miRTarBase - #MIRT727876 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DICER1   
Synonyms DCR1, Dicer, Dicer1e, HERNA, K12H4.8-LIKE, MNG1, RMSE2
Description dicer 1, ribonuclease III
Transcript NM_030621   
Other Transcripts NM_177438   
Expression
Putative miRNA Targets on DICER1
3'UTR of DICER1
(miRNA target sites are highlighted)
>DICER1|NM_030621|3'UTR
   1 AACCGCTTTTTAAAATTCAAAACAAGAAACAAAACAAAAAAAATTAAGGGGAAAATTATTTAAATCGGAAAGGAAGACTT
  81 AAAGTTGTTAGTGAGTGGAATGAATTGAAGGCAGAATTTAAAGTTTGGTTGATAACAGGATAGATAACAGAATAAAACAT
 161 TTAACATATGTATAAAATTTTGGAACTAATTGTAGTTTTAGTTTTTTGCGCAAACACAATCTTATCTTCTTTCCTCACTT
 241 CTGCTTTGTTTAAATCACAAGAGTGCTTTAATGATGACATTTAGCAAGTGCTCAAAATAATTGACAGGTTTTGTTTTTTT
 321 TTTTTTGAGTTTATGTCAGCTTTGCTTAGTGTTAGAAGGCCATGGAGCTTAAACCTCCAGCAGTCCCTAGGATGATGTAG
 401 ATTCTTCTCCATCTCTCCGTGTGTGCAGTAGTGCCAGTCCTGCAGTAGTTGATAAGCTGAATAGAAAGATAAGGTTTTCG
 481 AGAGGAGAAGTGCGCCAATGTTGTCTTTTCTTTCCACGTTATACTGTGTAAGGTGATGTTCCCGGTCGCTGTTGCACCTG
 561 ATAGTAAGGGACAGATTTTTAATGAACATTGGCTGGCATGTTGGTGAATCACATTTTAGTTTTCTGATGCCACATAGTCT
 641 TGCATAAAAAAGGGTTCTTGCCTTAAAAGTGAAACCTTCATGGATAGTCTTTAATCTCTGATCTTTTTGGAACAAACTGT
 721 TTTACATTCCTTTCATTTTATTATGCATTAGACGTTGAGACAGCGTGATACTTACAACTCACTAGTATAGTTGTAACTTA
 801 TTACAGGATCATACTAAAATTTCTGTCATATGTATACTGAAGACATTTTAAAAACCAGAATATGTAGTCTACGGATATTT
 881 TTTATCATAAAAATGATCTTTGGCTAAACACCCCATTTTACTAAAGTCCTCCTGCCAGGTAGTTCCCACTGATGGAAATG
 961 TTTATGGCAAATAATTTTGCCTTCTAGGCTGTTGCTCTAACAAAATAAACCTTAGACATATCACACCTAAAATATGCTGC
1041 AGATTTTATAATTGATTGGTTACTTATTTAAGAAGCAAAACACAGCACCTTTACCCTTAGTCTCCTCACATAAATTTCTT
1121 ACTATACTTTTCATAATGTTGCATGCATATTTCACCTACCAAAGCTGTGCTGTTAATGCCGTGAAAGTTTAACGTTTGCG
1201 ATAAACTGCCGTAATTTTGATACATCTGTGATTTAGGTCATTAATTTAGATAAACTAGCTCATTATTTCCATCTTTGGAA
1281 AAGGAAAAAAAAAAAAACTTCTTTAGGCATTTGCCTAAGTTTCTTTAATTAGACTTGTAGGCACTCTTCACTTAAATACC
1361 TCAGTTCTTCTTTTCTTTTGCATGCATTTTTCCCCTGTTTGGTGCTATGTTTATGTATTATGCTTGAAATTTTAATTTTT
1441 TTTTTTTTGCACTGTAACTATAATACCTCTTAATTTACCTTTTTAAAAGCTGTGGGTCAGTCTTGCACTCCCATCAACAT
1521 ACCAGTAGAGGTTTGCTGCAATTTGCCCCGTTAATTATGCTTGAAGTTTAAGAAAGCTGAGCAGAGGTGTCTCATATTTC
1601 CCAGCACATGATTCTGAACTTGATGCTTCGTGGAATGCTGCATTTATATGTAAGTGACATTTGAATACTGTCCTTCCTGC
1681 TTTATCTGCATCATCCACCCACAGAGAAATGCCTCTGTGCGAGTGCACCGACAGAAAACTGTCAGCTCTGCTTTCTAAGG
1761 AACCCTGAGTGAGGGGGGTATTAAGCTTCTCCAGTGTTTTTTGTTGTCTCCAATCTTAAACTTAAATTGAGATCTAAATT
1841 ATTAAACGAGTTTTTGAGCAAATTAGGTGACTTGTTTTAAAAATATTTAATTCCGATTTGGAACCTTAGATGTCTATTTG
1921 ATTTTTTAAAAAACCTTAATGTAAGATATGACCAGTTAAAACAAAGCAATTCTTGAATTATATAACTGTAAAAGTGTGCA
2001 GTTAACAAGGCTGGATGTGAATTTTATTCTGAGGGTGATTTGTGATCAAGTTTAATCACAAATCTCTTAATATTTATAAA
2081 CTACCTGATGCCAGGAGCTTAGGGCTTTGCATTGTGTCTAATACATTGATCCCAGTGTTACGGGATTCTCTTGATTCCTG
2161 GCACCAAAATCAGATTGTTTTCACAGTTATGATTCCCAGTGGGAGAAAAATGCCTCAATATATTTGTAACCTTAAGAAGA
2241 GTATTTTTTTGTTAATACTAAGATGTTCAAACTTAGACATGATTAGGTCATACATTCTCAGGGGTTCAAATTTCCTTCTA
2321 CCATTCAAATGTTTTATCAACAGCAAACTTCAGCCGTTTCACTTTTTGTTGGAGAAAAATAGTAGATTTTAATTTGACTC
2401 ACAGTTTGAAGCATTCTGTGATCCCCTGGTTACTGAGTTAAAAAATAAAAAAGTACGAGTTAGACATATGAAATGGTTAT
2481 GAACGCTTTTGTGCTGCTGATTTTTAATGCTGTAAAGTTTTCCTGTGTTTAGCTTGTTGAAATGTTTTGCATCTGTCAAT
2561 TAAGGAAAAAAAAAATCACTCTATGTTGCCCCACTTTAGAGCCCTGTGTGCCACCCTGTGTTCCTGTGATTGCAATGTGA
2641 GACCGAATGTAATATGGAAAACCTACCAGTGGGGTGTGGTTGTGCCCTGAGCACGTGTGTAAAGGACTGGGGAGGCGTGT
2721 CTTGAAAAAGCAACTGCAGAAATTCCTTATGATGATTGTGTGCAAGTTAGTTAACATGAACCTTCATTTGTAAATTTTTT
2801 AAAATTTCTTTTATAATATGCTTTCCGCAGTCCTAACTATGCTGCGTTTTATAATAGCTTTTTCCCTTCTGTTCTGTTCA
2881 TGTAGCACAGATAAGCATTGCACTTGGTACCATGCTTTACCTCATTTCAAGAAAATATGCTTAACAGAGAGGAAAAAAAT
2961 GTGGTTTGGCCTTGCTGCTGTTTTGATTTATGGAATTTGAAAAAGATAATTATAATGCCTGCAATGTGTCATATACTCGC
3041 ACAACTTAAATAGGTCATTTTTGTCTGTGGCATTTTTACTGTTTGTGAAAGTATGAAACAGATTTGTTAACTGAACTCTT
3121 AATTATGTTTTTAAAATGTTTGTTATATTTCTTTTCTTTTTTCTTTTATATTACGTGAAGTGATGAAATTTAGAATGACC
3201 TCTAACACTCCTGTAATTGTCTTTTAAAATACTGATATTTTTATTTGTTAATAATACTTTGCCCTCAGAAAGATTCTGAT
3281 ACCCTGCCTTGACAACATGAAACTTGAGGCTGCTTTGGTTCATGAATCCAGGTGTTCCCCCGGCAGTCGGCTTCTTCAGT
3361 CGCTCCCTGGAGGCAGGTGGGCACTGCAGAGGATCACTGGAATCCAGATCGAGCGCAGTTCATGCACAAGGCCCCGTTGA
3441 TTTAAAATATTGGATCTTGCTCTGTTAGGGTGTCTAATCCCTTTACACAAGATTGAAGCCACCAAACTGAGACCTTGATA
3521 CCTTTTTTTAACTGCATCTGAAATTATGTTAAGAGTCTTTAACCCATTTGCATTATCTGCAGAAGAGAAACTCATGTCAT
3601 GTTTATTACCTATATGGTTGTTTTAATTACATTTGAATAATTATATTTTTCCAACCACTGATTACTTTTCAGGAATTTAA
3681 TTATTTCCAGATAAATTTCTTTATTTTATATTGTACATGAAAAGTTTTAAAGATATGTTTAAGACCAAGACTATTAAAAT
3761 GATTTTTAAAGTTGTTGGAGACGCCAATAGCAATATCTAGGAAATTTGCATTGAGACCATTGTATTTTCCACTAGCAGTG
3841 AAAATGATTTTTCACAACTAACTTGTAAATATATTTTAATCATTACTTCTTTTTTTCTAGTCCATTTTTATTTGGACATC
3921 AACCACAGACAATTTAAATTTTATAGATGCACTAAGAATTCACTGCAGCAGCAGGTTACATAGCAAAAATGCAAAGGTGA
4001 ACAGGAAGTAAATTTCTGGCTTTTCTGCTGTAAATAGTGAAGGAAAATTACTAAAATCAAGTAAAACTAATGCATATTAT
4081 TTGATTGACAATAAAATATTTACCATCACATGCTGCAGCTGTTTTTTAAGGAACATGATGTCATTCATTCATACAGTAAT
4161 CATGCTGCAGAAATTTGCAGTCTGCACCTTATGGATCACAATTACCTTTAGTTGTTTTTTTTGTAATAATTGTAGCCAAG
4241 TAAATCTCCAATAAAGTTATCGTCTGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ::|||  || ||||||||| 
Target 5' taTGAACGCTTTTGTGCTGCTg 3'
2478 - 2499 168.00 -15.80
2
miRNA  3' gugUUUGGUA--AUAC----ACGACGAu 5'
             ||| ::|  | ||    ||||||| 
Target 5' aaaAAAATGTGGTTTGGCCTTGCTGCTg 3'
2953 - 2980 147.00 -10.60
3
miRNA  3' guGUUUGGUAAU----ACACGACGau 5'
            || |||| ||    | ||||||  
Target 5' aaCATACCAGTAGAGGTTTGCTGCaa 3'
1516 - 1541 142.00 -12.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
479616 4 ClinVar
315099 5 ClinVar
388878 20 ClinVar
803045 30 ClinVar
803044 35 ClinVar
885022 57 ClinVar
315098 88 ClinVar
315097 166 ClinVar
885021 175 ClinVar
885020 305 ClinVar
885019 314 ClinVar
315096 327 ClinVar
885018 335 ClinVar
888141 368 ClinVar
888140 381 ClinVar
315095 433 ClinVar
315094 465 ClinVar
888139 497 ClinVar
315093 517 ClinVar
315092 525 ClinVar
315091 754 ClinVar
886862 782 ClinVar
886861 800 ClinVar
315090 806 ClinVar
315089 873 ClinVar
315088 891 ClinVar
886860 901 ClinVar
886859 915 ClinVar
315087 943 ClinVar
315086 981 ClinVar
315085 997 ClinVar
315084 1032 ClinVar
885868 1040 ClinVar
885867 1045 ClinVar
315083 1048 ClinVar
315082 1199 ClinVar
885866 1305 ClinVar
315081 1397 ClinVar
315080 1435 ClinVar
315078 1449 ClinVar
315079 1449 ClinVar
315077 1450 ClinVar
884956 1506 ClinVar
884955 1550 ClinVar
884954 1571 ClinVar
315076 1575 ClinVar
315075 1630 ClinVar
315074 1720 ClinVar
884953 1823 ClinVar
315073 1825 ClinVar
888088 1834 ClinVar
315072 1847 ClinVar
315071 1894 ClinVar
315070 2050 ClinVar
888087 2131 ClinVar
315069 2169 ClinVar
888086 2184 ClinVar
315068 2309 ClinVar
315067 2361 ClinVar
315065 2380 ClinVar
315066 2380 ClinVar
315064 2410 ClinVar
886807 2493 ClinVar
315063 2693 ClinVar
315062 2757 ClinVar
315061 2811 ClinVar
315060 2826 ClinVar
886806 2880 ClinVar
315059 2965 ClinVar
315058 3024 ClinVar
315057 3039 ClinVar
315056 3175 ClinVar
315055 3185 ClinVar
315054 3234 ClinVar
885800 3282 ClinVar
315053 3312 ClinVar
315052 3341 ClinVar
315051 3366 ClinVar
884875 3414 ClinVar
315050 3473 ClinVar
884874 3578 ClinVar
884873 3579 ClinVar
315049 3736 ClinVar
315048 3816 ClinVar
315047 3886 ClinVar
315046 3966 ClinVar
315045 4005 ClinVar
888008 4036 ClinVar
315044 4039 ClinVar
888007 4128 ClinVar
888006 4241 ClinVar
315043 4260 ClinVar
COSN31597566 4 COSMIC
COSN19372515 5 COSMIC
COSN30144525 17 COSMIC
COSN30144527 18 COSMIC
COSN26973395 35 COSMIC
COSN30493553 40 COSMIC
COSN30188170 48 COSMIC
COSN30470935 66 COSMIC
COSN30159647 75 COSMIC
COSN17634982 205 COSMIC
COSN7034472 210 COSMIC
COSN30169352 260 COSMIC
COSN26646148 313 COSMIC
COSN20111642 314 COSMIC
COSN31486408 314 COSMIC
COSN17770008 316 COSMIC
COSN31568600 479 COSMIC
COSN1667039 494 COSMIC
COSN8589141 494 COSMIC
COSN26576145 713 COSMIC
COSN31553681 765 COSMIC
COSN30164575 767 COSMIC
COSN31961029 794 COSMIC
COSN1667038 922 COSMIC
COSN14815642 1285 COSMIC
COSN23742095 1285 COSMIC
COSN20111639 1435 COSMIC
COSN19656369 1449 COSMIC
COSN31589748 1689 COSMIC
COSN26677203 1700 COSMIC
COSN20111638 1716 COSMIC
COSN26549434 2105 COSMIC
COSN31520294 2270 COSMIC
COSN20092879 2320 COSMIC
COSN31552377 2356 COSMIC
COSN30543461 2458 COSMIC
COSN20611756 2606 COSMIC
COSN30172503 3101 COSMIC
COSN26666286 3163 COSMIC
COSN31551245 3195 COSMIC
COSN31591513 3245 COSMIC
COSN8812484 3287 COSMIC
COSN30172577 3389 COSMIC
COSN19498342 3462 COSMIC
COSN25075844 3714 COSMIC
COSN30172310 3761 COSMIC
COSN29821501 3883 COSMIC
COSN31485998 3889 COSMIC
rs35463377 1448 GWAS
rs1057035 2693 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774611849 4 dbSNP
rs770907156 5 dbSNP
rs1327649737 17 dbSNP
rs1051046532 18 dbSNP
rs200095508 20 dbSNP
rs772958808 23 dbSNP
rs1376753111 24 dbSNP
rs1294935979 25 dbSNP
rs772063181 26 dbSNP
rs749282967 30 dbSNP
rs1169107781 31 dbSNP
rs1315714511 34 dbSNP
rs1384920683 35 dbSNP
rs756294748 35 dbSNP
rs746134430 40 dbSNP
rs1206242179 44 dbSNP
rs1253857284 44 dbSNP
rs748693590 44 dbSNP
rs780675412 44 dbSNP
rs781520963 45 dbSNP
rs1200231957 46 dbSNP
rs757682330 48 dbSNP
rs751956931 49 dbSNP
rs1346211091 54 dbSNP
rs1447007375 55 dbSNP
rs191996364 66 dbSNP
rs528568542 67 dbSNP
rs1429164565 78 dbSNP
rs1172891382 81 dbSNP
rs13078 88 dbSNP
rs1337699534 92 dbSNP
rs776253418 97 dbSNP
rs1332134490 98 dbSNP
rs770494720 111 dbSNP
rs566961540 116 dbSNP
rs1296755923 125 dbSNP
rs914042436 126 dbSNP
rs1215815242 127 dbSNP
rs140021568 134 dbSNP
rs1311267469 139 dbSNP
rs571083676 140 dbSNP
rs960882464 142 dbSNP
rs1338679905 144 dbSNP
rs1264166203 145 dbSNP
rs1414942740 153 dbSNP
rs112795042 166 dbSNP
rs1156544450 169 dbSNP
rs1247943199 170 dbSNP
rs1486268334 170 dbSNP
rs1470965129 181 dbSNP
rs1188371720 184 dbSNP
rs1423068568 194 dbSNP
rs536572479 209 dbSNP
rs186123954 210 dbSNP
rs1182589321 211 dbSNP
rs1455417366 220 dbSNP
rs552609115 223 dbSNP
rs1459632213 225 dbSNP
rs772419252 229 dbSNP
rs981079616 232 dbSNP
rs1206166531 233 dbSNP
rs545752774 243 dbSNP
rs1284766371 248 dbSNP
rs578240601 258 dbSNP
rs1226929425 263 dbSNP
rs1283931383 264 dbSNP
rs1318050318 266 dbSNP
rs1218509492 270 dbSNP
rs1245080765 271 dbSNP
rs1203690710 273 dbSNP
rs1022635227 278 dbSNP
rs1353284110 284 dbSNP
rs180926609 290 dbSNP
rs1158168634 305 dbSNP
rs1310339723 313 dbSNP
rs995643319 314 dbSNP
rs1162569791 315 dbSNP
rs1245490865 316 dbSNP
rs1405021599 317 dbSNP
rs1380732567 318 dbSNP
rs200498201 326 dbSNP
rs1279367976 327 dbSNP
rs1348256191 327 dbSNP
rs1351789558 327 dbSNP
rs35649919 327 dbSNP
rs1317204322 328 dbSNP
rs1288313537 329 dbSNP
rs1448701112 329 dbSNP
rs1344472066 333 dbSNP
rs766170875 335 dbSNP
rs541589888 336 dbSNP
rs758181734 337 dbSNP
rs573788003 339 dbSNP
rs1233289168 351 dbSNP
rs1471020232 359 dbSNP
rs1015381767 361 dbSNP
rs1162588716 362 dbSNP
rs758288467 368 dbSNP
rs146053288 381 dbSNP
rs1386590150 383 dbSNP
rs1181884760 387 dbSNP
rs868741469 391 dbSNP
rs1473416079 394 dbSNP
rs1283007414 395 dbSNP
rs1242114717 407 dbSNP
rs1247269979 411 dbSNP
rs1191648874 414 dbSNP
rs746269429 418 dbSNP
rs537146227 419 dbSNP
rs891004627 421 dbSNP
rs1051417658 431 dbSNP
rs10144436 433 dbSNP
rs899808096 442 dbSNP
rs540370928 447 dbSNP
rs1063608 451 dbSNP
rs1445196731 453 dbSNP
rs1357493791 454 dbSNP
rs557719688 461 dbSNP
rs1294061719 463 dbSNP
rs1063609 464 dbSNP
rs142808371 465 dbSNP
rs1361350285 479 dbSNP
rs796969892 480 dbSNP
rs1432777842 482 dbSNP
rs913968481 488 dbSNP
rs1398170438 492 dbSNP
rs988222541 493 dbSNP
rs113164825 494 dbSNP
rs928163495 497 dbSNP
rs1317735322 498 dbSNP
rs981393854 499 dbSNP
rs138226643 500 dbSNP
rs778577287 505 dbSNP
rs1270784988 511 dbSNP
rs754759594 516 dbSNP
rs779080081 517 dbSNP
rs757448202 518 dbSNP
rs1262301860 520 dbSNP
rs886050939 525 dbSNP
rs1461585104 526 dbSNP
rs1205529398 528 dbSNP
rs973721711 530 dbSNP
rs962394544 543 dbSNP
rs1416745951 544 dbSNP
rs1193297859 547 dbSNP
rs1374229285 548 dbSNP
rs796382591 550 dbSNP
rs1175207504 558 dbSNP
rs1429071592 581 dbSNP
rs548834066 585 dbSNP
rs1470502463 602 dbSNP
rs1339337394 606 dbSNP
rs1382088891 618 dbSNP
rs1319099982 644 dbSNP
rs535308545 650 dbSNP
rs1004000162 653 dbSNP
rs1434643922 661 dbSNP
rs1282850285 662 dbSNP
rs866456511 671 dbSNP
rs1324089895 680 dbSNP
rs890923157 682 dbSNP
rs1265947222 687 dbSNP
rs1029514575 690 dbSNP
rs1205608781 698 dbSNP
rs1263254431 709 dbSNP
rs146319183 715 dbSNP
rs185629513 722 dbSNP
rs1044055742 725 dbSNP
rs946714433 733 dbSNP
rs531021447 753 dbSNP
rs886050938 754 dbSNP
rs1453699942 764 dbSNP
rs1248738927 765 dbSNP
rs1052434786 772 dbSNP
rs1302837155 776 dbSNP
rs567306131 778 dbSNP
rs939441711 780 dbSNP
rs563551631 782 dbSNP
rs1286265075 790 dbSNP
rs980978466 791 dbSNP
rs1262414030 797 dbSNP
rs1270932490 800 dbSNP
rs1216288256 801 dbSNP
rs886050937 806 dbSNP
rs948250041 808 dbSNP
rs766702678 820 dbSNP
rs920837889 823 dbSNP
rs1179506115 825 dbSNP
rs1293803536 832 dbSNP
rs1418829061 834 dbSNP
rs1183252786 859 dbSNP
rs1366045824 864 dbSNP
rs551769486 872 dbSNP
rs45518832 873 dbSNP
rs908208420 877 dbSNP
rs982504653 884 dbSNP
rs955163869 886 dbSNP
rs750494177 891 dbSNP
rs530836779 894 dbSNP
rs964258122 898 dbSNP
rs45467692 901 dbSNP
rs767597538 904 dbSNP
rs1360946843 906 dbSNP
rs1202637009 909 dbSNP
rs181259651 911 dbSNP
rs1250408952 914 dbSNP
rs541737776 915 dbSNP
rs1231274015 921 dbSNP
rs1253019517 927 dbSNP
rs756159471 929 dbSNP
rs1052406850 938 dbSNP
rs1385995402 941 dbSNP
rs574200081 943 dbSNP
rs1045581145 952 dbSNP
rs948244071 963 dbSNP
rs1462625470 964 dbSNP
rs1221590835 967 dbSNP
rs752666806 968 dbSNP
rs920796023 973 dbSNP
rs562287090 981 dbSNP
rs563019682 984 dbSNP
rs1337275020 988 dbSNP
rs762234965 995 dbSNP
rs571363127 997 dbSNP
rs55659064 998 dbSNP
rs1370655181 1000 dbSNP
rs1307723829 1002 dbSNP
rs1229109187 1006 dbSNP
rs1260423615 1013 dbSNP
rs1460244253 1019 dbSNP
rs1299392140 1020 dbSNP
rs1471637149 1025 dbSNP
rs1203635995 1028 dbSNP
rs189661484 1032 dbSNP
rs1462998589 1036 dbSNP
rs185201077 1042 dbSNP
rs886050936 1048 dbSNP
rs1418841568 1051 dbSNP
rs764424935 1054 dbSNP
rs922372205 1060 dbSNP
rs1426989366 1071 dbSNP
rs1469097024 1073 dbSNP
rs1177139072 1076 dbSNP
rs1408228519 1077 dbSNP
rs1468667142 1087 dbSNP
rs1361292426 1089 dbSNP
rs975600130 1093 dbSNP
rs1361980209 1104 dbSNP
rs1177178891 1105 dbSNP
rs1280941572 1110 dbSNP
rs1321943982 1118 dbSNP
rs551595785 1124 dbSNP
rs1405978388 1133 dbSNP
rs539005376 1137 dbSNP
rs1314494502 1143 dbSNP
rs1022085461 1168 dbSNP
rs528282193 1180 dbSNP
rs1242578312 1181 dbSNP
rs1201728184 1190 dbSNP
rs956637901 1193 dbSNP
rs571697838 1196 dbSNP
rs1267021864 1197 dbSNP
rs559333909 1199 dbSNP
rs1199888806 1200 dbSNP
rs1431106973 1201 dbSNP
rs1398906996 1206 dbSNP
rs776308492 1210 dbSNP
rs906567014 1211 dbSNP
rs1214729924 1220 dbSNP
rs1314908404 1223 dbSNP
rs1311070122 1229 dbSNP
rs1344475462 1233 dbSNP
rs1045148658 1239 dbSNP
rs1284347228 1247 dbSNP
rs1012755091 1254 dbSNP
rs1222600692 1265 dbSNP
rs1284174737 1276 dbSNP
rs1381450764 1277 dbSNP
rs1312227925 1278 dbSNP
rs1218904729 1283 dbSNP
rs1451124135 1284 dbSNP
rs1404907560 1285 dbSNP
rs76845545 1285 dbSNP
rs1200346749 1296 dbSNP
rs1248294892 1296 dbSNP
rs578164776 1298 dbSNP
rs899307216 1298 dbSNP
rs908106384 1304 dbSNP
rs940868069 1304 dbSNP
rs1453580453 1305 dbSNP
rs535340548 1305 dbSNP
rs1052053297 1308 dbSNP
rs1279277873 1315 dbSNP
rs1374699843 1327 dbSNP
rs1242901221 1337 dbSNP
rs1313040757 1338 dbSNP
rs933662212 1339 dbSNP
rs1223558222 1348 dbSNP
rs1292290979 1350 dbSNP
rs568193804 1354 dbSNP
rs922267282 1364 dbSNP
rs1203580831 1367 dbSNP
rs1420496569 1373 dbSNP
rs1459049492 1375 dbSNP
rs549910293 1382 dbSNP
rs1384111115 1391 dbSNP
rs1444710674 1392 dbSNP
rs1181773370 1395 dbSNP
rs942463789 1396 dbSNP
rs756671135 1397 dbSNP
rs989262025 1407 dbSNP
rs1185843475 1421 dbSNP
rs542883251 1426 dbSNP
rs148025111 1430 dbSNP
rs866552539 1432 dbSNP
rs570089276 1435 dbSNP
rs1358224734 1436 dbSNP
rs1246791075 1443 dbSNP
rs1288975386 1447 dbSNP
rs1246264292 1448 dbSNP
rs1285975969 1449 dbSNP
rs201612854 1449 dbSNP
rs35463377 1449 dbSNP
rs886050935 1449 dbSNP
rs886050934 1450 dbSNP
rs1314128242 1477 dbSNP
rs1201768237 1485 dbSNP
rs982471790 1487 dbSNP
rs1189023880 1503 dbSNP
rs1461667204 1503 dbSNP
rs529235567 1506 dbSNP
rs772627761 1511 dbSNP
rs1168115695 1517 dbSNP
rs551810526 1521 dbSNP
rs563589355 1522 dbSNP
rs1024061101 1523 dbSNP
rs1467508620 1525 dbSNP
rs375584756 1526 dbSNP
rs1406015100 1529 dbSNP
rs1453931442 1531 dbSNP
rs1336265915 1544 dbSNP
rs771544042 1549 dbSNP
rs193038010 1550 dbSNP
rs1016380652 1558 dbSNP
rs1319816159 1560 dbSNP
rs1005051696 1561 dbSNP
rs1262214897 1568 dbSNP
rs1324216335 1569 dbSNP
rs886639114 1571 dbSNP
rs1281573015 1573 dbSNP
rs190465278 1575 dbSNP
rs757476636 1579 dbSNP
rs1264871332 1589 dbSNP
rs1459565289 1593 dbSNP
rs778892818 1602 dbSNP
rs1197726925 1608 dbSNP
rs148897450 1609 dbSNP
rs1169702189 1618 dbSNP
rs1467042427 1623 dbSNP
rs529576357 1626 dbSNP
rs1426620321 1627 dbSNP
rs1187652 1630 dbSNP
rs1039792469 1637 dbSNP
rs749058420 1642 dbSNP
rs1194042023 1646 dbSNP
rs543949139 1652 dbSNP
rs1403283850 1654 dbSNP
rs1282432022 1658 dbSNP
rs1345877405 1662 dbSNP
rs1490085757 1663 dbSNP
rs1266411477 1671 dbSNP
rs942411707 1675 dbSNP
rs914976738 1677 dbSNP
rs1489730722 1682 dbSNP
rs1211249353 1691 dbSNP
rs1268689734 1700 dbSNP
rs1434111155 1701 dbSNP
rs1201734575 1710 dbSNP
rs1362574956 1713 dbSNP
rs35500699 1720 dbSNP
rs531315737 1720 dbSNP
rs563878612 1721 dbSNP
rs1302756720 1723 dbSNP
rs184814331 1729 dbSNP
rs1388290952 1730 dbSNP
rs1250227907 1739 dbSNP
rs1304512311 1746 dbSNP
rs1335108629 1759 dbSNP
rs923785816 1760 dbSNP
rs1310849948 1762 dbSNP
rs1356620549 1765 dbSNP
rs1244869274 1773 dbSNP
rs1292049568 1775 dbSNP
rs982013263 1778 dbSNP
rs1280499487 1779 dbSNP
rs971064154 1780 dbSNP
rs1382298783 1802 dbSNP
rs1401067414 1803 dbSNP
rs1023579440 1812 dbSNP
rs571735282 1820 dbSNP
rs1369272659 1823 dbSNP
rs886050933 1825 dbSNP
rs1459583983 1827 dbSNP
rs138980290 1828 dbSNP
rs1016349557 1834 dbSNP
rs756438588 1842 dbSNP
rs1380027975 1846 dbSNP
rs886050932 1847 dbSNP
rs1312740656 1848 dbSNP
rs1323170223 1856 dbSNP
rs541770994 1860 dbSNP
rs750594948 1867 dbSNP
rs1425604136 1868 dbSNP
rs1250018375 1870 dbSNP
rs1339114617 1874 dbSNP
rs540809100 1894 dbSNP
rs1030933640 1895 dbSNP
rs997751105 1914 dbSNP
rs1426905340 1927 dbSNP
rs556090668 1928 dbSNP
rs1200592297 1934 dbSNP
rs900739132 1939 dbSNP
rs1249226804 1945 dbSNP
rs1465946163 1949 dbSNP
rs538007258 1952 dbSNP
rs1039312359 1962 dbSNP
rs769292863 1966 dbSNP
rs1302953991 1969 dbSNP
rs191574000 1972 dbSNP
rs893509680 1974 dbSNP
rs1294389295 1975 dbSNP
rs1340369075 1978 dbSNP
rs573381337 1982 dbSNP
rs1260614159 1986 dbSNP
rs1219762419 1990 dbSNP
rs186767104 1996 dbSNP
rs935086203 1998 dbSNP
rs1273399750 2000 dbSNP
rs1484271851 2002 dbSNP
rs923753708 2010 dbSNP
rs1478240035 2014 dbSNP
rs1195607540 2026 dbSNP
rs539919178 2030 dbSNP
rs949269719 2035 dbSNP
rs916479268 2042 dbSNP
rs1450989507 2045 dbSNP
rs1306391165 2049 dbSNP
rs182848457 2050 dbSNP
rs1360780150 2052 dbSNP
rs776800950 2060 dbSNP
rs1402530387 2061 dbSNP
rs963339106 2064 dbSNP
rs547777889 2067 dbSNP
rs983511561 2076 dbSNP
rs1219204240 2091 dbSNP
rs1302586227 2103 dbSNP
rs529563923 2104 dbSNP
rs1213754620 2111 dbSNP
rs1285342239 2121 dbSNP
rs1488758753 2123 dbSNP
rs1399827995 2125 dbSNP
rs375654589 2126 dbSNP
rs1174054818 2127 dbSNP
rs1030446400 2132 dbSNP
rs998075873 2137 dbSNP
rs1362934615 2140 dbSNP
rs964946139 2141 dbSNP
rs752074297 2142 dbSNP
rs1011794406 2153 dbSNP
rs893436013 2157 dbSNP
rs1421177299 2163 dbSNP
rs1053405272 2165 dbSNP
rs192718122 2169 dbSNP
rs1436219024 2170 dbSNP
rs1363149322 2173 dbSNP
rs902240610 2174 dbSNP
rs1046183639 2176 dbSNP
rs1202474079 2177 dbSNP
rs1222526926 2190 dbSNP
rs1346144337 2190 dbSNP
rs1308673611 2193 dbSNP
rs949231811 2197 dbSNP
rs1242660476 2204 dbSNP
rs1238219178 2220 dbSNP
rs1451184715 2222 dbSNP
rs1222044855 2223 dbSNP
rs916425045 2229 dbSNP
rs1055009651 2235 dbSNP
rs1379252410 2240 dbSNP
rs1310013634 2251 dbSNP
rs1380426112 2251 dbSNP
rs941943577 2263 dbSNP
rs909183320 2268 dbSNP
rs1405544334 2281 dbSNP
rs550196410 2282 dbSNP
rs983439647 2294 dbSNP
rs1440716527 2306 dbSNP
rs7158095 2309 dbSNP
rs1377828321 2320 dbSNP
rs775911970 2323 dbSNP
rs1449095511 2326 dbSNP
rs1312940503 2328 dbSNP
rs1355938907 2334 dbSNP
rs1336090341 2337 dbSNP
rs1229061892 2346 dbSNP
rs1414887459 2350 dbSNP
rs1291809597 2355 dbSNP
rs923348310 2355 dbSNP
rs976227310 2356 dbSNP
rs200215778 2361 dbSNP
rs564317468 2361 dbSNP
rs1181242650 2365 dbSNP
rs1236346595 2367 dbSNP
rs140355178 2380 dbSNP
rs188106426 2380 dbSNP
rs1416483843 2386 dbSNP
rs1408570042 2387 dbSNP
rs527349342 2388 dbSNP
rs567592628 2396 dbSNP
rs1401679343 2397 dbSNP
rs1467597540 2401 dbSNP
rs1182376874 2403 dbSNP
rs559735598 2408 dbSNP
rs541765733 2409 dbSNP
rs886050931 2410 dbSNP
rs183501373 2418 dbSNP
rs1359682514 2426 dbSNP
rs1444564480 2427 dbSNP
rs1258418067 2433 dbSNP
rs1236302267 2456 dbSNP
rs902208967 2466 dbSNP
rs1443402750 2481 dbSNP
rs1046534909 2484 dbSNP
rs556464130 2493 dbSNP
rs1189271979 2509 dbSNP
rs1240007183 2512 dbSNP
rs1477257901 2529 dbSNP
rs372370761 2530 dbSNP
rs1286835262 2533 dbSNP
rs894948143 2548 dbSNP
rs779296405 2549 dbSNP
rs1171310498 2555 dbSNP
rs1054977896 2557 dbSNP
rs1245425307 2558 dbSNP
rs1354323945 2560 dbSNP
rs941871335 2568 dbSNP
rs887676239 2572 dbSNP
rs1047716650 2576 dbSNP
rs929291338 2576 dbSNP
rs544177735 2583 dbSNP
rs923305283 2583 dbSNP
rs577139593 2585 dbSNP
rs1325675888 2593 dbSNP
rs1274180117 2597 dbSNP
rs558771191 2613 dbSNP
rs369513768 2626 dbSNP
rs1201688337 2631 dbSNP
rs1281460400 2632 dbSNP
rs1401473800 2636 dbSNP
rs145757043 2644 dbSNP
rs1162530452 2645 dbSNP
rs1478997310 2650 dbSNP
rs957572435 2651 dbSNP
rs1377560009 2652 dbSNP
rs141919532 2662 dbSNP
rs1174421704 2676 dbSNP
rs1031874646 2682 dbSNP
rs1057035 2693 dbSNP
rs568358867 2694 dbSNP
rs760246677 2695 dbSNP
rs1262938353 2696 dbSNP
rs1384868378 2703 dbSNP
rs1322581574 2704 dbSNP
rs1024661120 2708 dbSNP
rs1277305914 2709 dbSNP
rs191724990 2717 dbSNP
rs1489473920 2719 dbSNP
rs749467333 2729 dbSNP
rs1264248537 2736 dbSNP
rs573135025 2757 dbSNP
rs772863817 2766 dbSNP
rs1489679970 2774 dbSNP
rs1208456417 2776 dbSNP
rs1452738847 2780 dbSNP
rs765038526 2780 dbSNP
rs531895007 2781 dbSNP
rs777914593 2787 dbSNP
rs1159261071 2790 dbSNP
rs1382417053 2795 dbSNP
rs887644836 2800 dbSNP
rs186384308 2801 dbSNP
rs1391143380 2804 dbSNP
rs1338597609 2806 dbSNP
rs929244732 2808 dbSNP
rs771539516 2811 dbSNP
rs575292922 2813 dbSNP
rs886050930 2826 dbSNP
rs1040390206 2827 dbSNP
rs1446886154 2830 dbSNP
rs552322819 2839 dbSNP
rs147563014 2845 dbSNP
rs943394672 2846 dbSNP
rs1243577158 2847 dbSNP
rs910632069 2860 dbSNP
rs1357485467 2864 dbSNP
rs1433815780 2866 dbSNP
rs1351147610 2867 dbSNP
rs1212221898 2871 dbSNP
rs1236889807 2880 dbSNP
rs1323580940 2880 dbSNP
rs372590879 2882 dbSNP
rs1179365233 2897 dbSNP
rs1240058095 2901 dbSNP
rs990225981 2902 dbSNP
rs559778560 2903 dbSNP
rs936135259 2922 dbSNP
rs1187076393 2930 dbSNP
rs1368892153 2938 dbSNP
rs1423632011 2941 dbSNP
rs1169150248 2945 dbSNP
rs1479037282 2947 dbSNP
rs1424752059 2949 dbSNP
rs1190866812 2951 dbSNP
rs1459241485 2952 dbSNP
rs1487602441 2952 dbSNP
rs1168185336 2953 dbSNP
rs1399470424 2958 dbSNP
rs537009606 2965 dbSNP
rs1332842485 2968 dbSNP
rs1376322416 2980 dbSNP
rs1222307704 2985 dbSNP
rs1341823933 2986 dbSNP
rs1235548744 2990 dbSNP
rs1256507372 3006 dbSNP
rs1317869575 3008 dbSNP
rs1199784639 3012 dbSNP
rs1396697573 3012 dbSNP
rs1457366104 3013 dbSNP
rs1256142575 3014 dbSNP
rs774193499 3016 dbSNP
rs978052972 3018 dbSNP
rs1200158670 3021 dbSNP
rs886050929 3024 dbSNP
rs756260449 3038 dbSNP
rs768690462 3039 dbSNP
rs1422621229 3040 dbSNP
rs991819605 3041 dbSNP
rs1357000470 3052 dbSNP
rs1465113063 3053 dbSNP
rs1302859614 3061 dbSNP
rs1217130128 3068 dbSNP
rs1403938049 3069 dbSNP
rs1276742807 3070 dbSNP
rs1397706623 3070 dbSNP
rs959339279 3072 dbSNP
rs183203101 3094 dbSNP
rs1298364114 3101 dbSNP
rs529744245 3104 dbSNP
rs1005983613 3116 dbSNP
rs1256610185 3118 dbSNP
rs1484384395 3126 dbSNP
rs1214703181 3127 dbSNP
rs1262283122 3128 dbSNP
rs1488494352 3134 dbSNP
rs1195493969 3136 dbSNP
rs1422991554 3144 dbSNP
rs1440915378 3147 dbSNP
rs1397477427 3151 dbSNP
rs1378828060 3168 dbSNP
rs749200376 3174 dbSNP
rs886050928 3175 dbSNP
rs189898328 3185 dbSNP
rs1400994073 3192 dbSNP
rs199910883 3205 dbSNP
rs1366139441 3206 dbSNP
rs1219112552 3210 dbSNP
rs1302133508 3216 dbSNP
rs993795610 3231 dbSNP
rs1238337453 3232 dbSNP
rs185088366 3234 dbSNP
rs564907544 3243 dbSNP
rs1191976627 3248 dbSNP
rs1439212536 3254 dbSNP
rs1488141121 3257 dbSNP
rs1040730928 3267 dbSNP
rs1236397122 3282 dbSNP
rs565097712 3286 dbSNP
rs1007550157 3287 dbSNP
rs1421085475 3294 dbSNP
rs1161771952 3297 dbSNP
rs1458119435 3297 dbSNP
rs1436472218 3307 dbSNP
rs180705469 3312 dbSNP
rs1373751446 3318 dbSNP
rs1444674059 3321 dbSNP
rs1207839989 3322 dbSNP
rs1308564104 3337 dbSNP
rs889120755 3337 dbSNP
rs1225652686 3339 dbSNP
rs113050387 3341 dbSNP
rs746137769 3342 dbSNP
rs766696071 3342 dbSNP
rs551852272 3345 dbSNP
rs1222822641 3347 dbSNP
rs528603414 3348 dbSNP
rs1041875974 3349 dbSNP
rs1179743698 3357 dbSNP
rs1310753388 3361 dbSNP
rs1449671895 3362 dbSNP
rs751582046 3366 dbSNP
rs1397352046 3371 dbSNP
rs1464484892 3373 dbSNP
rs766135670 3392 dbSNP
rs917505449 3394 dbSNP
rs992186221 3398 dbSNP
rs958992966 3410 dbSNP
rs554286964 3411 dbSNP
rs781473299 3414 dbSNP
rs984518166 3415 dbSNP
rs565849628 3435 dbSNP
rs1378571193 3436 dbSNP
rs1197897906 3437 dbSNP
rs951790677 3442 dbSNP
rs1384575362 3449 dbSNP
rs751638177 3452 dbSNP
rs1026514195 3469 dbSNP
rs3742330 3473 dbSNP
rs1472894234 3490 dbSNP
rs1189135258 3494 dbSNP
rs1255458271 3504 dbSNP
rs1420435690 3517 dbSNP
rs1477157273 3520 dbSNP
rs1170572760 3521 dbSNP
rs1401206136 3522 dbSNP
rs1411734207 3529 dbSNP
rs574809342 3534 dbSNP
rs1332210626 3538 dbSNP
rs529121490 3545 dbSNP
rs966303202 3548 dbSNP
rs1180026083 3553 dbSNP
rs1448976118 3554 dbSNP
rs1314533065 3555 dbSNP
rs186388543 3556 dbSNP
rs1218012148 3563 dbSNP
rs1237801551 3564 dbSNP
rs538167133 3565 dbSNP
rs1216996144 3566 dbSNP
rs1277246725 3578 dbSNP
rs1007889364 3582 dbSNP
rs889090013 3591 dbSNP
rs1350983083 3595 dbSNP
rs1487508991 3596 dbSNP
rs878886499 3596 dbSNP
rs1193312444 3603 dbSNP
rs1374155971 3611 dbSNP
rs1476646752 3613 dbSNP
rs758932903 3614 dbSNP
rs1287542000 3616 dbSNP
rs80121928 3617 dbSNP
rs78663441 3618 dbSNP
rs76409886 3619 dbSNP
rs1240319801 3623 dbSNP
rs1000182035 3626 dbSNP
rs1320575070 3630 dbSNP
rs1262250052 3646 dbSNP
rs1312694588 3651 dbSNP
rs1315002526 3669 dbSNP
rs1394767633 3674 dbSNP
rs1381836455 3690 dbSNP
rs1399181317 3691 dbSNP
rs1298529990 3695 dbSNP
rs1303739277 3696 dbSNP
rs1399643643 3699 dbSNP
rs1328165997 3702 dbSNP
rs1434176656 3708 dbSNP
rs1358940960 3713 dbSNP
rs1273786688 3718 dbSNP
rs1283442143 3736 dbSNP
rs80103767 3736 dbSNP
rs1420437757 3743 dbSNP
rs1042232300 3756 dbSNP
rs1367935758 3756 dbSNP
rs1262818881 3761 dbSNP
rs1449272028 3767 dbSNP
rs950239059 3775 dbSNP
rs1246258807 3776 dbSNP
rs917414834 3780 dbSNP
rs148795970 3782 dbSNP
rs1425438919 3783 dbSNP
rs1414278723 3787 dbSNP
rs1056011240 3789 dbSNP
rs1403594980 3790 dbSNP
rs1322810043 3793 dbSNP
rs1192588819 3796 dbSNP
rs535310119 3805 dbSNP
rs1371551409 3810 dbSNP
rs765598296 3816 dbSNP
rs1306390419 3819 dbSNP
rs926249853 3826 dbSNP
rs1463501948 3835 dbSNP
rs1216854190 3844 dbSNP
rs1240382117 3847 dbSNP
rs181818005 3861 dbSNP
rs1261730176 3882 dbSNP
rs984444798 3885 dbSNP
rs11556997 3886 dbSNP
rs919012849 3889 dbSNP
rs1263120576 3894 dbSNP
rs1195612383 3897 dbSNP
rs1243280229 3902 dbSNP
rs1236402991 3907 dbSNP
rs1439375495 3920 dbSNP
rs1182787225 3922 dbSNP
rs972230345 3929 dbSNP
rs750106160 3931 dbSNP
rs1456201511 3943 dbSNP
rs1162369277 3950 dbSNP
rs965864520 3951 dbSNP
rs1323968536 3954 dbSNP
rs1019210213 3962 dbSNP
rs1294441147 3963 dbSNP
rs532947960 3966 dbSNP
rs1338875884 3967 dbSNP
rs953283982 3971 dbSNP
rs1338279639 3975 dbSNP
rs1243100804 3979 dbSNP
rs1032912964 3980 dbSNP
rs1336162275 3981 dbSNP
rs1300328889 3990 dbSNP
rs1256308325 4002 dbSNP
rs886050927 4005 dbSNP
rs1382953321 4006 dbSNP
rs1390141223 4010 dbSNP
rs529739419 4020 dbSNP
rs1291805809 4034 dbSNP
rs1252940486 4036 dbSNP
rs1422230500 4037 dbSNP
rs112079219 4039 dbSNP
rs1369049314 4041 dbSNP
rs761276152 4061 dbSNP
rs1418260640 4063 dbSNP
rs774018669 4068 dbSNP
rs1020335230 4072 dbSNP
rs1422374358 4076 dbSNP
rs1462063582 4079 dbSNP
rs1299339662 4085 dbSNP
rs1399652994 4090 dbSNP
rs1395059620 4093 dbSNP
rs1312709731 4098 dbSNP
rs1356494847 4108 dbSNP
rs1476744853 4110 dbSNP
rs1276863530 4115 dbSNP
rs1307365736 4117 dbSNP
rs1228270094 4120 dbSNP
rs1014757027 4128 dbSNP
rs1253107678 4128 dbSNP
rs895962647 4135 dbSNP
rs1258033042 4145 dbSNP
rs1056381359 4147 dbSNP
rs1191154175 4155 dbSNP
rs763634343 4163 dbSNP
rs1425461335 4169 dbSNP
rs937523852 4173 dbSNP
rs1429011580 4174 dbSNP
rs1193970838 4185 dbSNP
rs888684231 4187 dbSNP
rs1465289838 4215 dbSNP
rs1048717995 4216 dbSNP
rs930259829 4222 dbSNP
rs1361903310 4223 dbSNP
rs918918852 4223 dbSNP
rs971814253 4223 dbSNP
rs944465555 4225 dbSNP
rs1432186274 4233 dbSNP
rs1310503303 4235 dbSNP
rs1264668951 4240 dbSNP
rs1211039308 4241 dbSNP
rs1233927935 4250 dbSNP
rs1281310132 4251 dbSNP
rs886050926 4260 dbSNP
rs911674521 4261 dbSNP
rs776066400 4262 dbSNP
rs1486182632 4264 dbSNP
rs185087846 4265 dbSNP
rs1188193309 4269 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.76 5.0e-5 0.777 2.8e-5 20 Click to see details
GSE21032 Prostate cancer 0.334 1.0e-3 0.287 4.3e-3 83 Click to see details
GSE38226 Liver fibrosis -0.607 1.8e-3 -0.425 2.7e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.549 2.6e-2 -0.423 7.5e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.342 5.5e-2 -0.235 1.4e-1 23 Click to see details
GSE17498 Multiple myeloma 0.177 1.4e-1 0.103 2.6e-1 40 Click to see details
GSE28544 Breast cancer -0.215 1.6e-1 -0.525 4.2e-3 24 Click to see details
GSE27834 Pluripotent stem cells -0.248 1.8e-1 -0.197 2.3e-1 16 Click to see details
GSE19783 ER- ER- breast cancer 0.104 1.8e-1 0.103 1.8e-1 79 Click to see details
GSE21849 B cell lymphoma -0.15 2.2e-1 -0.145 2.3e-1 29 Click to see details
GSE19536 Breast cancer 0.077 2.2e-1 0.100 1.6e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.101 3.2e-1 -0.075 3.6e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.051 3.2e-1 -0.001 5.0e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.075 3.4e-1 0.124 2.5e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.076 3.6e-1 -0.023 4.6e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.074 3.7e-1 -0.170 2.1e-1 24 Click to see details
GSE17306 Multiple myeloma -0.043 3.8e-1 0.049 3.7e-1 49 Click to see details
GSE19350 CNS germ cell tumors -0.075 4.1e-1 -0.329 1.5e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.015 4.5e-1 -0.040 3.8e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer 0.025 4.6e-1 0.029 4.5e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer 0.025 4.6e-1 0.029 4.5e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.31 0.02 0.144 0.16 49 Click to see details
PAAD 0.969 0.02 1.000 0.5 4 Click to see details
HNSC 0.292 0.03 0.384 0.01 42 Click to see details
CHOL -0.566 0.06 -0.417 0.13 9 Click to see details
BRCA 0.132 0.12 0.098 0.19 84 Click to see details
PCPG -0.91 0.14 -1.000 0.5 3 Click to see details
THCA -0.112 0.2 -0.197 0.07 59 Click to see details
COAD -0.322 0.22 -0.619 0.05 8 Click to see details
PRAD 0.084 0.28 0.020 0.45 50 Click to see details
ESCA -0.189 0.29 -0.355 0.14 11 Click to see details
STAD 0.096 0.3 0.080 0.33 32 Click to see details
UCEC -0.117 0.32 -0.002 0.5 19 Click to see details
LUAD 0.133 0.34 0.203 0.26 12 Click to see details
KIRP -0.06 0.37 -0.146 0.21 32 Click to see details
CESC 0.372 0.38 0.500 0.33 3 Click to see details
KICH -0.06 0.39 -0.032 0.44 25 Click to see details
BLCA 0.064 0.4 -0.042 0.43 18 Click to see details
LUSC -0.03 0.43 -0.071 0.34 38 Click to see details
KIRC -0.004 0.49 0.018 0.44 68 Click to see details
KIRC -0.004 0.49 0.018 0.44 68 Click to see details
KIRC -0.004 0.49 0.018 0.44 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1