miRTarBase - #MIRT727910 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CYLD   
Synonyms BRSS, CDMT, CYLD1, CYLDI, EAC, MFT, MFT1, SBS, TEM, USPL2
Description CYLD lysine 63 deubiquitinase
Transcript NM_001042355   
Other Transcripts NM_001042412 , NM_015247   
Expression
Putative miRNA Targets on CYLD
3'UTR of CYLD
(miRNA target sites are highlighted)
>CYLD|NM_001042355|3'UTR
   1 CTGGGGTCATCGGGAAAGGCAAAGAAACTGAAGGCAGAGTCCTAACGTTGCATCTTATTCGAGCTGGCAGTTCTGTTCAC
  81 GTCCATTGCCGGCAATGGATGTCTTTGTGGTGATGATCCTTCAGAAAAGGATGCCTCTGTTTAAAAACAAATTGCTTTTG
 161 TGTCCCTGAAGTATTTAATAAGAAGCATTTTGCACTCTAGAAAGTATGTTTGTGTTGGTTTTTTAAGAAGTCTAAATGAA
 241 GTTATTAATACCTGAAGCTTTAAGTTAAGTGCATTGATCATATGATATTTTTGGAAGCATACAATTTTAATTGTGGAAGT
 321 TTAAAGCCTCTTTTAGTCCATTGAGAATGTAAATAAATGTGTCTTCTTTATGGACCAAGGATATGAAATCATTTTTCTTT
 401 TGTAGCTAACGGTTGCCTTGAGGAAGAAATAATTTGGTTTTATTAAGAGTCTACTCTCAATCCAGTTATTAGAGATGTAC
 481 TGAGTTTGATTTGTTAATCCTTTCTATATACTGCTGATCTTGCATGTCTACAATCTGCTCAGTTTTTCTGTGTTTCTGCA
 561 ATAGTGGTCAGAAAAATACTTAAATTCCCTTAATGGTGTTGTTTTCTATTTGTTCTGGTTTTGAGATAAATGAGTGATTC
 641 TGTCCCCAAATGTCCATTTTTGAAGTGATTTTCCTGGAGGATTAGGGTATTTAGCAGTTGAAGCTCTTCATTCATAGTAG
 721 TTACTGTCAGCTAACAGGTTTTTTAAGGCTTTTAACTATTAATATTTTATGGAATGGGGCAAAGTAAATTGATGAAAGAA
 801 TTGGAGTGATAATAGTCCTTTACAAACATACAGTCCATAAGAAAATGAATTTGGCATATAGAATTATTACAATTTCCTGG
 881 GAGAGATGGATATTTAAACCTCTATTATTTTAGACAAGACTGTCTAGAACTTAAGTTTGATCTGTCAGCCAGTACTCCCA
 961 TTAAATTCAGTGTAGTTTCACTTGATAGAATCAGATATGTTATCGAAATGTTAGCAGCAGCTTCATCCTCCTTCTGATTA
1041 AAGTAAGTAGAAATGGGATGTTTTGTTTAATAACAGCCATAGTGTGTGTTTAGACCACAGCGGATGTTGTAGACCAGGAC
1121 CATAGATGATACATGTCAGTGCTGTGGAATGTGCATTCTCTGAGTGTTGTTTTGTGGTATCATTGTCTTTCCTGAATGAC
1201 TTTCTAACTGTGCAGAAAGGCAGAAAAGTCATCATATGTATATGTCATATGACTTTATAAAATATTTAATGTGACAAAAA
1281 GTGGAAAGAATCTTTACAAACCCTGCAATTACTTTTTTAAAGGCACTTTTACTCTTTGGTTTTATCATTCCATTTTGCTA
1361 ATATTTACTAGCTTTATAAATTACAGTAAGGTACAAAAACTCATCTTGTAATATTTTCATTTTTGAAGTGAAAAAGTACA
1441 TATATTTTGCACAAGGTTTTATACTGCTAAGTGCTTGGTTGGGGTGGTGAGATGATGATTAGATCAGGGGTGAGGCTGAG
1521 AGACTCTGGGTTTAGGGCTAGCCCTGCCTCCATCTCCCTTGGGTAAAATGAAGGGTGTGGGGTAAAAGATGCATAAGGCC
1601 TTTTCTAGCTCTGACAGCCTAGAAGTCCAATCACCCTGTAATAAATATGTGTTGAATGAAGAAATGGGTGAATGAGCTTG
1681 TCAATGTGATTTTAAAAAATTGACTACCTGGAGGAATGATTAGGAATCTAAATGAAGCCAGCCCTCGGTATCTGCAGGTT
1761 TCTCATCCATGGATTCAACCAACTGCAAATGGAAAATACGATTTTTTTTAAAAAAAGGATGGTTACATCCGTATTGAACA
1841 TGTACAGACTTTTTTCTTGTCATTATTCTCTGAACAATACAAGAACTCTTTATGTAGCATTTACATTTATTAGGTATTAT
1921 AAGTAATCTAGAGATTATTTAATTAAAATATACAGGAGGATGTGTGTCAGTTATATGCAAATTCTGTACCATTTTGTATC
2001 AGGGAATTGAGCATCTTCAGATGTTGGTATCTGCAGGGATCCTGGAACCAAACCCCTGCAGATACTAAGGGCTGACGATC
2081 TAGGTAAGACTGGATTTAACAGTTGGAAAAAAAAAAAAAAAAGGAGAGAGAAGACAGTTCCTTTCCTGTAGAAATTAAAA
2161 CAAAATACAAATTGAGGAAGCTCTGCTACCCAGGCTGTCATGGTAGAGAACTTGAAGAAGACCTGTTTGGATGGACACCT
2241 GGTTTCAAAAGTCAGGTGTGGAGACTGTTAAATGGGAGGGCCTCATCCATAAATGATTTCTGGCAACGTCTTCTTCAGGT
2321 GGAGCTTGACGTCTTTTTAATGTTACTTGGGGAGGGAGTGCTCATTAAGGGATGCCAGGGCCAGCTCTGGTGGTTCCTGG
2401 GGAGGCTGCGTCCTTCCCTGCTTCTGCATGTCATGAGGCAGCAGGAAGGTTTCCCCTGCACCTGTCTGTCCTGGCTCCCT
2481 CTGGGTAGCCCCCTACTGTTCTGTGCTTCAGCACAGCCTGGTTTGTCAAGAGGCACATAGTTGGGGCTGGGCTGCATGGC
2561 ACAGGGGCTTATGTGCCTGCTGGTTATTTAATTTTCAGCCTTAAGTTTTCTTTAATATTTTCCTGTTGGCTATTTAAAGG
2641 TTTTGGTTATCTTTTATTCCTTATCTACAATCAAGATGACAATGTAATTGAATTATCTTATTTATAACACGGTTCGTGAT
2721 TCATGATTCATGATTACAAGTAGAAAATATGTCATGTTCCTCACCTCCAAATAAATATGTGTGTGTCTGTGTGTGTGTAT
2801 ATATGTATGTGGCGGAGAGGGAGAGAGTGGGGAAGGAGAGCAGTGTTATCATACATAGAGAGGCTAAATGTGTCCCATCC
2881 CTCACTGTCAGCTTTATAAAGGAGTTTGACTCCATCCACAGAAGAATGTTTTATAAGACTAGGAAAACACGTTGAAAACT
2961 AGGATAAACAGCAACAAAAATCAACTAAATATGTTGTTACTGTTGCTAAGGATTTTCTCCTTAGAATAATTTAGGATTTT
3041 TAAAAATTTCTGTTTGCCAAATGCTGTAGATAAATGGCCAGATTCTTCCTATCCCTAGGATTCCTTTATTATTTTTTTTC
3121 ACAGATTTTGAGAACAAGGGGGAGAGATAGTATGGAAGATTAAGATTCCATTAATCTTATAGAACTGTGTTGTCACCCAA
3201 ATTCCTGCTTGTTTGAACATGGCATCTTCATAGATTCAGGATTCACTACCCTCTATAGCTGGATCTTGAAAATTATCTGG
3281 CCAGATAATTTTGCATCTGCTTGGATGATTGTAGACTGAGATGTGAGTGGAGGATAAAGTATTAGACTTTTGCTGAGTAA
3361 CTGCCAACCAAGAAGTATTTATCGGACACTTACTAGGTGCCTAGGATTGTATCAGAGGGAATATGAAATGTGTCCCTGCC
3441 CTACCTAGTTTTAACGACAGAATATCTATTAAAGGCTACTTAGCTGAAGGGTAAGGGTGACAGGTCTAGGGGAAGCTTTG
3521 GGAGGTGGTGTGCTGTGACAGAAAAAGTGGCAGAGTAGGGACGAGAGACCTGCATTCTAGCCCTGTTTCTGTCACTTGCT
3601 CTGTACACTTAGACAACAGCTTGACCTCTTGAGCTTTAGTTTCCTCCTCTGCATAATGAGAGGGTTAGACTACTGAATTG
3681 TATGGGAAAAAAATACAAATTCCTGGGTCCTAGGCCATGCCTGCTGAATCCGACTGTTCAGGAAGAGGCCTAGGAAATCT
3761 GTGAGGGAATCCCCAGGGGAATCTCGTGACCAGCCAGGTGTGAAATCTGCTAACTGGAAGATCTCAAAGCTTCCTTCACT
3841 TTTTGTGATTTTGTGGTCATGTAACGTTACTGTATTATTCTACGTAAATGTGGGTACTTGGATGTTTATCATACTGTTTC
3921 TCTGTGTTTACATACTAATTTGTGTAAGAAATGCATTTTAGTCTGTGTACCTCAACCTGCTGTTTGTTTCCTAGAGGTGT
4001 TAGTAGTCTTTAAATACAAGTAAGACTTAAGAGGATATTTGATGTTATTTACCTGGATATTTTCTTCCCCTTTTATTTAT
4081 TTAGAGGAAATTGAGATTCTAGGAGCCAAAAAAATGAAAACAAAATTCTAAGGCAAAGTTAAAGAAAAAAATTACATTAT
4161 TTCTTACCATTTGCTACTTTATAATGAAAATTTAAAAATTATATGGGAAGATTTTTCTCTGGGATAACAAATCCTTGTCA
4241 TAAAGTAAGAGGTCTTTTTAAAGTAGGTAGGCTATAAGGCCTGTAATTTAAAATAATACTCCTTTCTCTAGGGTTTGGTG
4321 CAATTCTCCATTAATGAAGATAACATTTGAATTCCCCAAAGCAGGTGAGGAGTCGGGGAGGAGAAAGCGATGTTAAAATG
4401 AAAACTCACTGCAAAAGAGGAGGCAGAGGAAGAAGGAATGTAAACCCCTTAAAGCAGATGTGTGTGGGGCCTTATGAAGA
4481 CCAGGATTCTGCGGGTGTCAGGGGATTGCCCCTCTTGACAGAGACTAGGGTTTTAGACTGAGGCTTCCTGCAGGGTGTTC
4561 GCATTGCCCTTCTCCGTTCCCCTTCAGACCTTTCTGGGGAGAAGAGGTGGGAGGAGGGGAGAAAGACTGTTCATCTTATT
4641 CTGAATCCTGGAGCAGCTGAAGGTTTTCTCTTGAGTCAGGATGCAGTGGTAATGCATTAACCAGCAAGTGTGGCCAAGGA
4721 TAATGAAAAAGTGGGAAAGGAAGGTCCTCCTCCTCCCTGATTGTAGCATCCAGCAGTCTCTGTAGCCAGGTTACTCAAGA
4801 ACCACATTTGATTTCCTGGCCCTTTGCCTTGGCAGTGATGGCATTTTTATTTCACTGTGTTTTAAAGTCTTCATTTATTT
4881 TTATAACATGGGTTAGGGAGAAGGGCCACAAATGGAGGGATTGTCCTTTCAAGCACCACAGCTTCAGATAAAATTAGTAC
4961 TTTCAAATATTGTCCACTTTAACTTAAAAAATTCTAGAGGGATTATATTGGAGACTCAACTGCCCTTGGTTTTAGTTTAT
5041 AAAATGGCCTAGTACTGTGGAATTTTAATTTTAGAAAGTCTTAGCATCAGATCATAAACATTCATTAAAAGAACTCACAT
5121 CCCATCTGAAACTTCCCAGGGGAGTTGGGATTCTTAGTAGATTGGTAGAAAGGGGCTCATTTTCTACTGCATTTCCCATT
5201 TTTGGTATCTTGTTCAGCATGTTTTATTTTTATTTCTTGTCTGCAGAACATCCTATATTTATGAGAACATTCTTTAAGAA
5281 GACCACCACATAGAATACCCCTTCCTATCAGCTCGCTCTGATTTAGCCTTAATTTTGTTAAATTTTTTAGAGATGAATGA
5361 AGTGCTGCTGTGGAAAGAAATGTACATATACTATTTCTGTATCATTAAAATTACATTTTTATGGTTCAAAAAAAAAAAAA
5441 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUG-GUAAUACACGACGAu 5'
             |:|:  || | |||||||| 
Target 5' tagAGATGAATGAAGTGCTGCTg 3'
5348 - 5370 155.00 -13.50
2
miRNA  3' guGUUUG-GUAAUA--CACGACGAu 5'
            :|||: ::||:|   ||:|||| 
Target 5' acTAAATATGTTGTTACTGTTGCTa 3'
2984 - 3008 138.00 -9.50
3
miRNA  3' guGUUUGGUAAUACAC-GACGAu 5'
            ||::   ||||||| ||||| 
Target 5' caCAGGGGCTTATGTGCCTGCTg 3'
2560 - 2582 136.00 -18.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
887868 30 ClinVar
319510 48 ClinVar
884715 60 ClinVar
884716 140 ClinVar
884717 207 ClinVar
885654 281 ClinVar
319511 383 ClinVar
319512 404 ClinVar
319513 469 ClinVar
319514 699 ClinVar
319515 780 ClinVar
319516 832 ClinVar
319517 838 ClinVar
319518 842 ClinVar
884773 1034 ClinVar
884774 1035 ClinVar
319519 1103 ClinVar
885714 1192 ClinVar
885715 1192 ClinVar
319520 1246 ClinVar
319521 1309 ClinVar
319522 1342 ClinVar
319523 1576 ClinVar
319524 1584 ClinVar
319525 1591 ClinVar
884839 1652 ClinVar
319526 1668 ClinVar
319527 1728 ClinVar
319528 1747 ClinVar
319529 1811 ClinVar
319530 1832 ClinVar
319531 1984 ClinVar
886776 2027 ClinVar
319532 2107 ClinVar
319533 2107 ClinVar
888053 2114 ClinVar
888054 2148 ClinVar
319534 2151 ClinVar
319535 2237 ClinVar
319536 2306 ClinVar
319537 2336 ClinVar
319538 2370 ClinVar
885845 2425 ClinVar
319539 2439 ClinVar
886839 2522 ClinVar
319540 2557 ClinVar
319541 2616 ClinVar
319542 2647 ClinVar
319543 2711 ClinVar
884989 2849 ClinVar
319544 2857 ClinVar
319545 2976 ClinVar
319546 3001 ClinVar
319547 3071 ClinVar
319548 3112 ClinVar
319549 3149 ClinVar
886903 3152 ClinVar
319550 3230 ClinVar
319551 3306 ClinVar
319552 3385 ClinVar
885050 3463 ClinVar
319553 3470 ClinVar
885051 3590 ClinVar
319554 3615 ClinVar
319555 3680 ClinVar
319556 3723 ClinVar
319557 3732 ClinVar
319558 3737 ClinVar
319559 3740 ClinVar
888241 3852 ClinVar
885133 3866 ClinVar
319560 4389 ClinVar
319561 4471 ClinVar
319562 4486 ClinVar
319563 4495 ClinVar
886040 4515 ClinVar
887035 4531 ClinVar
319564 4562 ClinVar
319565 4568 ClinVar
319566 4692 ClinVar
319567 4703 ClinVar
319568 4842 ClinVar
319569 4886 ClinVar
319570 4888 ClinVar
319571 4948 ClinVar
886098 5061 ClinVar
319572 5087 ClinVar
319573 5273 ClinVar
887102 5328 ClinVar
319574 5385 ClinVar
COSN30502603 12 COSMIC
COSN30185130 13 COSMIC
COSN30185126 15 COSMIC
COSN31581545 40 COSMIC
COSN30520080 47 COSMIC
COSN30504295 49 COSMIC
COSN30104620 59 COSMIC
COSN13675292 61 COSMIC
COSN30172127 64 COSMIC
COSN30504840 83 COSMIC
COSN28878939 225 COSMIC
COSN8233145 225 COSMIC
COSN8501070 252 COSMIC
COSN31550412 293 COSMIC
COSN9647549 766 COSMIC
COSN20905975 1748 COSMIC
COSN29917012 1751 COSMIC
COSN19549570 1810 COSMIC
COSN19551595 1817 COSMIC
COSN8233146 1905 COSMIC
COSN216781 2069 COSMIC
COSN20112869 2123 COSMIC
COSN16105930 2224 COSMIC
COSN15012342 2545 COSMIC
COSN17183214 2814 COSMIC
COSN8501071 3022 COSMIC
COSN31609360 3159 COSMIC
COSN8501072 3317 COSMIC
COSN24504617 3612 COSMIC
COSN22613214 3647 COSMIC
COSN17181773 3907 COSMIC
COSN21497809 4220 COSMIC
COSN19310949 4324 COSMIC
COSN32055897 4510 COSMIC
COSN26653941 4708 COSMIC
COSN30544991 4924 COSMIC
COSN8601743 5003 COSMIC
COSN31485870 5049 COSMIC
COSN31517206 5112 COSMIC
COSN31580053 5149 COSMIC
COSN15320263 5225 COSMIC
COSN31513725 5266 COSMIC
COSN31531418 5343 COSMIC
COSN4905113 5367 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1186236757 2 dbSNP
rs1305743685 2 dbSNP
rs1414918711 4 dbSNP
rs968276673 6 dbSNP
rs546095170 8 dbSNP
rs774586791 9 dbSNP
rs1405101347 10 dbSNP
rs373881703 12 dbSNP
rs767664383 12 dbSNP
rs748496132 13 dbSNP
rs1334325656 15 dbSNP
rs772503554 16 dbSNP
rs773694519 23 dbSNP
rs1309619290 24 dbSNP
rs761327786 34 dbSNP
rs376027595 35 dbSNP
rs774909997 37 dbSNP
rs1348585163 45 dbSNP
rs762474804 47 dbSNP
rs116979331 48 dbSNP
rs1442053657 51 dbSNP
rs1209039940 59 dbSNP
rs950448066 60 dbSNP
rs866233263 61 dbSNP
rs758747871 78 dbSNP
rs983593351 81 dbSNP
rs1275758699 82 dbSNP
rs908733170 85 dbSNP
rs1329747784 86 dbSNP
rs905940338 91 dbSNP
rs941521364 92 dbSNP
rs1001570263 93 dbSNP
rs1036112716 95 dbSNP
rs1318659244 96 dbSNP
rs531557092 99 dbSNP
rs1470888603 104 dbSNP
rs1402797576 107 dbSNP
rs1171968805 110 dbSNP
rs974384082 117 dbSNP
rs1374641192 119 dbSNP
rs1188736692 122 dbSNP
rs921479658 124 dbSNP
rs1245623930 132 dbSNP
rs1205039384 133 dbSNP
rs932640314 134 dbSNP
rs148107725 140 dbSNP
rs1279912735 148 dbSNP
rs1025532104 156 dbSNP
rs891227001 158 dbSNP
rs1343293118 177 dbSNP
rs945512349 179 dbSNP
rs548122771 180 dbSNP
rs1162519984 183 dbSNP
rs952558125 185 dbSNP
rs1364766726 187 dbSNP
rs1295742744 196 dbSNP
rs1391430276 199 dbSNP
rs1406870242 207 dbSNP
rs746394506 208 dbSNP
rs568159513 213 dbSNP
rs1412700639 219 dbSNP
rs1398278508 232 dbSNP
rs983951068 235 dbSNP
rs527388457 237 dbSNP
rs1185089744 242 dbSNP
rs1042849519 253 dbSNP
rs1236442301 260 dbSNP
rs1187380505 273 dbSNP
rs1441228562 274 dbSNP
rs868309372 280 dbSNP
rs1326667597 282 dbSNP
rs547036418 283 dbSNP
rs1349678559 284 dbSNP
rs1409401562 286 dbSNP
rs1289227154 292 dbSNP
rs942440465 298 dbSNP
rs976507009 305 dbSNP
rs1242775939 307 dbSNP
rs1265367617 311 dbSNP
rs922263979 327 dbSNP
rs903726337 340 dbSNP
rs1053815622 342 dbSNP
rs1001101214 346 dbSNP
rs1033566620 351 dbSNP
rs570093314 360 dbSNP
rs947582253 369 dbSNP
rs1043192089 372 dbSNP
rs906010696 376 dbSNP
rs142580891 383 dbSNP
rs1160978270 391 dbSNP
rs886052052 404 dbSNP
rs556456455 411 dbSNP
rs1421525629 416 dbSNP
rs1254557175 427 dbSNP
rs1183619790 434 dbSNP
rs1482926993 435 dbSNP
rs1186303966 456 dbSNP
rs1223965547 459 dbSNP
rs1322585933 466 dbSNP
rs886052053 469 dbSNP
rs1473710946 470 dbSNP
rs1226656388 476 dbSNP
rs1331360924 483 dbSNP
rs950368432 492 dbSNP
rs1288903558 499 dbSNP
rs1002040818 500 dbSNP
rs983260221 505 dbSNP
rs1295106032 514 dbSNP
rs1436695178 520 dbSNP
rs569984894 521 dbSNP
rs1348921213 531 dbSNP
rs1321226488 534 dbSNP
rs895812286 535 dbSNP
rs1412143376 538 dbSNP
rs1160482549 544 dbSNP
rs1472554567 549 dbSNP
rs994174234 559 dbSNP
rs751740183 562 dbSNP
rs1489038197 570 dbSNP
rs962918361 578 dbSNP
rs1219722989 588 dbSNP
rs1430183081 596 dbSNP
rs536048872 597 dbSNP
rs1268859981 599 dbSNP
rs1308851358 599 dbSNP
rs1227637819 609 dbSNP
rs1327030268 613 dbSNP
rs1303388722 617 dbSNP
rs1219558861 618 dbSNP
rs1366734589 619 dbSNP
rs1272705491 625 dbSNP
rs1436852020 638 dbSNP
rs1388644068 646 dbSNP
rs974606514 650 dbSNP
rs867122631 652 dbSNP
rs984010941 656 dbSNP
rs1457131066 665 dbSNP
rs1018140113 671 dbSNP
rs921531675 687 dbSNP
rs755189090 690 dbSNP
rs932859328 697 dbSNP
rs1341165948 698 dbSNP
rs541975303 699 dbSNP
rs1191917345 703 dbSNP
rs1451560282 705 dbSNP
rs1208167663 711 dbSNP
rs912592904 715 dbSNP
rs572542849 721 dbSNP
rs1341822997 725 dbSNP
rs1311338008 731 dbSNP
rs987749482 739 dbSNP
rs1230109143 741 dbSNP
rs541160720 753 dbSNP
rs1038854022 776 dbSNP
rs190787930 780 dbSNP
rs1276324253 790 dbSNP
rs1482091881 798 dbSNP
rs578058157 799 dbSNP
rs1199550199 803 dbSNP
rs1256199021 804 dbSNP
rs543813166 812 dbSNP
rs1467014684 813 dbSNP
rs1358875608 819 dbSNP
rs1172194980 822 dbSNP
rs1432072117 825 dbSNP
rs1325567898 828 dbSNP
rs1443650139 829 dbSNP
rs757230393 831 dbSNP
rs144877731 832 dbSNP
rs903903071 837 dbSNP
rs3743781 838 dbSNP
rs117537927 842 dbSNP
rs1482904277 848 dbSNP
rs771840289 852 dbSNP
rs895080836 855 dbSNP
rs1342657318 875 dbSNP
rs775008114 876 dbSNP
rs1057471090 877 dbSNP
rs1225793714 878 dbSNP
rs1322936596 884 dbSNP
rs1024845264 886 dbSNP
rs895898842 900 dbSNP
rs1397077547 906 dbSNP
rs1311640038 918 dbSNP
rs1379057392 918 dbSNP
rs746722092 919 dbSNP
rs375222421 923 dbSNP
rs994598131 934 dbSNP
rs1168134909 937 dbSNP
rs369791294 976 dbSNP
rs1460664254 996 dbSNP
rs1370228719 1005 dbSNP
rs886138352 1006 dbSNP
rs1423370802 1009 dbSNP
rs561730089 1013 dbSNP
rs1047080855 1032 dbSNP
rs527412619 1050 dbSNP
rs147959249 1054 dbSNP
rs1250814651 1058 dbSNP
rs1005476605 1066 dbSNP
rs963432647 1075 dbSNP
rs1489274532 1077 dbSNP
rs1265462380 1081 dbSNP
rs1397870271 1082 dbSNP
rs1018171015 1102 dbSNP
rs141088048 1103 dbSNP
rs1291968636 1107 dbSNP
rs1230791944 1109 dbSNP
rs974250945 1118 dbSNP
rs114552144 1123 dbSNP
rs1029851978 1131 dbSNP
rs1389843309 1137 dbSNP
rs1393121164 1139 dbSNP
rs1294380350 1142 dbSNP
rs1457464941 1154 dbSNP
rs954178095 1170 dbSNP
rs987092006 1178 dbSNP
rs1415845511 1182 dbSNP
rs1161207062 1188 dbSNP
rs956470807 1189 dbSNP
rs146935881 1192 dbSNP
rs966745257 1193 dbSNP
rs768406996 1194 dbSNP
rs1267608753 1196 dbSNP
rs747730155 1200 dbSNP
rs925408890 1201 dbSNP
rs1466708236 1209 dbSNP
rs1256243189 1210 dbSNP
rs936723424 1211 dbSNP
rs1269485167 1212 dbSNP
rs1055122050 1214 dbSNP
rs1346493264 1215 dbSNP
rs916453963 1237 dbSNP
rs1279538968 1241 dbSNP
rs150937990 1243 dbSNP
rs192470603 1246 dbSNP
rs917349100 1247 dbSNP
rs930095825 1253 dbSNP
rs1392291051 1257 dbSNP
rs1047139745 1258 dbSNP
rs888457490 1272 dbSNP
rs541682018 1282 dbSNP
rs1247308538 1291 dbSNP
rs1387786423 1293 dbSNP
rs1465329104 1296 dbSNP
rs549599611 1298 dbSNP
rs1264951954 1300 dbSNP
rs1432389253 1301 dbSNP
rs1039684859 1302 dbSNP
rs899732263 1306 dbSNP
rs1249292489 1307 dbSNP
rs886052054 1309 dbSNP
rs1175554220 1323 dbSNP
rs998457060 1325 dbSNP
rs886315643 1335 dbSNP
rs1347507202 1338 dbSNP
rs140767609 1342 dbSNP
rs1157081328 1343 dbSNP
rs1009272635 1352 dbSNP
rs535156455 1358 dbSNP
rs1300154790 1361 dbSNP
rs528827194 1363 dbSNP
rs967719422 1377 dbSNP
rs1291151531 1386 dbSNP
rs770453111 1392 dbSNP
rs575889691 1395 dbSNP
rs980402063 1401 dbSNP
rs540896571 1406 dbSNP
rs1171805750 1409 dbSNP
rs1432685606 1413 dbSNP
rs1391600092 1419 dbSNP
rs150124371 1428 dbSNP
rs1168910021 1432 dbSNP
rs1448333324 1436 dbSNP
rs1239874461 1441 dbSNP
rs1191578931 1442 dbSNP
rs1386625034 1472 dbSNP
rs558297227 1480 dbSNP
rs1301539520 1482 dbSNP
rs1313631164 1483 dbSNP
rs1210585732 1487 dbSNP
rs927559746 1511 dbSNP
rs1226016252 1518 dbSNP
rs1229431563 1529 dbSNP
rs764701383 1530 dbSNP
rs954228666 1538 dbSNP
rs1450070946 1542 dbSNP
rs1340969616 1543 dbSNP
rs1312243031 1547 dbSNP
rs773718032 1551 dbSNP
rs917426871 1557 dbSNP
rs1008367650 1569 dbSNP
rs1019867466 1575 dbSNP
rs184344245 1576 dbSNP
rs1210439763 1584 dbSNP
rs886052055 1584 dbSNP
rs528844666 1591 dbSNP
rs557383849 1594 dbSNP
rs1369520254 1613 dbSNP
rs751857673 1631 dbSNP
rs1484864072 1634 dbSNP
rs1254428626 1636 dbSNP
rs188778402 1650 dbSNP
rs780573901 1651 dbSNP
rs1206094648 1652 dbSNP
rs925305383 1657 dbSNP
rs750022206 1668 dbSNP
rs958061165 1669 dbSNP
rs899805003 1674 dbSNP
rs1180335422 1676 dbSNP
rs1292581939 1681 dbSNP
rs933944183 1690 dbSNP
rs759803504 1695 dbSNP
rs767698943 1709 dbSNP
rs990897102 1710 dbSNP
rs545769513 1712 dbSNP
rs1440954788 1717 dbSNP
rs886052056 1728 dbSNP
rs1352374943 1742 dbSNP
rs886052057 1747 dbSNP
rs916630278 1748 dbSNP
rs949224402 1749 dbSNP
rs1046189046 1763 dbSNP
rs1294537067 1765 dbSNP
rs1347806192 1769 dbSNP
rs1469983960 1770 dbSNP
rs1231394452 1776 dbSNP
rs1224133152 1780 dbSNP
rs907796042 1785 dbSNP
rs1272628815 1789 dbSNP
rs1211697747 1792 dbSNP
rs1331166203 1798 dbSNP
rs138586985 1800 dbSNP
rs1350505458 1801 dbSNP
rs1037604682 1802 dbSNP
rs903593207 1802 dbSNP
rs1033364589 1810 dbSNP
rs561954943 1810 dbSNP
rs886052058 1811 dbSNP
rs572164664 1823 dbSNP
rs995836540 1831 dbSNP
rs181246559 1832 dbSNP
rs1160559412 1834 dbSNP
rs890171892 1842 dbSNP
rs1008418315 1855 dbSNP
rs982931481 1861 dbSNP
rs1020172373 1866 dbSNP
rs1266934923 1876 dbSNP
rs966891930 1878 dbSNP
rs1000210822 1881 dbSNP
rs779822556 1884 dbSNP
rs1193065284 1897 dbSNP
rs778732746 1900 dbSNP
rs1478496827 1907 dbSNP
rs1032587062 1910 dbSNP
rs1481954943 1918 dbSNP
rs1203219156 1919 dbSNP
rs141752920 1923 dbSNP
rs909997803 1935 dbSNP
rs1191800187 1939 dbSNP
rs958038692 1945 dbSNP
rs990741594 1947 dbSNP
rs1466338075 1952 dbSNP
rs1023693131 1959 dbSNP
rs1215051469 1970 dbSNP
rs1210390334 1971 dbSNP
rs975881489 1977 dbSNP
rs1472958362 1983 dbSNP
rs867027657 1984 dbSNP
rs145519346 1985 dbSNP
rs1179067934 1987 dbSNP
rs1300857030 1989 dbSNP
rs549403730 1990 dbSNP
rs1423692863 1993 dbSNP
rs1365369367 1997 dbSNP
rs933949307 1999 dbSNP
rs1343761685 2004 dbSNP
rs907722563 2005 dbSNP
rs1367773077 2014 dbSNP
rs1172075773 2016 dbSNP
rs1051054586 2028 dbSNP
rs940531388 2054 dbSNP
rs892379026 2058 dbSNP
rs1185823263 2066 dbSNP
rs973763387 2077 dbSNP
rs1307011654 2078 dbSNP
rs1370854950 2084 dbSNP
rs1239192200 2086 dbSNP
rs1210522853 2091 dbSNP
rs1443699504 2101 dbSNP
rs1281967501 2102 dbSNP
rs1342165614 2105 dbSNP
rs75414200 2105 dbSNP
rs1043526052 2107 dbSNP
rs111804189 2107 dbSNP
rs1225179113 2107 dbSNP
rs1311228110 2107 dbSNP
rs1382107080 2107 dbSNP
rs1466782176 2107 dbSNP
rs74757288 2107 dbSNP
rs886052059 2107 dbSNP
rs886052060 2107 dbSNP
rs1377833665 2108 dbSNP
rs79868875 2109 dbSNP
rs1192616444 2117 dbSNP
rs1169802555 2119 dbSNP
rs1415868531 2122 dbSNP
rs1426859829 2122 dbSNP
rs1228751336 2123 dbSNP
rs1485190307 2123 dbSNP
rs920491019 2123 dbSNP
rs1317098253 2124 dbSNP
rs199826833 2125 dbSNP
rs1339792408 2126 dbSNP
rs1227482145 2128 dbSNP
rs1274154987 2131 dbSNP
rs1483534201 2134 dbSNP
rs931640789 2138 dbSNP
rs1250461176 2141 dbSNP
rs1001977718 2142 dbSNP
rs1323064285 2148 dbSNP
rs563954578 2151 dbSNP
rs1234452942 2156 dbSNP
rs138143910 2163 dbSNP
rs1235769101 2165 dbSNP
rs528162627 2169 dbSNP
rs1397443826 2177 dbSNP
rs1297892695 2189 dbSNP
rs1238471805 2201 dbSNP
rs1460521138 2213 dbSNP
rs1351703715 2214 dbSNP
rs1165480624 2224 dbSNP
rs1474856540 2231 dbSNP
rs57638820 2237 dbSNP
rs1184049307 2238 dbSNP
rs1419490871 2240 dbSNP
rs1041449807 2250 dbSNP
rs758261657 2252 dbSNP
rs999664667 2255 dbSNP
rs1033008834 2262 dbSNP
rs185590115 2272 dbSNP
rs894037354 2279 dbSNP
rs1012213474 2290 dbSNP
rs1390376751 2302 dbSNP
rs559634329 2306 dbSNP
rs983004969 2308 dbSNP
rs1017135210 2309 dbSNP
rs1292022857 2309 dbSNP
rs370824949 2309 dbSNP
rs1336788535 2310 dbSNP
rs571810597 2312 dbSNP
rs970682523 2314 dbSNP
rs746775343 2317 dbSNP
rs1369772366 2319 dbSNP
rs962834627 2320 dbSNP
rs975530317 2331 dbSNP
rs537539631 2332 dbSNP
rs9646285 2336 dbSNP
rs1362997787 2350 dbSNP
rs1434062369 2356 dbSNP
rs1454108626 2359 dbSNP
rs1363023891 2360 dbSNP
rs573938366 2363 dbSNP
rs1298001611 2366 dbSNP
rs796838903 2368 dbSNP
rs16948829 2370 dbSNP
rs1276787099 2373 dbSNP
rs555398609 2382 dbSNP
rs189512578 2383 dbSNP
rs1466803507 2388 dbSNP
rs1271818031 2392 dbSNP
rs973224156 2406 dbSNP
rs913849123 2410 dbSNP
rs540834237 2411 dbSNP
rs1237091070 2417 dbSNP
rs1350292892 2436 dbSNP
rs886052061 2439 dbSNP
rs780951726 2440 dbSNP
rs368296872 2452 dbSNP
rs1368943979 2457 dbSNP
rs1322394929 2458 dbSNP
rs577361954 2460 dbSNP
rs1383917893 2475 dbSNP
rs866750556 2479 dbSNP
rs1188505794 2480 dbSNP
rs1156571907 2481 dbSNP
rs1467430241 2482 dbSNP
rs1172691449 2489 dbSNP
rs925126516 2489 dbSNP
rs944386630 2496 dbSNP
rs1249355912 2503 dbSNP
rs1041866012 2515 dbSNP
rs1448106043 2517 dbSNP
rs1170436448 2518 dbSNP
rs937833973 2522 dbSNP
rs902892097 2524 dbSNP
rs1486894357 2526 dbSNP
rs1424116451 2532 dbSNP
rs371051271 2534 dbSNP
rs1233863126 2539 dbSNP
rs1414515426 2548 dbSNP
rs1272031424 2554 dbSNP
rs747682326 2557 dbSNP
rs896206694 2558 dbSNP
rs1013282936 2563 dbSNP
rs1385832868 2565 dbSNP
rs1053929228 2568 dbSNP
rs1375854408 2576 dbSNP
rs886084772 2578 dbSNP
rs1004473001 2579 dbSNP
rs893961224 2584 dbSNP
rs1167964127 2587 dbSNP
rs1474816692 2590 dbSNP
rs1373000483 2600 dbSNP
rs1012474594 2601 dbSNP
rs1486825091 2606 dbSNP
rs763407838 2606 dbSNP
rs997420012 2613 dbSNP
rs181056407 2616 dbSNP
rs796464725 2624 dbSNP
rs1275431263 2633 dbSNP
rs1196452840 2642 dbSNP
rs563329143 2647 dbSNP
rs1268289168 2652 dbSNP
rs1235070713 2655 dbSNP
rs1355813698 2656 dbSNP
rs986874729 2666 dbSNP
rs1224172695 2668 dbSNP
rs76888453 2677 dbSNP
rs533481735 2678 dbSNP
rs966642928 2681 dbSNP
rs1327200367 2682 dbSNP
rs773088526 2693 dbSNP
rs1393704480 2696 dbSNP
rs141928186 2711 dbSNP
rs1476491137 2712 dbSNP
rs995094146 2716 dbSNP
rs542579675 2717 dbSNP
rs1449094770 2721 dbSNP
rs937884075 2726 dbSNP
rs953174391 2738 dbSNP
rs1182818310 2747 dbSNP
rs1437251159 2752 dbSNP
rs559806079 2754 dbSNP
rs1197253039 2759 dbSNP
rs987879934 2772 dbSNP
rs1215436713 2778 dbSNP
rs986086042 2779 dbSNP
rs911776848 2780 dbSNP
rs917731759 2781 dbSNP
rs1231220080 2782 dbSNP
rs1279708262 2788 dbSNP
rs773771930 2788 dbSNP
rs1441030591 2790 dbSNP
rs528785995 2797 dbSNP
rs966102023 2798 dbSNP
rs977091467 2805 dbSNP
rs772595190 2814 dbSNP
rs935790962 2815 dbSNP
rs1387130884 2818 dbSNP
rs1054112576 2832 dbSNP
rs915447961 2833 dbSNP
rs1410627877 2837 dbSNP
rs1177961523 2851 dbSNP
rs898722390 2855 dbSNP
rs1028921720 2857 dbSNP
rs778856255 2857 dbSNP
rs1469014149 2865 dbSNP
rs552050344 2878 dbSNP
rs1045299991 2880 dbSNP
rs1322703659 2885 dbSNP
rs906756435 2888 dbSNP
rs566637778 2889 dbSNP
rs955543880 2892 dbSNP
rs571847444 2914 dbSNP
rs1222800990 2931 dbSNP
rs1003973662 2933 dbSNP
rs1405732556 2951 dbSNP
rs531064740 2952 dbSNP
rs1305229633 2954 dbSNP
rs897807414 2964 dbSNP
rs886052062 2976 dbSNP
rs1020986920 2988 dbSNP
rs886052063 3001 dbSNP
rs1347273605 3002 dbSNP
rs1027738616 3012 dbSNP
rs1348698764 3025 dbSNP
rs1400536626 3033 dbSNP
rs966721102 3042 dbSNP
rs953228116 3044 dbSNP
rs1007359921 3054 dbSNP
rs144667145 3071 dbSNP
rs959566882 3079 dbSNP
rs1191626218 3080 dbSNP
rs185943382 3084 dbSNP
rs965960531 3092 dbSNP
rs990730496 3097 dbSNP
rs1445126046 3099 dbSNP
rs1281950674 3106 dbSNP
rs977729098 3109 dbSNP
rs1234576520 3110 dbSNP
rs1346468997 3111 dbSNP
rs149875014 3112 dbSNP
rs886052064 3112 dbSNP
rs917747479 3112 dbSNP
rs1364664802 3126 dbSNP
rs1353538994 3132 dbSNP
rs374305356 3136 dbSNP
rs555603514 3149 dbSNP
rs774821906 3151 dbSNP
rs759858517 3152 dbSNP
rs767751883 3157 dbSNP
rs1435602035 3174 dbSNP
rs1394504530 3178 dbSNP
rs941698822 3181 dbSNP
rs1224183643 3183 dbSNP
rs1430418520 3195 dbSNP
rs1249238772 3199 dbSNP
rs553290181 3222 dbSNP
rs1471975070 3224 dbSNP
rs752862278 3230 dbSNP
rs1045188196 3235 dbSNP
rs34088926 3240 dbSNP
rs1211098774 3248 dbSNP
rs375925980 3253 dbSNP
rs1365442926 3254 dbSNP
rs1277801575 3256 dbSNP
rs939650304 3262 dbSNP
rs1307628577 3264 dbSNP
rs1162617287 3273 dbSNP
rs1214497692 3284 dbSNP
rs1338843575 3295 dbSNP
rs891295905 3297 dbSNP
rs1391093229 3300 dbSNP
rs886052065 3306 dbSNP
rs1008348883 3307 dbSNP
rs192317768 3310 dbSNP
rs1021019394 3323 dbSNP
rs1305186431 3331 dbSNP
rs1368995198 3335 dbSNP
rs534599316 3358 dbSNP
rs1169607219 3364 dbSNP
rs1464020140 3380 dbSNP
rs886052066 3385 dbSNP
rs1329572381 3388 dbSNP
rs1474797778 3392 dbSNP
rs1253631828 3401 dbSNP
rs1049175860 3407 dbSNP
rs1243169394 3421 dbSNP
rs183255879 3424 dbSNP
rs1284141775 3433 dbSNP
rs557557039 3442 dbSNP
rs1000877802 3446 dbSNP
rs577399038 3448 dbSNP
rs186163821 3456 dbSNP
rs1275641460 3457 dbSNP
rs764297855 3462 dbSNP
rs111951225 3470 dbSNP
rs1482552215 3472 dbSNP
rs1355287211 3505 dbSNP
rs1310764074 3511 dbSNP
rs1393390130 3517 dbSNP
rs1374089558 3521 dbSNP
rs1297660025 3523 dbSNP
rs1464172605 3526 dbSNP
rs901653078 3536 dbSNP
rs1251993909 3551 dbSNP
rs970585759 3553 dbSNP
rs1186676573 3555 dbSNP
rs1460671706 3556 dbSNP
rs998820788 3563 dbSNP
rs190533095 3564 dbSNP
rs913659921 3568 dbSNP
rs983262278 3573 dbSNP
rs1249440641 3584 dbSNP
rs907652381 3586 dbSNP
rs368698335 3594 dbSNP
rs372708124 3598 dbSNP
rs559299003 3600 dbSNP
rs1389348748 3602 dbSNP
rs989736778 3603 dbSNP
rs1429304417 3613 dbSNP
rs372370285 3615 dbSNP
rs969753351 3618 dbSNP
rs1398658084 3627 dbSNP
rs1394426416 3635 dbSNP
rs981146112 3640 dbSNP
rs928178213 3644 dbSNP
rs545703479 3649 dbSNP
rs1454896122 3650 dbSNP
rs972377299 3651 dbSNP
rs919470704 3677 dbSNP
rs141888517 3680 dbSNP
rs374723746 3681 dbSNP
rs766099276 3682 dbSNP
rs1440117030 3684 dbSNP
rs1252712586 3687 dbSNP
rs944240017 3687 dbSNP
rs1049061266 3689 dbSNP
rs1342241971 3690 dbSNP
rs889106888 3692 dbSNP
rs1199430580 3696 dbSNP
rs182950511 3697 dbSNP
rs943457150 3700 dbSNP
rs1156519582 3703 dbSNP
rs1455149375 3711 dbSNP
rs1395192462 3714 dbSNP
rs1040854050 3715 dbSNP
rs901708450 3717 dbSNP
rs1451518367 3722 dbSNP
rs886052067 3723 dbSNP
rs551109634 3732 dbSNP
rs1031589487 3733 dbSNP
rs567662515 3737 dbSNP
rs16948836 3740 dbSNP
rs1350087989 3754 dbSNP
rs188392607 3757 dbSNP
rs1012244712 3768 dbSNP
rs969679749 3774 dbSNP
rs546722267 3775 dbSNP
rs1025333175 3782 dbSNP
rs1194154033 3783 dbSNP
rs566503832 3786 dbSNP
rs549222528 3787 dbSNP
rs1464580963 3794 dbSNP
rs1014783669 3798 dbSNP
rs1175854787 3808 dbSNP
rs1406952228 3815 dbSNP
rs972617166 3816 dbSNP
rs1476795921 3825 dbSNP
rs919529099 3832 dbSNP
rs1376417870 3835 dbSNP
rs868795638 3839 dbSNP
rs1195976649 3849 dbSNP
rs930910588 3852 dbSNP
rs1262955396 3854 dbSNP
rs1214659103 3856 dbSNP
rs1332018690 3859 dbSNP
rs985022999 3861 dbSNP
rs921694857 3864 dbSNP
rs1281354923 3866 dbSNP
rs770206028 3867 dbSNP
rs910593386 3870 dbSNP
rs192669779 3874 dbSNP
rs943341066 3879 dbSNP
rs751430336 3883 dbSNP
rs1297239871 3884 dbSNP
rs571179733 3885 dbSNP
rs1329046980 3894 dbSNP
rs923309016 3899 dbSNP
rs536855142 3912 dbSNP
rs1228069201 3916 dbSNP
rs1339544569 3918 dbSNP
rs567605672 3921 dbSNP
rs1053335551 3924 dbSNP
rs944312669 3933 dbSNP
rs367816704 3947 dbSNP
rs371569379 3956 dbSNP
rs1412212841 3958 dbSNP
rs1398020419 3960 dbSNP
rs573701908 3964 dbSNP
rs754769791 3966 dbSNP
rs536324513 3977 dbSNP
rs1054321751 3978 dbSNP
rs1011473935 3981 dbSNP
rs1191913029 3983 dbSNP
rs1476429026 4008 dbSNP
rs1258470318 4009 dbSNP
rs1187123251 4018 dbSNP
rs1044287950 4040 dbSNP
rs775965696 4051 dbSNP
rs1196509566 4062 dbSNP
rs905571070 4070 dbSNP
rs1212463424 4074 dbSNP
rs183024011 4081 dbSNP
rs1256154867 4091 dbSNP
rs1234893740 4103 dbSNP
rs1002919398 4105 dbSNP
rs1267493779 4108 dbSNP
rs1012688602 4118 dbSNP
rs1445404247 4132 dbSNP
rs1336962676 4133 dbSNP
rs1328917528 4139 dbSNP
rs1046404918 4141 dbSNP
rs1169234484 4145 dbSNP
rs1486070672 4145 dbSNP
rs1188089976 4150 dbSNP
rs376037772 4155 dbSNP
rs557502143 4170 dbSNP
rs1264094749 4177 dbSNP
rs572895229 4188 dbSNP
rs1162849459 4190 dbSNP
rs1471920684 4195 dbSNP
rs1234855355 4198 dbSNP
rs1431606945 4199 dbSNP
rs1199007872 4204 dbSNP
rs1035448996 4206 dbSNP
rs961387739 4211 dbSNP
rs544994887 4224 dbSNP
rs1215495169 4231 dbSNP
rs1481465285 4232 dbSNP
rs993917959 4234 dbSNP
rs1335196270 4240 dbSNP
rs1288911132 4253 dbSNP
rs1026922135 4259 dbSNP
rs1157567293 4260 dbSNP
rs1279838411 4268 dbSNP
rs1258152150 4276 dbSNP
rs565582907 4277 dbSNP
rs1219802882 4280 dbSNP
rs1243305613 4281 dbSNP
rs187441896 4282 dbSNP
rs1443795126 4284 dbSNP
rs1485922425 4304 dbSNP
rs1323273914 4309 dbSNP
rs1185481457 4311 dbSNP
rs952188134 4319 dbSNP
rs1410424959 4322 dbSNP
rs544518764 4323 dbSNP
rs1004804778 4324 dbSNP
rs1014814877 4331 dbSNP
rs1378583818 4335 dbSNP
rs1195375690 4338 dbSNP
rs963241511 4341 dbSNP
rs994662570 4346 dbSNP
rs1219099020 4355 dbSNP
rs1448574987 4367 dbSNP
rs1165851861 4376 dbSNP
rs1215447667 4379 dbSNP
rs1226111307 4383 dbSNP
rs1287617330 4387 dbSNP
rs781004605 4389 dbSNP
rs1217889365 4390 dbSNP
rs1274837816 4392 dbSNP
rs561527592 4393 dbSNP
rs1263413538 4397 dbSNP
rs1434695793 4401 dbSNP
rs953170725 4403 dbSNP
rs747878517 4415 dbSNP
rs1221945964 4419 dbSNP
rs1269936407 4424 dbSNP
rs1175559536 4425 dbSNP
rs1424355399 4426 dbSNP
rs1490859057 4441 dbSNP
rs1189411941 4446 dbSNP
rs1476231818 4452 dbSNP
rs1242518665 4456 dbSNP
rs1180171527 4463 dbSNP
rs755710819 4471 dbSNP
rs987603704 4479 dbSNP
rs1420166511 4483 dbSNP
rs886052068 4486 dbSNP
rs964708302 4493 dbSNP
rs575852312 4494 dbSNP
rs546313281 4495 dbSNP
rs934771364 4501 dbSNP
rs924195596 4505 dbSNP
rs1279214547 4507 dbSNP
rs530162344 4511 dbSNP
rs1399819655 4513 dbSNP
rs1303376683 4515 dbSNP
rs1315074119 4527 dbSNP
rs748716852 4531 dbSNP
rs1407428873 4546 dbSNP
rs1173817935 4550 dbSNP
rs1411611494 4551 dbSNP
rs1424308229 4553 dbSNP
rs1297058634 4554 dbSNP
rs1053942530 4561 dbSNP
rs17314948 4562 dbSNP
rs1182093458 4566 dbSNP
rs113748745 4568 dbSNP
rs373507820 4577 dbSNP
rs1206074169 4580 dbSNP
rs905749862 4582 dbSNP
rs940665123 4596 dbSNP
rs1002555016 4597 dbSNP
rs1036319100 4600 dbSNP
rs1057229052 4602 dbSNP
rs34262697 4616 dbSNP
rs896798094 4620 dbSNP
rs899069801 4627 dbSNP
rs1424795638 4629 dbSNP
rs994359406 4630 dbSNP
rs1292734164 4633 dbSNP
rs995135020 4648 dbSNP
rs1490888623 4657 dbSNP
rs1463807001 4664 dbSNP
rs1203324312 4666 dbSNP
rs1419802658 4679 dbSNP
rs1232312312 4681 dbSNP
rs1026727779 4683 dbSNP
rs774794760 4684 dbSNP
rs1416410109 4691 dbSNP
rs886052069 4692 dbSNP
rs1178431432 4694 dbSNP
rs1179449993 4695 dbSNP
rs888909431 4697 dbSNP
rs1239262387 4698 dbSNP
rs886052070 4703 dbSNP
rs1008657448 4704 dbSNP
rs1275467341 4709 dbSNP
rs192535029 4710 dbSNP
rs967059082 4715 dbSNP
rs977041563 4719 dbSNP
rs1031240117 4725 dbSNP
rs1225480277 4726 dbSNP
rs868762379 4748 dbSNP
rs1006353581 4758 dbSNP
rs552106131 4762 dbSNP
rs746247128 4763 dbSNP
rs958326246 4776 dbSNP
rs1164672228 4784 dbSNP
rs990113516 4786 dbSNP
rs1017887673 4795 dbSNP
rs1427376323 4805 dbSNP
rs1366342244 4819 dbSNP
rs1160862028 4820 dbSNP
rs1439707097 4823 dbSNP
rs1379191885 4834 dbSNP
rs150641352 4841 dbSNP
rs886052071 4842 dbSNP
rs976350002 4850 dbSNP
rs1210795928 4858 dbSNP
rs923289494 4863 dbSNP
rs537349306 4865 dbSNP
rs1219108718 4870 dbSNP
rs1381991800 4878 dbSNP
rs184571054 4886 dbSNP
rs143814807 4888 dbSNP
rs914626785 4906 dbSNP
rs1373085448 4926 dbSNP
rs947226525 4931 dbSNP
rs899141924 4938 dbSNP
rs1388318971 4940 dbSNP
rs567438576 4948 dbSNP
rs1212972759 4954 dbSNP
rs755736137 4961 dbSNP
rs927114822 4965 dbSNP
rs938620113 4968 dbSNP
rs1156273835 4980 dbSNP
rs1455246409 4981 dbSNP
rs1379821304 4992 dbSNP
rs1200207050 5002 dbSNP
rs536028311 5008 dbSNP
rs547681240 5009 dbSNP
rs896844810 5012 dbSNP
rs1050737738 5020 dbSNP
rs1196354363 5022 dbSNP
rs1488720359 5029 dbSNP
rs1285655754 5031 dbSNP
rs1214518710 5038 dbSNP
rs1254749180 5040 dbSNP
rs929624228 5042 dbSNP
rs187446083 5050 dbSNP
rs553128470 5055 dbSNP
rs1245280417 5059 dbSNP
rs888172609 5061 dbSNP
rs1232486137 5068 dbSNP
rs1329091340 5081 dbSNP
rs572929759 5087 dbSNP
rs1009145978 5094 dbSNP
rs1411120044 5095 dbSNP
rs1344277620 5100 dbSNP
rs540583866 5101 dbSNP
rs1018675689 5109 dbSNP
rs1435967926 5111 dbSNP
rs1402334381 5112 dbSNP
rs1173620050 5115 dbSNP
rs1465958698 5116 dbSNP
rs1376470920 5123 dbSNP
rs1173262118 5136 dbSNP
rs1017815917 5137 dbSNP
rs1478384062 5141 dbSNP
rs902925893 5149 dbSNP
rs796645311 5163 dbSNP
rs900651950 5166 dbSNP
rs1256981411 5172 dbSNP
rs779734487 5177 dbSNP
rs1342750089 5179 dbSNP
rs1030574313 5185 dbSNP
rs1219000468 5187 dbSNP
rs1317073706 5194 dbSNP
rs1032655867 5219 dbSNP
rs1338641686 5227 dbSNP
rs192242759 5238 dbSNP
rs562376985 5247 dbSNP
rs989755394 5249 dbSNP
rs988735503 5256 dbSNP
rs1173468561 5257 dbSNP
rs1466410981 5269 dbSNP
rs1423398579 5271 dbSNP
rs140875917 5273 dbSNP
rs753515238 5276 dbSNP
rs1171389126 5277 dbSNP
rs1369314580 5289 dbSNP
rs982258151 5290 dbSNP
rs1440826865 5291 dbSNP
rs1239859545 5302 dbSNP
rs928088853 5304 dbSNP
rs940773220 5309 dbSNP
rs1216574329 5310 dbSNP
rs1229858706 5313 dbSNP
rs980135927 5315 dbSNP
rs575893839 5316 dbSNP
rs1378481606 5336 dbSNP
rs544864659 5337 dbSNP
rs920613518 5339 dbSNP
rs1204801767 5343 dbSNP
rs1327234846 5353 dbSNP
rs561354135 5354 dbSNP
rs930630359 5367 dbSNP
rs938518417 5368 dbSNP
rs1391707599 5369 dbSNP
rs1265604609 5381 dbSNP
rs886052072 5385 dbSNP
rs754758384 5386 dbSNP
rs778573524 5387 dbSNP
rs1179388713 5394 dbSNP
rs1438972058 5415 dbSNP
rs1463817385 5418 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.759 5.2e-5 0.871 2.9e-7 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.656 3.4e-4 0.605 1.1e-3 23 Click to see details
GSE14794 Lymphoblastoid cells -0.249 9.0e-3 -0.297 2.2e-3 90 Click to see details
GSE27834 Pluripotent stem cells -0.559 1.2e-2 -0.562 1.2e-2 16 Click to see details
GSE21032 Prostate cancer 0.185 4.7e-2 0.146 9.4e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.332 5.2e-2 0.462 1.0e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.193 6.3e-2 0.207 5.0e-2 64 Click to see details
GSE19783 ER+ ER+ breast cancer -0.339 7.2e-2 -0.120 3.1e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.372 1.1e-1 -0.176 2.8e-1 13 Click to see details
GSE38226 Liver fibrosis -0.277 1.1e-1 -0.163 2.4e-1 21 Click to see details
GSE17498 Multiple myeloma -0.181 1.3e-1 -0.116 2.4e-1 40 Click to see details
GSE32688 Pancreatic cancer 0.174 1.7e-1 0.053 3.9e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.166 2.1e-1 -0.124 2.8e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.162 2.2e-1 0.101 3.2e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.211 2.6e-1 0.259 2.1e-1 12 Click to see details
GSE19536 Breast cancer -0.053 3.0e-1 -0.046 3.2e-1 100 Click to see details
GSE17306 Multiple myeloma -0.06 3.4e-1 -0.086 2.8e-1 49 Click to see details
GSE28544 Breast cancer -0.077 3.6e-1 -0.260 1.1e-1 24 Click to see details
GSE21849 B cell lymphoma 0.048 4.0e-1 0.057 3.8e-1 29 Click to see details
GSE19783 ER- ER- breast cancer 0.017 4.4e-1 -0.029 4.0e-1 79 Click to see details
GSE19783 ER- ER- breast cancer 0.017 4.4e-1 -0.029 4.0e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.298 0.01 0.275 0.01 68 Click to see details
PRAD -0.264 0.03 -0.147 0.15 50 Click to see details
PAAD 0.915 0.04 0.800 0.1 4 Click to see details
PCPG -0.973 0.07 -1.000 0.5 3 Click to see details
CHOL -0.51 0.08 -0.600 0.04 9 Click to see details
KICH 0.223 0.14 0.198 0.17 25 Click to see details
THCA -0.108 0.21 -0.120 0.18 59 Click to see details
LUAD 0.244 0.22 0.301 0.17 12 Click to see details
HNSC -0.115 0.23 -0.142 0.18 42 Click to see details
BLCA -0.167 0.25 -0.191 0.22 18 Click to see details
BRCA -0.073 0.25 -0.042 0.35 84 Click to see details
STAD -0.091 0.31 -0.064 0.36 32 Click to see details
KIRP -0.074 0.34 -0.194 0.14 32 Click to see details
LUSC -0.044 0.4 0.004 0.49 38 Click to see details
COAD -0.106 0.4 -0.286 0.25 8 Click to see details
ESCA -0.06 0.43 0.064 0.43 11 Click to see details
LIHC 0.025 0.43 0.040 0.39 49 Click to see details
UCEC 0.036 0.44 -0.030 0.45 19 Click to see details
CESC -0.163 0.45 -0.500 0.33 3 Click to see details
CESC -0.163 0.45 -0.500 0.33 3 Click to see details
CESC -0.163 0.45 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1