miRTarBase - #MIRT728237 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol B4GALT1   
Synonyms B4GAL-T1, CDG2D, GGTB2, GT1, GTB, beta4Gal-T1
Description beta-1,4-galactosyltransferase 1
Transcript NM_001497   
Expression
Putative miRNA Targets on B4GALT1
3'UTR of B4GALT1
(miRNA target sites are highlighted)
>B4GALT1|NM_001497|3'UTR
   1 CGTTTTGGTACACGGATAAGAGACCTGAAATTAGCCAGGGACCTCTGCTGTGTGTCTCTGCCAATCTGCTGGGCTGGTCC
  81 CTCTCATTTTTACCAGTCTGAGTGACAGGTCCCCTTCGCTCATCATTCAGATGGCTTTCCAGATGACCAGGACGAGTGGG
 161 ATATTTTGCCCCCAACTTGGCTCGGCATGTGAATTCTTAGCTCTGCAAGGTGTTTATGCCTTTGCGGGTTTCTTGATGTG
 241 TTCGCAGTGTCACCCCAGAGTCAGAACTGTACACATCCCAAAATTTGGTGGCCGTGGAACACATTCCCGGTGATAGAATT
 321 GCTAAATTGTCGTGAAATAGGTTAGAATTTTTCTTTAAATTATGGTTTTCTTATTCGTGAAAATTCGGAGAGTGCTGCTA
 401 AAATTGGATTGGTGTGATCTTTTTGGTAGTTGTAATTTAACAGAAAAACACAAAATTTCAACCATTCTTAATGTTACGTC
 481 CTCCCCCCACCCCCTTCTTTCAGTGGTATGCAACCACTGCAATCACTGTGCATATGTCTTTTCTTAGCAAAAGGATTTTA
 561 AAACTTGAGCCCTGGACCTTTTGTCCTATGTGTGTGGATTCCAGGGCAACTCTAGCATCAGAGCAAAAGCCTTGGGTTTC
 641 TCGCATTCAGTGGCCTATCTCCAGATTGTCTGATTTCTGAATGTAAAGTTGTTGTGTTTTTTTTTAAATAGTAGTTTGTA
 721 GTATTTTAAAGAAAGAACAGATCGAGTTCTAATTATGATCTAGCTTGATTTTGTGTTGATCCAAATTTGCATAGCTGTTT
 801 AATGTTAAGTCATGACAATTTATTTTTCTTGGCATGCTATGTAAACTTGAATTTCCTATGTATTTTTATTGTGGTGTTTT
 881 AAATATGGGGAGGGGTATTGAGCATTTTTTAGGGAGAAAAATAAATATATGCTGTAGTGGCCACAAATAGGCCTATGATT
 961 TAGCTGGCAGGCCAGGTTTTCTCAAGAGCAAAATCACCCTCTGGCCCCTTGGCAGGTAAGGCCTCCCGGTCAGCATTATC
1041 CTGCCAGACCTCGGGGAGGATACCTGGGAGACAGAAGCCTCTGCACCTACTGTGCAGAACTCTCCACTTCCCCAACCCTC
1121 CCCAGGTGGGCAGGGCGGAGGGAGCCTCAGCCTCCTTAGACTGACCCCTCAGGCCCCTAGGCTGGGGGGTTGTAAATAAC
1201 AGCAGTCAGGTTGTTTACCAGCCCTTTGCACCTCCCCAGGCAGAGGGAGCCTCTGTTCTGGTGGGGGCCACCTCCCTCAG
1281 AGGCTCTGCTAGCCACACTCCGTGGCCCACCCTTTGTTACCAGTTCTTCCTCCTTCCTCTTTTCCCCTGCCTTTCTCATT
1361 CCTTCCTTCGTCTCCCTTTTTGTTCCTTTGCCTCTTGCCTGTCCCCTAAAACTTGACTGTGGCACTCAGGGTCAAACAGA
1441 CTATCCATTCCCCAGCATGAATGTGCCTTTTAATTAGTGATCTAGAAAGAAGTTCAGCCGAACCCACACCCCAACTCCCT
1521 CCCAAGAACTTCGGTGCCTAAAGCCTCCTGTTCCACCTCAGGTTTTCACAGGTGCTCCCACCCCAGTTGAGGCTCCCACC
1601 CACAGGGCTGTCTGTCACAAACCCACCTCTGTTGGGAGCTATTGAGCCACCTGGGATGAGATGACACAAGGCACTCCTAC
1681 CACTGAGCGCCTTTGCCAGGTCCAGCCTGGGCTCAGGTTCCAAGACTCAGCTGCCTAATCCCAGGGTTGAGCCTTGTGCT
1761 CGTGGCGGACCCCAAACCACTGCCCTCCTGGGTACCAGCCCTCAGTGTGGAGGCTGAGCTGGTGCCTGGCCCCAGTCTTA
1841 TCTGTGCCTTTACTGCTTTGCGCATCTCAGATGCTAACTTGGTTCTTTTTCCAGAAGCCTTTGTATTGGTTAAAAATTAT
1921 TTTCCATTGCAGAAGCAGCTGGACTATGCAAAAAGTATTTCTCTGTCAGTTCCCCACTCTATACCAAGGATATTATTAAA
2001 ACTAGAAATGACTGCATTGAGAGGGAGTTGTGGGAAATAAGAAGAATGAAAGCCTCTCTTTCTGTCCGCAGATCCTGACT
2081 TTTCCAAAGTGCCTTAAAAGAAATCAGACAAATGCCCTGAGTGGTAACTTCTGTGTTATTTTACTCTTAAAACCAAACTC
2161 TACCTTTTCTTGTTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTACCTTCTCATTCATGTCAAGTATGTGGTTCATT
2241 CTTAGAACCAAGGGAAATACTGCTCCCCCCATTTGCTGACGTAGTGCTCTCATGGGCTCACCTGGGCCCAAGGCACAGCC
2321 AGGGCACAGTTAGGCCTGGATGTTTGCCTGGTCCGTGAGATGCCGCGGGTCCTGTTTCCTTACTGGGGATTTCAGGGCTG
2401 GGGGTTCAGGGAGCATTTCCTTTTCCTGGGAGTTATGACCGCGAAGTTGTCATGTGCCGTGCCCTTTTCTGTTTCTGTGT
2481 ATCCTATTGCTGGTGACTCTGTGTGAACTGGCCTTTGGGAAAGATCAGAGAGGGCAGAGGTGGCACAGGACAGTAAAGGA
2561 GATGCTGTGCTGGCCTTCAGCCTGGACAGGGTCTCTGCTGACTGCCAGGGGCGGGGGCTCTGCATAGCCAGGATGACGGC
2641 TTTCATGTCCCAGAGACCTGTTGTGCTGTGTATTTTGATTTCCTGTGTATGCAAATGTGTGTATTTACCATTGTGTAGGG
2721 GGCTGTGTCTGATCTTGGTGTTCAAAACAGAACTGTATTTTTGCCTTTAAAATTAAATAATATAACGTGAATAAATGACC
2801 CTATCTTTGTAACAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             || :|:  : |||||||| 
Target 5' gaaAATTCGGAGAGTGCTGCTa 3'
379 - 400 151.00 -14.50
2
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             |||: | ||| |||||:  
Target 5' gaaAAATAAATATATGCTGTag 3'
916 - 937 131.00 -6.20
3
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             |:||| |  |||||||:  
Target 5' cagAGACC-TGTTGTGCTGTgt 3'
2651 - 2671 126.00 -16.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1199111 154 ClinVar
366641 706 ClinVar
366639 714 ClinVar
366638 738 ClinVar
366631 1088 ClinVar
366623 1676 ClinVar
366620 1874 ClinVar
366619 1891 ClinVar
366615 2177 ClinVar
366614 2178 ClinVar
366612 2204 ClinVar
366608 2399 ClinVar
366600 2718 ClinVar
COSN30496663 2 COSMIC
COSN20887155 9 COSMIC
COSN30178966 15 COSMIC
COSN30533689 34 COSMIC
COSN31508292 39 COSMIC
COSN30457252 56 COSMIC
COSN24394558 68 COSMIC
COSN30166427 85 COSMIC
COSN31555953 118 COSMIC
COSN19770563 130 COSMIC
COSN31588303 190 COSMIC
COSN31543065 260 COSMIC
COSN19658336 331 COSMIC
COSN30174987 371 COSMIC
COSN31534493 390 COSMIC
COSN4889322 403 COSMIC
COSN30172446 411 COSMIC
COSN31565368 419 COSMIC
COSN1377964 434 COSMIC
COSN5703063 444 COSMIC
COSN22742768 449 COSMIC
COSN31547537 454 COSMIC
COSN26635508 485 COSMIC
COSN30173418 567 COSMIC
COSN30540892 612 COSMIC
COSN31527922 626 COSMIC
COSN26640337 706 COSMIC
COSN23475861 714 COSMIC
COSN31538440 718 COSMIC
COSN31527924 724 COSMIC
COSN31537520 744 COSMIC
COSN31537804 761 COSMIC
COSN31520742 821 COSMIC
COSN21198951 828 COSMIC
COSN31552196 856 COSMIC
COSN31549571 946 COSMIC
COSN30169257 949 COSMIC
COSN28380604 953 COSMIC
COSN14935278 1087 COSMIC
COSN31530907 1335 COSMIC
COSN23550605 1519 COSMIC
COSN17182110 1521 COSMIC
COSN31489564 1532 COSMIC
COSN25773113 1641 COSMIC
COSN28676564 1664 COSMIC
COSN31484716 1728 COSMIC
COSN31521586 1767 COSMIC
COSN6603965 1767 COSMIC
COSN24303022 1808 COSMIC
COSN31552541 1862 COSMIC
COSN28703208 2041 COSMIC
COSN25435399 2176 COSMIC
COSN9282701 2185 COSMIC
COSN31588182 2260 COSMIC
COSN4889321 2283 COSMIC
COSN28662780 2317 COSMIC
COSN31540928 2319 COSMIC
COSN20878246 2386 COSMIC
COSN2507049 2403 COSMIC
COSN31545930 2436 COSMIC
COSN9710733 2635 COSMIC
COSN18983813 2697 COSMIC
COSN2322320 2755 COSMIC
rs7019909 130 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767768449 1 dbSNP
rs774770478 2 dbSNP
rs377742682 3 dbSNP
rs764400945 5 dbSNP
rs763374161 13 dbSNP
rs537402869 14 dbSNP
rs1169760574 15 dbSNP
rs374328236 16 dbSNP
rs571848514 25 dbSNP
rs1276344427 28 dbSNP
rs1225115638 32 dbSNP
rs1323938144 34 dbSNP
rs771875889 38 dbSNP
rs1202594097 41 dbSNP
rs1020457484 43 dbSNP
rs1483933713 45 dbSNP
rs369256675 46 dbSNP
rs1184317810 50 dbSNP
rs778858783 50 dbSNP
rs202081755 51 dbSNP
rs530256316 56 dbSNP
rs909287528 62 dbSNP
rs1176230045 64 dbSNP
rs1173483960 86 dbSNP
rs757496621 93 dbSNP
rs1469649036 109 dbSNP
rs985399192 117 dbSNP
rs1431778217 118 dbSNP
rs181556643 121 dbSNP
rs1026570828 123 dbSNP
rs1361181395 124 dbSNP
rs1428721743 127 dbSNP
rs7019909 130 dbSNP
rs1362761035 132 dbSNP
rs1382660523 134 dbSNP
rs759202880 142 dbSNP
rs907493787 144 dbSNP
rs1469712414 147 dbSNP
rs149800125 153 dbSNP
rs140867747 154 dbSNP
rs1461987506 160 dbSNP
rs147243611 169 dbSNP
rs1262738862 175 dbSNP
rs1196434366 180 dbSNP
rs72720992 183 dbSNP
rs569375888 184 dbSNP
rs1427707721 185 dbSNP
rs113541188 187 dbSNP
rs1318473472 194 dbSNP
rs931131003 202 dbSNP
rs549373637 207 dbSNP
rs1021370743 210 dbSNP
rs1345818930 211 dbSNP
rs561534035 219 dbSNP
rs1223097332 220 dbSNP
rs1370561608 225 dbSNP
rs143871976 226 dbSNP
rs777622118 243 dbSNP
rs891591306 244 dbSNP
rs542029937 247 dbSNP
rs541306145 249 dbSNP
rs886063873 251 dbSNP
rs1052976821 255 dbSNP
rs7019896 256 dbSNP
rs1464884570 258 dbSNP
rs561943265 262 dbSNP
rs901751832 264 dbSNP
rs986446525 266 dbSNP
rs140170339 268 dbSNP
rs1176800778 272 dbSNP
rs1020004878 274 dbSNP
rs1441609440 277 dbSNP
rs190558555 286 dbSNP
rs1365041009 287 dbSNP
rs1423874432 290 dbSNP
rs1324160947 293 dbSNP
rs957133647 294 dbSNP
rs1439812965 296 dbSNP
rs1034514477 308 dbSNP
rs57903353 309 dbSNP
rs543881966 311 dbSNP
rs1049105472 315 dbSNP
rs41274023 316 dbSNP
rs907418686 318 dbSNP
rs1018 323 dbSNP
rs869 331 dbSNP
rs992309306 332 dbSNP
rs1436413298 334 dbSNP
rs1204339561 341 dbSNP
rs1486739669 348 dbSNP
rs1459206538 357 dbSNP
rs1181992403 369 dbSNP
rs1384643153 375 dbSNP
rs535304342 377 dbSNP
rs1285860020 381 dbSNP
rs1445357691 382 dbSNP
rs41274021 383 dbSNP
rs10971412 386 dbSNP
rs980213146 387 dbSNP
rs969710415 394 dbSNP
rs1400771844 395 dbSNP
rs1246123190 397 dbSNP
rs930702492 400 dbSNP
rs1021798611 406 dbSNP
rs1358052208 409 dbSNP
rs1334324996 410 dbSNP
rs1381367019 412 dbSNP
rs41274019 414 dbSNP
rs1383497840 418 dbSNP
rs1286457504 425 dbSNP
rs1338091797 426 dbSNP
rs1214504202 429 dbSNP
rs1259043405 430 dbSNP
rs1320481841 431 dbSNP
rs1201974626 439 dbSNP
rs148351595 453 dbSNP
rs569460810 454 dbSNP
rs1430446512 461 dbSNP
rs1359240201 462 dbSNP
rs143366665 477 dbSNP
rs750880059 477 dbSNP
rs901804073 478 dbSNP
rs1165987040 481 dbSNP
rs1467030107 487 dbSNP
rs1173790177 488 dbSNP
rs1404979712 489 dbSNP
rs1414542181 492 dbSNP
rs181621586 493 dbSNP
rs967349862 495 dbSNP
rs878951274 500 dbSNP
rs768154677 505 dbSNP
rs1162966924 508 dbSNP
rs767254817 516 dbSNP
rs532823850 522 dbSNP
rs1262675930 535 dbSNP
rs1262744786 536 dbSNP
rs1345894879 549 dbSNP
rs912873619 553 dbSNP
rs887750583 558 dbSNP
rs1487167047 561 dbSNP
rs989871701 563 dbSNP
rs1192818981 569 dbSNP
rs767972737 569 dbSNP
rs577696308 581 dbSNP
rs555971971 588 dbSNP
rs570405801 592 dbSNP
rs1056680108 594 dbSNP
rs1223069630 597 dbSNP
rs547053456 601 dbSNP
rs1263095107 611 dbSNP
rs926863439 615 dbSNP
rs981011210 619 dbSNP
rs1173992263 624 dbSNP
rs970139373 628 dbSNP
rs914217014 636 dbSNP
rs1228968390 638 dbSNP
rs189274653 642 dbSNP
rs955820156 643 dbSNP
rs1031377257 648 dbSNP
rs971573064 649 dbSNP
rs562412427 651 dbSNP
rs997346003 654 dbSNP
rs1403639769 668 dbSNP
rs1282971533 669 dbSNP
rs1024530433 671 dbSNP
rs1294381002 673 dbSNP
rs1235637062 679 dbSNP
rs149481193 690 dbSNP
rs1350023351 691 dbSNP
rs1217516149 692 dbSNP
rs1338850844 694 dbSNP
rs1305515527 696 dbSNP
rs185861239 705 dbSNP
rs779761525 706 dbSNP
rs886063872 706 dbSNP
rs1266351011 708 dbSNP
rs1017947758 709 dbSNP
rs762311151 711 dbSNP
rs886063871 714 dbSNP
rs1200521204 718 dbSNP
rs1361761049 729 dbSNP
rs537888935 738 dbSNP
rs1463567388 739 dbSNP
rs1007449052 741 dbSNP
rs1169958991 742 dbSNP
rs887673017 743 dbSNP
rs1158651915 744 dbSNP
rs1381636376 747 dbSNP
rs1423232554 749 dbSNP
rs1303108840 755 dbSNP
rs776922607 756 dbSNP
rs900557962 759 dbSNP
rs531529824 763 dbSNP
rs1335470916 764 dbSNP
rs1241157580 773 dbSNP
rs1311483101 793 dbSNP
rs1357399833 801 dbSNP
rs993897011 809 dbSNP
rs897950332 811 dbSNP
rs1056522106 813 dbSNP
rs942510129 818 dbSNP
rs563811595 820 dbSNP
rs1480107091 821 dbSNP
rs939506613 822 dbSNP
rs905329846 823 dbSNP
rs16918999 829 dbSNP
rs947015726 831 dbSNP
rs137953955 832 dbSNP
rs915468428 837 dbSNP
rs989868209 858 dbSNP
rs764473672 868 dbSNP
rs1396245447 872 dbSNP
rs145214286 873 dbSNP
rs41316025 879 dbSNP
rs1380637670 885 dbSNP
rs971165035 888 dbSNP
rs1299775690 893 dbSNP
rs1393244224 895 dbSNP
rs1246916490 897 dbSNP
rs1249349071 903 dbSNP
rs975772091 906 dbSNP
rs965863788 913 dbSNP
rs983675797 924 dbSNP
rs886063870 925 dbSNP
rs1459584661 929 dbSNP
rs1162864921 951 dbSNP
rs951023277 955 dbSNP
rs1256253699 957 dbSNP
rs776466184 964 dbSNP
rs1408567970 965 dbSNP
rs1176963428 972 dbSNP
rs1479975885 982 dbSNP
rs1423308483 983 dbSNP
rs1375898326 986 dbSNP
rs1466506515 991 dbSNP
rs1017414877 994 dbSNP
rs757663178 999 dbSNP
rs76703260 1005 dbSNP
rs1249145171 1006 dbSNP
rs1303441871 1007 dbSNP
rs1397671305 1008 dbSNP
rs1176404378 1010 dbSNP
rs1339568203 1012 dbSNP
rs41274017 1014 dbSNP
rs900524876 1021 dbSNP
rs1320894580 1024 dbSNP
rs375458325 1027 dbSNP
rs535693848 1028 dbSNP
rs897793583 1032 dbSNP
rs569899973 1038 dbSNP
rs760321607 1053 dbSNP
rs1035114852 1054 dbSNP
rs1478350455 1064 dbSNP
rs375455006 1080 dbSNP
rs1344700113 1081 dbSNP
rs1427654421 1084 dbSNP
rs905255636 1086 dbSNP
rs753854896 1088 dbSNP
rs1045267424 1089 dbSNP
rs1241728288 1090 dbSNP
rs1360932887 1094 dbSNP
rs946869093 1107 dbSNP
rs1451778140 1111 dbSNP
rs1296251627 1119 dbSNP
rs146744987 1122 dbSNP
rs1308702065 1136 dbSNP
rs1053078929 1149 dbSNP
rs1343435909 1152 dbSNP
rs934337448 1154 dbSNP
rs180823182 1155 dbSNP
rs1313418021 1164 dbSNP
rs1385321278 1165 dbSNP
rs924251328 1166 dbSNP
rs975822912 1170 dbSNP
rs1337602244 1171 dbSNP
rs1469130639 1179 dbSNP
rs944487572 1183 dbSNP
rs551622189 1185 dbSNP
rs771909430 1186 dbSNP
rs935623998 1187 dbSNP
rs1417401302 1190 dbSNP
rs926932396 1190 dbSNP
rs547381574 1210 dbSNP
rs1363155358 1212 dbSNP
rs986019722 1221 dbSNP
rs1420183955 1231 dbSNP
rs1299998364 1234 dbSNP
rs949776952 1236 dbSNP
rs1435560887 1237 dbSNP
rs951931183 1243 dbSNP
rs1243405288 1247 dbSNP
rs1293741151 1248 dbSNP
rs917038137 1260 dbSNP
rs1182544158 1264 dbSNP
rs983989529 1265 dbSNP
rs1263053859 1266 dbSNP
rs950933954 1267 dbSNP
rs878970707 1269 dbSNP
rs533509723 1271 dbSNP
rs1321476955 1277 dbSNP
rs1222852317 1287 dbSNP
rs1248829760 1291 dbSNP
rs568413248 1293 dbSNP
rs1178287439 1298 dbSNP
rs1238827304 1299 dbSNP
rs189592532 1301 dbSNP
rs1160362302 1302 dbSNP
rs1411613322 1308 dbSNP
rs964956386 1319 dbSNP
rs886063869 1327 dbSNP
rs886063868 1332 dbSNP
rs1444067320 1334 dbSNP
rs886063867 1337 dbSNP
rs1017556568 1340 dbSNP
rs1376960064 1341 dbSNP
rs962054740 1347 dbSNP
rs1282935316 1350 dbSNP
rs1356186145 1355 dbSNP
rs1352108524 1357 dbSNP
rs1285901285 1359 dbSNP
rs1306160821 1359 dbSNP
rs778604135 1369 dbSNP
rs150168782 1370 dbSNP
rs1459135868 1372 dbSNP
rs1181897052 1373 dbSNP
rs1236988682 1374 dbSNP
rs562648583 1380 dbSNP
rs1316023746 1384 dbSNP
rs1415654005 1386 dbSNP
rs867596198 1387 dbSNP
rs1338493468 1398 dbSNP
rs1400659626 1401 dbSNP
rs1010460454 1403 dbSNP
rs1449352527 1405 dbSNP
rs1320123728 1409 dbSNP
rs891638705 1412 dbSNP
rs1338875561 1416 dbSNP
rs969536906 1422 dbSNP
rs1024138153 1440 dbSNP
rs1320196550 1441 dbSNP
rs552058659 1446 dbSNP
rs1011078801 1451 dbSNP
rs1198969957 1456 dbSNP
rs533482397 1457 dbSNP
rs564383128 1461 dbSNP
rs1210695947 1463 dbSNP
rs1044074125 1468 dbSNP
rs1385247082 1483 dbSNP
rs1052650394 1484 dbSNP
rs999709603 1488 dbSNP
rs41303661 1499 dbSNP
rs56800565 1500 dbSNP
rs944368064 1501 dbSNP
rs548121061 1506 dbSNP
rs1047488808 1510 dbSNP
rs562079950 1514 dbSNP
rs542096432 1516 dbSNP
rs1399938960 1524 dbSNP
rs973581935 1530 dbSNP
rs964923582 1532 dbSNP
rs1050563933 1533 dbSNP
rs1231297026 1539 dbSNP
rs780311179 1544 dbSNP
rs191562209 1545 dbSNP
rs1283975601 1550 dbSNP
rs1490865127 1554 dbSNP
rs1263582638 1557 dbSNP
rs1448565811 1577 dbSNP
rs1196280815 1579 dbSNP
rs1376773886 1584 dbSNP
rs1478068163 1585 dbSNP
rs1292507867 1586 dbSNP
rs1173753413 1594 dbSNP
rs1377970066 1599 dbSNP
rs1419583494 1600 dbSNP
rs987394990 1609 dbSNP
rs1354589308 1610 dbSNP
rs920398173 1612 dbSNP
rs1385506515 1613 dbSNP
rs556356971 1628 dbSNP
rs1323130904 1634 dbSNP
rs1331826642 1640 dbSNP
rs971870718 1641 dbSNP
rs1438890297 1643 dbSNP
rs961982052 1652 dbSNP
rs16918998 1664 dbSNP
rs1239303459 1672 dbSNP
rs113144091 1676 dbSNP
rs1352558246 1676 dbSNP
rs1207911920 1677 dbSNP
rs1266415816 1678 dbSNP
rs1451763524 1681 dbSNP
rs576876668 1687 dbSNP
rs17326539 1688 dbSNP
rs1366109684 1689 dbSNP
rs1159767935 1690 dbSNP
rs1322369245 1696 dbSNP
rs1032840532 1697 dbSNP
rs1398234149 1702 dbSNP
rs757723914 1709 dbSNP
rs1023730028 1712 dbSNP
rs1168096401 1717 dbSNP
rs905743531 1718 dbSNP
rs1423290687 1723 dbSNP
rs1011380108 1724 dbSNP
rs17247945 1738 dbSNP
rs886063866 1751 dbSNP
rs1481744561 1753 dbSNP
rs1309882561 1760 dbSNP
rs1031154035 1761 dbSNP
rs1270221443 1763 dbSNP
rs17326497 1766 dbSNP
rs901471912 1767 dbSNP
rs867937924 1778 dbSNP
rs1449912159 1779 dbSNP
rs1255824261 1781 dbSNP
rs1456923975 1782 dbSNP
rs1178642428 1784 dbSNP
rs1252062579 1785 dbSNP
rs1275407098 1788 dbSNP
rs1008570797 1791 dbSNP
rs1463393133 1797 dbSNP
rs888749134 1805 dbSNP
rs1050201011 1807 dbSNP
rs943544271 1818 dbSNP
rs930411221 1834 dbSNP
rs1400187539 1835 dbSNP
rs528782588 1840 dbSNP
rs1311981484 1841 dbSNP
rs1036232682 1847 dbSNP
rs1225100528 1860 dbSNP
rs187075558 1861 dbSNP
rs955158465 1862 dbSNP
rs1316849462 1871 dbSNP
rs886063865 1874 dbSNP
rs1198904315 1888 dbSNP
rs3841451 1891 dbSNP
rs913885804 1893 dbSNP
rs927871021 1898 dbSNP
rs1257559048 1905 dbSNP
rs981993234 1909 dbSNP
rs376719802 1910 dbSNP
rs969429731 1912 dbSNP
rs1423372741 1918 dbSNP
rs1478244230 1920 dbSNP
rs1172856076 1924 dbSNP
rs916545028 1936 dbSNP
rs1465657627 1941 dbSNP
rs1302187876 1942 dbSNP
rs1329144530 1949 dbSNP
rs1464719171 1955 dbSNP
rs989479490 1958 dbSNP
rs1397670958 1968 dbSNP
rs1339626676 1972 dbSNP
rs371446418 1975 dbSNP
rs753100140 1982 dbSNP
rs958138287 1984 dbSNP
rs1231981741 1995 dbSNP
rs1256079744 2001 dbSNP
rs1426540164 2016 dbSNP
rs1803717 2021 dbSNP
rs763928825 2022 dbSNP
rs1191087624 2023 dbSNP
rs1477087146 2024 dbSNP
rs1215116831 2026 dbSNP
rs767384487 2035 dbSNP
rs1488848980 2038 dbSNP
rs78409522 2041 dbSNP
rs527240435 2044 dbSNP
rs978550562 2047 dbSNP
rs978231896 2062 dbSNP
rs1176805091 2064 dbSNP
rs965484177 2066 dbSNP
rs532160095 2067 dbSNP
rs564649137 2068 dbSNP
rs1019836635 2070 dbSNP
rs1156818230 2074 dbSNP
rs184203621 2079 dbSNP
rs1323940944 2103 dbSNP
rs16918997 2104 dbSNP
rs1217349858 2115 dbSNP
rs1374884964 2122 dbSNP
rs1301300153 2125 dbSNP
rs895763052 2126 dbSNP
rs1445389802 2131 dbSNP
rs561769709 2133 dbSNP
rs1338261781 2135 dbSNP
rs1454948786 2138 dbSNP
rs1360047961 2143 dbSNP
rs1175978373 2144 dbSNP
rs1413328933 2146 dbSNP
rs1025972509 2147 dbSNP
rs1410783049 2160 dbSNP
rs1159378810 2162 dbSNP
rs1439130103 2163 dbSNP
rs1236614911 2164 dbSNP
rs1291920852 2165 dbSNP
rs1185600578 2166 dbSNP
rs759484311 2169 dbSNP
rs1236616932 2170 dbSNP
rs1488249127 2170 dbSNP
rs1207755087 2171 dbSNP
rs746956537 2172 dbSNP
rs1284846196 2173 dbSNP
rs1437960635 2173 dbSNP
rs1238849386 2174 dbSNP
rs1176689734 2175 dbSNP
rs7041909 2175 dbSNP
rs1029102981 2176 dbSNP
rs147768292 2176 dbSNP
rs374921974 2176 dbSNP
rs111345260 2177 dbSNP
rs1316748847 2177 dbSNP
rs886063864 2177 dbSNP
rs1307903241 2178 dbSNP
rs45480798 2178 dbSNP
rs754771244 2178 dbSNP
rs769799377 2178 dbSNP
rs770356020 2178 dbSNP
rs1064950 2179 dbSNP
rs1246166994 2179 dbSNP
rs1222553014 2180 dbSNP
rs1377977871 2180 dbSNP
rs763903279 2181 dbSNP
rs1456498318 2182 dbSNP
rs1238880898 2183 dbSNP
rs1302690542 2183 dbSNP
rs796930062 2184 dbSNP
rs906338622 2184 dbSNP
rs1328213165 2185 dbSNP
rs13289751 2185 dbSNP
rs1411322624 2185 dbSNP
rs1347503201 2186 dbSNP
rs1463743667 2186 dbSNP
rs1299300025 2187 dbSNP
rs796346335 2188 dbSNP
rs1282992752 2189 dbSNP
rs1378494269 2189 dbSNP
rs1037432896 2190 dbSNP
rs1234358909 2190 dbSNP
rs1046328462 2191 dbSNP
rs1316233777 2191 dbSNP
rs889269349 2192 dbSNP
rs1424674399 2193 dbSNP
rs1439678672 2195 dbSNP
rs1413338805 2197 dbSNP
rs1235728409 2198 dbSNP
rs1179937717 2202 dbSNP
rs35504729 2203 dbSNP
rs1160392153 2204 dbSNP
rs1169567012 2204 dbSNP
rs1218218821 2204 dbSNP
rs1271045387 2204 dbSNP
rs1332768103 2204 dbSNP
rs1341547414 2204 dbSNP
rs1359025158 2204 dbSNP
rs1411208259 2204 dbSNP
rs1415952971 2204 dbSNP
rs1419581682 2204 dbSNP
rs1419781808 2204 dbSNP
rs1423376687 2204 dbSNP
rs1476193152 2204 dbSNP
rs1476612908 2204 dbSNP
rs1482887107 2204 dbSNP
rs751351046 2204 dbSNP
rs886063863 2204 dbSNP
rs1170233673 2205 dbSNP
rs7041783 2206 dbSNP
rs1486709906 2208 dbSNP
rs1423885045 2211 dbSNP
rs1435845966 2213 dbSNP
rs1176126004 2214 dbSNP
rs1263838629 2216 dbSNP
rs1052387273 2217 dbSNP
rs1319392494 2219 dbSNP
rs1328361309 2220 dbSNP
rs947989541 2221 dbSNP
rs541787590 2222 dbSNP
rs989926711 2226 dbSNP
rs936635397 2234 dbSNP
rs368519327 2238 dbSNP
rs1310110319 2243 dbSNP
rs576341394 2248 dbSNP
rs925332395 2251 dbSNP
rs74995636 2253 dbSNP
rs371831330 2262 dbSNP
rs374364990 2265 dbSNP
rs74772022 2269 dbSNP
rs745322216 2271 dbSNP
rs1454375870 2280 dbSNP
rs116375484 2281 dbSNP
rs1379077220 2283 dbSNP
rs1419637935 2287 dbSNP
rs1159457117 2289 dbSNP
rs1387630916 2291 dbSNP
rs886063862 2292 dbSNP
rs985632600 2293 dbSNP
rs553864348 2295 dbSNP
rs954474360 2296 dbSNP
rs761196389 2299 dbSNP
rs994915693 2300 dbSNP
rs959950114 2304 dbSNP
rs1430113128 2308 dbSNP
rs898800578 2308 dbSNP
rs531869620 2310 dbSNP
rs774394805 2311 dbSNP
rs1261052777 2319 dbSNP
rs1014697177 2321 dbSNP
rs1352629449 2322 dbSNP
rs768566333 2325 dbSNP
rs1272220286 2327 dbSNP
rs533627511 2329 dbSNP
rs1192655968 2330 dbSNP
rs1476840782 2332 dbSNP
rs1214949013 2334 dbSNP
rs993156099 2335 dbSNP
rs1270924006 2340 dbSNP
rs749146295 2347 dbSNP
rs898849257 2351 dbSNP
rs367581361 2354 dbSNP
rs574554324 2355 dbSNP
rs775197030 2364 dbSNP
rs947905109 2365 dbSNP
rs1206100420 2366 dbSNP
rs895057619 2367 dbSNP
rs192108272 2379 dbSNP
rs537799576 2385 dbSNP
rs1399686291 2387 dbSNP
rs886063861 2399 dbSNP
rs1307681606 2400 dbSNP
rs188764568 2402 dbSNP
rs1242426712 2403 dbSNP
rs1292457014 2404 dbSNP
rs140793406 2405 dbSNP
rs1285722171 2410 dbSNP
rs558569071 2419 dbSNP
rs978042680 2420 dbSNP
rs1366945989 2436 dbSNP
rs944153101 2440 dbSNP
rs75201363 2441 dbSNP
rs1187610998 2442 dbSNP
rs1463778315 2443 dbSNP
rs34791389 2446 dbSNP
rs1419062928 2450 dbSNP
rs1053134036 2452 dbSNP
rs770013565 2453 dbSNP
rs1168852311 2455 dbSNP
rs184223660 2458 dbSNP
rs920180628 2459 dbSNP
rs974295364 2461 dbSNP
rs963061253 2464 dbSNP
rs749777226 2471 dbSNP
rs546746382 2486 dbSNP
rs746049762 2489 dbSNP
rs116898233 2490 dbSNP
rs992636228 2499 dbSNP
rs1275972668 2500 dbSNP
rs1306410180 2501 dbSNP
rs140042694 2506 dbSNP
rs13764 2508 dbSNP
rs568178663 2528 dbSNP
rs1457987431 2535 dbSNP
rs76945433 2540 dbSNP
rs1486886753 2544 dbSNP
rs1024724935 2552 dbSNP
rs781165196 2565 dbSNP
rs971941490 2567 dbSNP
rs886063860 2569 dbSNP
rs1172553320 2574 dbSNP
rs1376024471 2575 dbSNP
rs1432747596 2576 dbSNP
rs1258318120 2588 dbSNP
rs894950366 2589 dbSNP
rs1311689591 2591 dbSNP
rs1375825378 2593 dbSNP
rs1054131107 2612 dbSNP
rs10412 2613 dbSNP
rs1007214725 2618 dbSNP
rs1382458883 2621 dbSNP
rs902422945 2624 dbSNP
rs953095796 2637 dbSNP
rs563238472 2638 dbSNP
rs997668943 2640 dbSNP
rs892639032 2655 dbSNP
rs1214823446 2657 dbSNP
rs944037113 2658 dbSNP
rs912642354 2661 dbSNP
rs1486292161 2663 dbSNP
rs1188544444 2665 dbSNP
rs1265325352 2672 dbSNP
rs555420709 2680 dbSNP
rs747040675 2685 dbSNP
rs904141337 2687 dbSNP
rs1049803185 2688 dbSNP
rs1395538345 2697 dbSNP
rs1436518449 2702 dbSNP
rs932828127 2708 dbSNP
rs1045055969 2709 dbSNP
rs1173103888 2710 dbSNP
rs920085169 2715 dbSNP
rs1290316427 2717 dbSNP
rs886063859 2718 dbSNP
rs1465533797 2720 dbSNP
rs1375855004 2723 dbSNP
rs1391637737 2724 dbSNP
rs374700518 2729 dbSNP
rs948038002 2731 dbSNP
rs1439748314 2732 dbSNP
rs11548671 2734 dbSNP
rs1238642544 2743 dbSNP
rs756468800 2745 dbSNP
rs1237206948 2746 dbSNP
rs532766729 2747 dbSNP
rs1056965505 2755 dbSNP
rs1218189963 2757 dbSNP
rs961651633 2758 dbSNP
rs1803716 2759 dbSNP
rs1456718434 2773 dbSNP
rs1258627598 2783 dbSNP
rs190731618 2786 dbSNP
rs534250668 2787 dbSNP
rs983155566 2787 dbSNP
rs758971135 2791 dbSNP
rs1483234108 2799 dbSNP
rs971910434 2800 dbSNP
rs781337108 2801 dbSNP
rs1391750267 2802 dbSNP
rs1025157253 2807 dbSNP
rs1325939210 2811 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.424 2.2e-2 -0.381 3.6e-2 23 Click to see details
GSE21849 B cell lymphoma -0.368 2.5e-2 -0.165 2.0e-1 29 Click to see details
GSE21032 Prostate cancer -0.21 2.8e-2 -0.175 5.7e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.432 2.9e-2 0.474 1.7e-2 20 Click to see details
GSE17306 Multiple myeloma -0.263 3.4e-2 -0.350 6.8e-3 49 Click to see details
GSE38226 Liver fibrosis 0.273 1.2e-1 0.321 7.8e-2 21 Click to see details
GSE32688 Pancreatic cancer -0.215 1.2e-1 0.058 3.8e-1 32 Click to see details
GSE19350 CNS germ cell tumors -0.366 1.2e-1 -0.650 1.1e-2 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.239 1.6e-1 0.099 3.4e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.11 1.9e-1 -0.009 4.7e-1 64 Click to see details
GSE17498 Multiple myeloma 0.117 2.4e-1 0.156 1.7e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.112 3.0e-1 0.001 5.0e-1 25 Click to see details
GSE28544 Breast cancer -0.094 3.3e-1 -0.347 4.8e-2 24 Click to see details
GSE19783 ER- ER- breast cancer -0.047 3.4e-1 -0.028 4.0e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.074 3.7e-1 0.142 2.5e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.065 3.8e-1 -0.230 1.3e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.067 4.1e-1 -0.016 4.8e-1 13 Click to see details
GSE14794 Lymphoblastoid cells -0.023 4.1e-1 0.023 4.1e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.034 4.5e-1 0.053 4.2e-1 16 Click to see details
GSE19536 Breast cancer 0.012 4.5e-1 0.034 3.7e-1 100 Click to see details
GSE19536 Breast cancer 0.012 4.5e-1 0.034 3.7e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.544 0 0.602 0 32 Click to see details
BLCA 0.689 0 0.752 0 18 Click to see details
BRCA -0.32 0 -0.318 0 84 Click to see details
THCA -0.276 0.02 -0.316 0.01 59 Click to see details
KIRP -0.327 0.03 -0.346 0.03 32 Click to see details
LUSC 0.299 0.03 0.288 0.04 38 Click to see details
PAAD -0.837 0.08 -1.000 0.5 4 Click to see details
LIHC -0.186 0.1 -0.127 0.19 49 Click to see details
HNSC -0.196 0.11 -0.156 0.16 42 Click to see details
LUAD 0.375 0.11 0.308 0.17 12 Click to see details
PCPG 0.874 0.16 0.500 0.33 3 Click to see details
COAD 0.384 0.17 0.071 0.43 8 Click to see details
KICH 0.169 0.21 0.128 0.27 25 Click to see details
CESC -0.783 0.21 -0.500 0.33 3 Click to see details
PRAD 0.104 0.24 0.046 0.38 50 Click to see details
UCEC 0.1 0.34 0.235 0.17 19 Click to see details
CHOL 0.148 0.35 -0.067 0.43 9 Click to see details
KIRC 0.037 0.38 0.028 0.41 68 Click to see details
ESCA -0.022 0.47 -0.164 0.31 11 Click to see details
ESCA -0.022 0.47 -0.164 0.31 11 Click to see details
ESCA -0.022 0.47 -0.164 0.31 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*