSNP
rs527595967 937 dbSNP
rs533205296 937 dbSNP
rs892504546 938 dbSNP
rs1190542566 943 dbSNP
rs1447676852 950 dbSNP
rs1271693872 951 dbSNP
rs1283755353 952 dbSNP
rs1203618253 953 dbSNP
rs1216831393 977 dbSNP
rs1032325170 981 dbSNP
rs762829140 987 dbSNP
rs899931880 993 dbSNP
rs894813123 1001 dbSNP
rs1258067147 1005 dbSNP
rs1474841656 1018 dbSNP
rs1040160216 1030 dbSNP
rs1381188299 1034 dbSNP
rs1419272588 1035 dbSNP
rs1158009304 1036 dbSNP
rs148379891 1037 dbSNP
rs568120774 1038 dbSNP
rs943220748 1043 dbSNP
rs890285358 1044 dbSNP
rs1051721648 1050 dbSNP
rs1376555020 1053 dbSNP
rs1414733671 1054 dbSNP
rs929204490 1055 dbSNP
rs1056106794 1058 dbSNP
rs918944524 1059 dbSNP
rs1376030778 1063 dbSNP
rs1224532497 1067 dbSNP
rs1300487409 1072 dbSNP
rs1432233907 1083 dbSNP
rs1037345282 1084 dbSNP
rs549716221 1088 dbSNP
rs143370761 1094 dbSNP
rs918395886 1104 dbSNP
rs1208691231 1106 dbSNP
rs972519611 1109 dbSNP
rs980888906 1117 dbSNP
rs1176428081 1121 dbSNP
rs970959044 1123 dbSNP
rs7611390 1124 dbSNP
rs1394002337 1127 dbSNP
rs988435126 1140 dbSNP
rs1332841150 1144 dbSNP
rs1383246743 1146 dbSNP
rs552175140 1147 dbSNP
rs985431619 1148 dbSNP
rs1297968070 1151 dbSNP
rs1371404104 1153 dbSNP
rs1032567276 1156 dbSNP
rs1236832007 1162 dbSNP
rs1000877449 1168 dbSNP
rs1475743703 1171 dbSNP
rs954146244 1171 dbSNP
rs7616001 1178 dbSNP
rs1018401110 1183 dbSNP
rs372708296 1185 dbSNP
rs1230986906 1187 dbSNP
rs1469514234 1189 dbSNP
rs1453524145 1192 dbSNP
rs976805456 1193 dbSNP
rs149218136 1208 dbSNP
rs544164490 1216 dbSNP
rs1031784099 1226 dbSNP
rs1422188818 1232 dbSNP
rs1170127860 1234 dbSNP
rs1000759640 1236 dbSNP
rs1443374503 1243 dbSNP
rs890327010 1244 dbSNP
rs1357774420 1249 dbSNP
rs535564955 1250 dbSNP
rs1326901211 1258 dbSNP
rs529774658 1270 dbSNP
rs1277327355 1280 dbSNP
rs1215673946 1293 dbSNP
rs993265758 1306 dbSNP
rs1370550262 1307 dbSNP
rs1434316322 1308 dbSNP
rs1339388183 1317 dbSNP
rs1339942425 1318 dbSNP
rs1269052607 1327 dbSNP
rs1213967516 1329 dbSNP
rs1270582531 1331 dbSNP
rs897757252 1332 dbSNP
rs1213912543 1338 dbSNP
rs1037545843 1339 dbSNP
rs941701566 1341 dbSNP
rs879093400 1346 dbSNP
rs1272080836 1354 dbSNP
rs1466861998 1361 dbSNP
rs562471547 1364 dbSNP
rs1476010648 1365 dbSNP
rs1044853714 1373 dbSNP
rs1428085484 1376 dbSNP
rs949144707 1380 dbSNP
rs1303400132 1381 dbSNP
rs776840188 1389 dbSNP
rs917651705 1390 dbSNP
rs771059715 1391 dbSNP
rs1363491806 1392 dbSNP
rs183023581 1394 dbSNP
rs1393974592 1396 dbSNP
rs113880770 1406 dbSNP
rs1320347709 1408 dbSNP
rs1327139140 1413 dbSNP
rs761024731 1424 dbSNP
rs1429932073 1429 dbSNP
rs1276286627 1433 dbSNP
rs576746713 1444 dbSNP
rs61257072 1445 dbSNP
rs778283493 1464 dbSNP
rs1166201003 1467 dbSNP
rs1353758172 1470 dbSNP
rs925528774 1480 dbSNP
rs979679726 1481 dbSNP
rs1284341435 1484 dbSNP
rs1445977639 1484 dbSNP
rs964076678 1493 dbSNP
rs1213052632 1499 dbSNP
rs1261574462 1502 dbSNP
rs1476493105 1509 dbSNP
rs1481477640 1510 dbSNP
rs1018680891 1527 dbSNP
rs896894620 1530 dbSNP
rs766814276 1531 dbSNP
rs1471917303 1534 dbSNP
rs1385739437 1536 dbSNP
rs1036815439 1541 dbSNP
rs1296423664 1543 dbSNP
rs941185976 1544 dbSNP
rs1415345539 1551 dbSNP
rs1292423468 1554 dbSNP
rs1338554165 1557 dbSNP
rs773795660 1558 dbSNP
rs1050077081 1561 dbSNP
rs546152462 1566 dbSNP
rs932600167 1586 dbSNP
rs922576445 1591 dbSNP
rs1025697413 1592 dbSNP
rs1486929181 1597 dbSNP
rs976731796 1599 dbSNP
rs772273076 1601 dbSNP
rs897622871 1602 dbSNP
rs1257248702 1608 dbSNP
rs748487202 1613 dbSNP
rs924682666 1625 dbSNP
rs1364531685 1626 dbSNP
rs145772393 1637 dbSNP
rs904885344 1640 dbSNP
rs1397018955 1642 dbSNP
rs1045147719 1645 dbSNP
rs553904248 1650 dbSNP
rs969256596 1652 dbSNP
rs535554991 1663 dbSNP
rs1023146034 1670 dbSNP
rs1162176746 1675 dbSNP
rs949052003 1676 dbSNP
rs896232842 1680 dbSNP
rs1392850140 1686 dbSNP
rs1329332312 1687 dbSNP
rs1052146356 1691 dbSNP
rs1444193411 1694 dbSNP
rs1222517304 1696 dbSNP
rs1348065955 1697 dbSNP
rs935525937 1702 dbSNP
rs1255860025 1707 dbSNP
rs1343493823 1711 dbSNP
rs1197882681 1720 dbSNP
rs925435493 1722 dbSNP
rs1289611445 1723 dbSNP
rs1244124307 1724 dbSNP
rs1356092876 1728 dbSNP
rs747642175 1734 dbSNP
rs780629086 1743 dbSNP
rs1254952656 1745 dbSNP
rs1372555349 1755 dbSNP
rs1173095249 1760 dbSNP
rs1035929756 1761 dbSNP
rs1463485598 1762 dbSNP
rs1438357022 1765 dbSNP
rs768354583 1768 dbSNP
rs746580802 1775 dbSNP
rs1327568331 1776 dbSNP
rs1422416088 1786 dbSNP
rs942930345 1790 dbSNP
rs1158759706 1791 dbSNP
rs911452123 1800 dbSNP
rs779776111 1803 dbSNP
rs1439432791 1811 dbSNP
rs1193492219 1812 dbSNP
rs1298594078 1813 dbSNP
rs1343313381 1822 dbSNP
rs987222016 1823 dbSNP
rs1246536466 1824 dbSNP
rs1230318981 1826 dbSNP
rs190436920 1831 dbSNP
rs955370321 1832 dbSNP
rs201096434 1833 dbSNP
rs1286946756 1838 dbSNP
rs1239537784 1841 dbSNP
rs1315139248 1843 dbSNP
rs1386472167 1844 dbSNP
rs1275209682 1845 dbSNP
rs758719986 1848 dbSNP
rs200011258 1857 dbSNP
rs1005311420 1858 dbSNP
rs1190637474 1859 dbSNP
rs1302355922 1859 dbSNP
rs779286915 1860 dbSNP
rs556231966 1862 dbSNP
rs879687908 1864 dbSNP
rs1298355794 1874 dbSNP
rs972791225 1876 dbSNP
rs1049601965 1878 dbSNP
rs1452600318 1885 dbSNP
rs1372278789 1886 dbSNP
rs757818952 1887 dbSNP
rs1177572215 1892 dbSNP
rs1463809999 1895 dbSNP
rs1434288826 1903 dbSNP
rs1429149261 1916 dbSNP
rs932498085 1918 dbSNP
rs1478975289 1919 dbSNP
rs753947007 1921 dbSNP
rs538274525 1925 dbSNP
rs1460615250 1932 dbSNP
rs1291265839 1933 dbSNP
rs570737469 1934 dbSNP
rs552469274 1938 dbSNP
rs1384414401 1939 dbSNP
rs769429344 1940 dbSNP
rs1340456513 1941 dbSNP
rs761147700 1944 dbSNP
rs1401948983 1949 dbSNP
rs961887164 1953 dbSNP
rs527557368 1954 dbSNP
rs1006118986 1960 dbSNP
rs1221167936 1962 dbSNP
rs185581435 1964 dbSNP
rs1486925490 1968 dbSNP
rs1205801837 1974 dbSNP
rs1041018798 1977 dbSNP
rs1476816852 1980 dbSNP
rs1308739146 1989 dbSNP
rs758861949 1991 dbSNP
rs374156178 1992 dbSNP
rs60210039 1992 dbSNP
rs1023517389 1993 dbSNP
rs1287815971 1994 dbSNP
rs979225444 1994 dbSNP
rs1372363821 1996 dbSNP
rs1315144121 1998 dbSNP
rs1013671385 1999 dbSNP
rs896150381 2001 dbSNP
rs1491022818 2002 dbSNP
rs3836225 2002 dbSNP
rs397876388 2002 dbSNP
rs767285736 2002 dbSNP
rs796767353 2002 dbSNP
rs933101684 2002 dbSNP
rs1179906012 2003 dbSNP
rs1454512005 2003 dbSNP
rs947512143 2003 dbSNP
rs1157506409 2004 dbSNP
rs916003416 2010 dbSNP
rs14414 2024 dbSNP
rs935054044 2030 dbSNP
rs1336141174 2043 dbSNP
rs1447668376 2050 dbSNP
rs1301487651 2065 dbSNP
rs1468324149 2074 dbSNP
rs960230001 2077 dbSNP
rs1347132535 2079 dbSNP
rs1160114657 2083 dbSNP
rs1400419805 2091 dbSNP
rs1236390083 2096 dbSNP
rs1406234547 2107 dbSNP
rs1311565184 2118 dbSNP
rs1207699917 2121 dbSNP
rs1234446450 2128 dbSNP
rs1480737704 2130 dbSNP
rs1185873048 2131 dbSNP
rs904043484 2139 dbSNP
rs1243110806 2140 dbSNP
rs972289788 2144 dbSNP
rs9878016 2159 dbSNP
rs546823356 2163 dbSNP
rs377047250 2177 dbSNP
rs529912773 2178 dbSNP
rs960992608 2181 dbSNP
rs1426436063 2183 dbSNP
rs1414419096 2188 dbSNP
rs1015274772 2198 dbSNP
rs1356680888 2207 dbSNP
rs1466333304 2210 dbSNP
rs1331000290 2216 dbSNP
rs1262064032 2218 dbSNP
rs181177423 2220 dbSNP
rs72607888 2221 dbSNP
rs11900 2227 dbSNP
rs1247965883 2228 dbSNP
rs987032919 2229 dbSNP
rs1217447545 2236 dbSNP
rs189239650 2237 dbSNP
rs1314318637 2239 dbSNP
rs1197797683 2250 dbSNP
rs140298913 2261 dbSNP
rs1469557465 2262 dbSNP
rs972821009 2266 dbSNP
rs1245669597 2267 dbSNP
rs1289586901 2269 dbSNP
rs1430262417 2271 dbSNP
rs1477969233 2283 dbSNP
rs962750517 2304 dbSNP
rs1016945756 2305 dbSNP
rs1422077806 2308 dbSNP
rs1478319630 2310 dbSNP
rs1170416783 2311 dbSNP
rs546485727 2312 dbSNP
rs1463258095 2315 dbSNP
rs374883168 2316 dbSNP
rs1165826783 2325 dbSNP
rs1349442097 2325 dbSNP
rs1425723298 2330 dbSNP
rs777745229 2359 dbSNP
rs1162239109 2361 dbSNP
rs1421476074 2362 dbSNP
rs1263219228 2379 dbSNP
rs984596059 2384 dbSNP
rs1186662247 2388 dbSNP
rs1217750431 2390 dbSNP
rs1276089761 2393 dbSNP
rs969209341 2395 dbSNP
rs1024011083 2405 dbSNP
rs1013494051 2406 dbSNP
rs758451897 2411 dbSNP
rs1030651849 2413 dbSNP
rs999166025 2419 dbSNP
rs1217327410 2421 dbSNP
rs567221920 2425 dbSNP
rs1244270588 2427 dbSNP
rs151066144 2433 dbSNP
rs1224371839 2435 dbSNP
rs903621250 2438 dbSNP
rs1359902437 2440 dbSNP
rs915988227 2442 dbSNP
rs1421985147 2446 dbSNP
rs1476308772 2458 dbSNP
rs1242507567 2466 dbSNP
rs1043463857 2477 dbSNP
rs1413366634 2479 dbSNP
rs572603949 2482 dbSNP
rs1309245572 2491 dbSNP
rs1320408140 2491 dbSNP
rs1399377414 2492 dbSNP
rs752538229 2494 dbSNP
rs889959949 2496 dbSNP
rs1245047255 2498 dbSNP
rs1283179293 2499 dbSNP
rs1353826150 2500 dbSNP
rs1051819434 2504 dbSNP
rs991571221 2506 dbSNP
rs146684625 2508 dbSNP
rs934248172 2514 dbSNP
rs1488886343 2527 dbSNP
rs918611818 2533 dbSNP
rs1305212330 2535 dbSNP
rs1037011931 2541 dbSNP
rs1365346968 2548 dbSNP
rs1237083170 2549 dbSNP
rs1471948517 2557 dbSNP
rs972262187 2560 dbSNP
rs962291396 2562 dbSNP
rs1016953246 2563 dbSNP
rs941330844 2581 dbSNP
rs1301758870 2589 dbSNP
rs909971957 2593 dbSNP
rs559246034 2602 dbSNP
rs1338314191 2609 dbSNP
rs542057545 2616 dbSNP
rs1028070218 2617 dbSNP
rs1352419321 2618 dbSNP
rs73889860 2625 dbSNP
rs556268702 2626 dbSNP
rs537924720 2629 dbSNP
rs1420943374 2631 dbSNP
rs762009638 2634 dbSNP
rs992507208 2640 dbSNP
rs960629382 2641 dbSNP
rs1019476295 2644 dbSNP
rs998710301 2655 dbSNP
rs1238848678 2658 dbSNP
rs1207891067 2664 dbSNP
rs1439098465 2668 dbSNP
rs570840683 2671 dbSNP
rs558641990 2683 dbSNP
rs774478592 2690 dbSNP
rs1043400260 2694 dbSNP
rs139437389 2696 dbSNP
rs185926558 2698 dbSNP
rs1316160129 2708 dbSNP
rs1399885074 2708 dbSNP
rs1411284827 2710 dbSNP
rs1285360494 2712 dbSNP
rs1375702482 2719 dbSNP
rs1022094733 2728 dbSNP
rs1224351758 2733 dbSNP
rs894466784 2734 dbSNP
rs1305024730 2743 dbSNP
rs570777581 2747 dbSNP
rs548495981 2748 dbSNP
rs182148172 2752 dbSNP
rs889981610 2754 dbSNP
rs1051255340 2756 dbSNP
rs998738329 2758 dbSNP
rs76390303 2759 dbSNP
rs762835995 2763 dbSNP
rs909459415 2768 dbSNP
rs1433698723 2772 dbSNP
rs1198148393 2774 dbSNP
rs941404202 2776 dbSNP
rs189645011 2778 dbSNP
rs76813681 2790 dbSNP
rs1480546370 2796 dbSNP
rs150930223 2797 dbSNP
rs948812155 2801 dbSNP
rs917296491 2806 dbSNP
rs1463775506 2807 dbSNP
rs80136368 2810 dbSNP
rs960496666 2816 dbSNP
rs923859004 2818 dbSNP
rs965105717 2829 dbSNP
rs1019404156 2832 dbSNP
rs1176555454 2837 dbSNP
rs1279259335 2839 dbSNP
rs1317498239 2842 dbSNP
rs1217104250 2846 dbSNP
rs1267289462 2846 dbSNP
rs978002348 2860 dbSNP
rs1456441629 2861 dbSNP
rs967741801 2870 dbSNP
rs546324073 2872 dbSNP
rs112690318 2874 dbSNP
rs1489241519 2881 dbSNP
rs1194083726 2883 dbSNP
rs1422700559 2884 dbSNP
rs1021501485 2893 dbSNP
rs1011914763 2895 dbSNP
rs1007076592 2913 dbSNP
rs953839483 2917 dbSNP
rs894445185 2933 dbSNP
rs1389145717 2934 dbSNP
rs1402452421 2938 dbSNP
rs1204445816 2944 dbSNP
rs1323056875 2947 dbSNP
rs528079897 2947 dbSNP
rs1340360334 2950 dbSNP
rs1398554313 2951 dbSNP
rs1029797869 2954 dbSNP
rs1322583647 2977 dbSNP
rs998367630 2983 dbSNP
rs1241546276 2985 dbSNP
rs1002853906 2990 dbSNP
rs1263804139 2991 dbSNP
rs897326149 2992 dbSNP
rs1336726282 2997 dbSNP
rs760827090 3002 dbSNP
rs115503599 3007 dbSNP
rs1217341414 3016 dbSNP
rs1036441507 3018 dbSNP
rs773211859 3022 dbSNP
rs1183387310 3029 dbSNP
rs546031834 3044 dbSNP
rs775426889 3047 dbSNP
rs1385682847 3049 dbSNP
rs575377853 3051 dbSNP
rs1044419465 3058 dbSNP
rs1422047448 3061 dbSNP
rs557116327 3061 dbSNP
rs922202472 3061 dbSNP
rs1360451835 3065 dbSNP
rs895906988 3075 dbSNP
rs1304981841 3093 dbSNP
rs975061016 3094 dbSNP
rs184890113 3096 dbSNP
rs769771065 3103 dbSNP
rs1455091731 3104 dbSNP
rs35453719 3108 dbSNP
rs574715374 3109 dbSNP
rs1364158057 3121 dbSNP
rs977575433 3139 dbSNP
rs967200833 3140 dbSNP
rs34250988 3147 dbSNP
rs1285140343 3153 dbSNP
rs1351463411 3157 dbSNP
rs1211916980 3181 dbSNP
rs550362648 3183 dbSNP
rs1180896547 3187 dbSNP
rs1482707160 3189 dbSNP
rs1179824922 3190 dbSNP
rs1239633384 3195 dbSNP
rs1437728225 3202 dbSNP
rs1021888646 3206 dbSNP
rs939208723 3210 dbSNP
rs958854911 3222 dbSNP
rs1399512786 3228 dbSNP
rs1184249910 3231 dbSNP
rs1178646556 3242 dbSNP
rs923764066 3242 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.722 1.6e-4 0.809 7.8e-6 20 Click to see details
GSE21032 Prostate cancer 0.371 2.8e-4 0.267 7.3e-3 83 Click to see details
GSE42095 Differentiated embryonic stem cells 0.632 6.1e-4 0.344 5.4e-2 23 Click to see details
GSE38226 Liver fibrosis -0.59 2.4e-3 -0.618 1.4e-3 21 Click to see details
GSE28260 Renal cortex and medulla -0.616 1.2e-2 -0.698 4.0e-3 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.32 5.9e-2 0.446 1.3e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.214 1.6e-1 -0.152 2.4e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.159 1.9e-1 0.247 8.6e-2 32 Click to see details
GSE21687 Ependynoma primary tumors -0.06 3.2e-1 -0.038 3.8e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.092 3.3e-1 0.086 3.4e-1 25 Click to see details
GSE17498 Multiple myeloma 0.063 3.5e-1 -0.069 3.4e-1 40 Click to see details
GSE14794 Lymphoblastoid cells 0.037 3.6e-1 0.038 3.6e-1 90 Click to see details
GSE17306 Multiple myeloma -0.036 4.0e-1 -0.099 2.5e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.06 4.3e-1 0.147 3.2e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.021 4.3e-1 -0.005 4.8e-1 79 Click to see details
GSE28544 Breast cancer -0.035 4.4e-1 0.087 3.4e-1 24 Click to see details
GSE19536 Breast cancer -0.011 4.6e-1 -0.003 4.9e-1 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.025 4.6e-1 -0.030 4.5e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.025 4.6e-1 -0.030 4.5e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.459 0 0.488 0 32 Click to see details
LUAD 0.603 0.02 0.580 0.02 12 Click to see details
PAAD -0.954 0.02 -0.800 0.1 4 Click to see details
BRCA 0.211 0.03 0.239 0.01 84 Click to see details
PCPG 0.991 0.04 1.000 0.5 3 Click to see details
CHOL -0.555 0.06 -0.517 0.08 9 Click to see details
BLCA 0.376 0.06 0.465 0.03 18 Click to see details
PRAD 0.173 0.11 0.151 0.15 50 Click to see details
CESC 0.877 0.16 0.500 0.33 3 Click to see details
LIHC -0.137 0.17 -0.213 0.07 49 Click to see details
KIRC 0.11 0.19 0.112 0.18 68 Click to see details
KICH 0.16 0.22 0.114 0.29 25 Click to see details
UCEC 0.166 0.25 0.151 0.27 19 Click to see details
LUSC -0.078 0.32 -0.095 0.29 38 Click to see details
ESCA -0.152 0.33 -0.227 0.25 11 Click to see details
HNSC 0.059 0.36 0.111 0.24 42 Click to see details
COAD 0.06 0.44 -0.095 0.41 8 Click to see details
KIRP 0.006 0.49 -0.043 0.41 32 Click to see details
THCA -0.003 0.49 -0.123 0.18 59 Click to see details
THCA -0.003 0.49 -0.123 0.18 59 Click to see details
THCA -0.003 0.49 -0.123 0.18 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*