miRTarBase - #MIRT727523 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GSK3B   
Synonyms -
Description glycogen synthase kinase 3 beta
Transcript NM_001146156   
Other Transcripts NM_002093   
Expression
Putative miRNA Targets on GSK3B
3'UTR of GSK3B
(miRNA target sites are highlighted)
>GSK3B|NM_001146156|3'UTR
   1 ACAGTCCCGAGCAGCCAGCTGCACAGGAAAAACCACCAGTTACTTGAGTGTCACTCAGCAACACTGGTCACGTTTGGAAA
  81 GAATATTAAAAAGAGAAAAAAATCCTGTTCATTTTAGTGTTCAATTTTTTTATTATTATTGTTGTTCTTATTTAACCTTG
 161 TAAAATATCTATAAATACAAACCAATTTCATTGTATTCTCACTTTGAGGGAGATCCAGGGGGTGGGAGGGGTTGTGGGGA
 241 GGGGGAAAGCGGAGCACTAGAACATACAATCTCTCTCCCACGACAATCTTTTTTTATTAAAAGTCTGCTGTTGTATACTT
 321 TAAAAACAGGACTCCTGCCTCATGCCCCTTCCACAAAAGAAGAAAACCTTTTTCTGTGCTGATGGGTTTTTTTGAACTTT
 401 GTTTTCTTTTAAAGTCTAGTGTGAGACTTTGGTATAGTGCACAGCTTGAAATTGGTTGGGAGCTTAGCAGGTATAACTCA
 481 ACGGGGACTTAAATGTCACTTGTAAAATTAATCCATATCTTCGGGTATTTATAGACTTGCCTTTGGCATGTTGGTGGCAG
 561 GTGTGGCAGACAAAGAAATGTGTATCATTCGTAACCCAGGGAGGTCAATAAAGTTTGGAACTCTACAGGGAAGATTCTTA
 641 GTAGATTTGTTAAGGTTTTGTTTTGCTCTCAGTTAGTGCTAGTGATGTAGAGGCTTGTACAGGAGGCTGCCAGAGGGGAA
 721 GCAGCAAGCAAGACTCAGGCACACATGCTCTACAGGTGGCTCTTTGTTTGCCTGACCAAAGTTCTTTGCAAATCTTAGCA
 801 CAGTTTCAAACTAGTGACCTGGGAGGAGATGGAAGGGGTGTTGAGCAGGCTGAGCTAGCTGCTGAGGTCAAAGGCTGATG
 881 AGCCCAGAGGAAGGGGACAGGTCAGGGATACATCTCACCACTGTGAATAAGTTTGTCCAGATTTTTTTCTAAAGTTACTT
 961 CCCTTGGAAAGATACACTTGAGAGGACATTGTAGTTAAATAATGTGAACTGTAACAGTCATCTACTGGTTTATTTTTCAT
1041 ATTTTTTAATTGAAAATTGAGCTTGCAGAAATAGCCACATTCTACACATAGTTCTAATTTTAAATCCAAATCTAGAATCT
1121 GTATTTAATTTGTTTTTTAACCTCATGCTTTTTACATTTATTTATTGATGCATGTCAGATGGTAGAAATATTAAAAACTA
1201 CACATCAGAATGATACAGTCACTTATACCTGCTGACTTTATAGGAAAGCTGATGATATAAATGTGTGTATATATGTTATA
1281 TATACATATATTCAATACTGCCTTTTTTTTTGTCTACAGTATCAAAATTGACTGGTTGAAGCATGAGAAGAATGTTTCCC
1361 CCACACCCAGTTAAGAGTTTTTGTGTCTGTTTTCTTTGTGTATCAGTGAACGATGTTAAGAATCAGTCTCTCTTTTTGAA
1441 GAAAAAGCAATATTCCTTGGAAAGCAAGGAGAATTGAAGGACTATGTTTGCCGTGAGGAAATAGATTTTCATGACTAGTT
1521 TGTTTTATACTTTTAAGGTTGGCATCTATGTGGGCCTTATATACTCTAAAATGAACTTTAGTCACCTTGGTGCTTATGGG
1601 CCATTACTTGACCTATGAATCTTTAAGGCACAATCAGTTGTACTTTACATTTAAAGATCACTTGAGTGATGGCCGCCTTT
1681 CCCTCCTACCCGCTCCTTCCCCACATGCCTTCCAAGGTTAGCTGGTAACTGTAGGGCTGCAGAGCTGAGCCCATGGTTGT
1761 GTGTAACTTGCCCTCACCCTCCTCATTGCCACCTTAGGTCACTTTATGGGTCTCGTCCTCCAGAGGGTTCGGAAGTGGAG
1841 TCTGTTGGCAGCCCTCCTGCAGGCCCTAGCACCCTGTCCTGCTCCTTAACTGTGTGTGTGACTCTCCAAGAGAGTTGTCC
1921 TGCCTGCTGAAGTGAACCAGTACCCAGAAAGACAACTGTGAGCCATCTTGGTTTTCACTCGCTGTTTAGCTGAGGTCTTG
2001 GGCCACAAAAGGGGTTTCACAAACCTCTGGATATATCAGAGTTTATGAGAAAGGAAACATGCTCAGTCAAACCAAATCAA
2081 ACAAATTGAATTTTATGTTTTATAAAGTGCTTCTGAAAGCTAAGATTTGAAAGAAGTCTGAAATCAAAGTATTTGGCAGC
2161 ATAACTCCTTAAAGGTAGTGGCGTTGATAGACCATTTTCAGACAGAATTTATAAAGAATCTGAAAAGGCAGGTCTGTGAT
2241 AGAGAAATGGACCTGCATTCAGATCCAACTGCCCAGCAAGCGTTTGGATGCAGACACTGCTCTGGACGTGGTATACTCCC
2321 CAGAGTCCATAAAAATCAGTGCTTATTTTAGGAAACAGGTTGCCCCCCACAACTGGGGTAAAAGAAGAGAGAAAAGTCAC
2401 GCTTTTCTCTCATTTCATTGTGTGTGCATGTGTGCGTGTGTGTGTGTGTGTGTGTGTGCTGAGATGTGTGATTTTTCTTT
2481 CTCAAGGATCATGGTGGGATCACAGAACTCTTTTATACAAGTGAGATCCAGGTCTCTGAATATCTTTTTGTATATAATAA
2561 TAATAAAAAGCTCCTCACCAAATTCAAGCTTGTACATTATATTTTCTTTCTGTGTTTTTAAATTTAAGTTTTATTGTTTT
2641 GTATGTAAATATGTGGACCCAGGAACTGTTATTAATGAGCAAAAAGTTACTGTTCAGGGCAGTGATTCTGTTTAATAATC
2721 AGACAAAATGTAGACGAGCTTTTTAAAGCCATATAGTTTTAACTCTGTACAGTAGGTACCGGCCTGTATTATTGTAACAA
2801 TAACTCTAGCAATGTATAGTGTATCTATATAGTTTGGAGTGCCTTCGCTTCCATGTGTTTTTTTTTTTAATTTGTTCTTT
2881 TTTAAATTTTAATTGGTTTCCTTTATCCATGTCTCCCTGTCCACCCCCTTTCCCTTTGAAATAATAACTCACTCATAACA
2961 GTATCTTTGCCCCTTCCACAGTTAAGTTTCAGTGATACCATACTCAGGAGTGGGAAGAGGAAATCATATTCGTAATTTCA
3041 TTTCGTTGAAGCCCTGCCTTTGTTTTGGTTCTGAATGTCTTTCCTCCTCGGTAGCAGTGAGACCGGTTTCATTTCATACT
3121 TAGTCCATTCAGGGACTTAGTGTAGCACCAGGGAGCCCTAGAGCTGGAGGATATCGAATAGATTAAATTTTGCTCGTCTC
3201 TTCCACAAGCCCTAACCATGGGTCTTAAAAACAGCAGATTCTGGGAGCCTTCCATGCTCTCTCTCTCTCCTCTTTTATCT
3281 ACTTCCCTCCCAAATGAGAGAGTGACAGAGAATTGTTTTTTTATAAATCGAAGTTTCTTAATAGTATCAGGTTTTGATAC
3361 GTCAGTGGTCTAAAATGCTATAGTGCAATTACTAGCAGTTACTGCACGGAGTGCCACCGTGCCAATAGAGGACTGTTGTT
3441 TTAACAAGGGAACTCTTAGCCCATTTCCTCCCTCCCGCCATCTCTACCCTTGCTCAATGAAATATCATTTTAATTTCTTT
3521 TAAAAAAAATCAGTTTAATTCTTACTGTGTGCCCAACACGAAGGCCTTTTTTGAAAGAAAAATAGAATGTTTTGCCTCAA
3601 AGTAGTCCATATAAAATGTCTTGAATAGAAGAAAAAACTACCAAACCAAAGGTTACTATTTTTGAAACATCGTGTGTTCA
3681 TTCCAGCAAGGCAGAAGACTGCACCTTCTTTCCAGTGACATGCTGTGTCATTTTTTTTAAGTCCTCTTAATTTTTAGACA
3761 CATTTTTGGTTTATGTTTTAACAATGTATGCCTAACCAGTCATCTTGTCTGCACCAATGCAAAGGTTTCTGAGAGGAGTA
3841 TTCTCTATCCCTGTGGATATGAAGACACTGGCATTTCATCTATTTTTCCCTTTCCTTTTTAAAGGATTTAACTTTGGAAT
3921 CTTCCAAAGGAAGTTTGGCCAATGCCAGATCCCCAGGAATTTGGGGGGTTTTCTTTCTTTTCAACTGAAATTGTATCTGA
4001 TTCCTACTGTTCATGTTAGTGATCATCTAATCACAGAGCCAAACACTTTTCTCCCCTGTGTGGAAAAGTAGGTATGCTTT
4081 ACAATAAAATCTGTCTTTTCTGGTAGAAACCTGAGCCACTGAAAATAAAAGAGACAACTAGAAGCACAGTAGAGTCCCAG
4161 ACTGAGATCTACCTTTGAGAGGCTTTGAAAGTAATCCCTGGGGTTTGGATTATTTTCACAAGGGTTATGCCGTTTTATTC
4241 AAGTTTGTTGCTCCGTTTTGCACCTCTGCAATAAAAGCAAAATGACAACCAGTACATAAGGGGTTAGCTTGACAAAGTAG
4321 ACTTCCTTGTGTTAATTTTTAAGTTTTTTTTTCCTTAACTATATCTGTCTACAGGCAGATACAGATAGTTGTATGAAAAT
4401 CTGCTTGCCTGTAAAATTTGCATTTATAAATGTGTTGCCGATGGATCACTTGGGCCTGTACACATACCAATTAGCGTGAC
4481 CACTTCCATCTTAAAAACAAACCTAAAAAACAAAATTTATTATATATATATATATATATATATAAAGGACTGTGGGTTGT
4561 ATACAAACTATTGCAAACACTTGTGCAAATCTGTCTTGATATAAAGGAAAAGCAAAATCTGTATAACATTATTACTACTT
4641 GAATGCCTCTGTGACTGATTTTTTTTTCATTTTAAATATAAACTTTTTTGTGAAAAGTATGCTCAATGTTTTTTTTCCCT
4721 TTCCCCATTCCCTTGTAAATACATTTTGTTCTATGTGACTTGGTTTGGAAATAGTTAACTGGTACTGTAATTTGCATTAA
4801 ATAAAAAGTAGGTTAGCCTGGAAATGAAATTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGG--UAAUACACGACGAu 5'
             |||||   || ||||||| | 
Target 5' agaAAACCTTTTTCTGTGCTGATg 3'
361 - 384 137.00 -13.82
2
miRNA  3' guguuuGGUAAU----ACACGACGAu 5'
                ::||||    | |||||:| 
Target 5' ctttttTTATTAAAAGTCTGCTGTTg 3'
288 - 313 134.00 -9.70
3
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |::||||| ||:||:| 
Target 5' tttttATTATTAT-TGTTGTTc 3'
127 - 147 132.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28189251 9 COSMIC
COSN30190554 11 COSMIC
COSN31548162 19 COSMIC
COSN30112696 28 COSMIC
COSN26641828 64 COSMIC
COSN30118885 64 COSMIC
COSN30484908 83 COSMIC
COSN30519701 103 COSMIC
COSN30468642 110 COSMIC
COSN28868342 125 COSMIC
COSN15647183 129 COSMIC
COSN30698971 135 COSMIC
COSN31558049 165 COSMIC
COSN27929410 176 COSMIC
COSN6747284 322 COSMIC
COSN15097152 453 COSMIC
COSN17459376 757 COSMIC
COSN21000745 1028 COSMIC
COSN25388968 1119 COSMIC
COSN22847658 1215 COSMIC
COSN23846056 1671 COSMIC
COSN32056193 1784 COSMIC
COSN7814300 1960 COSMIC
COSN9233524 2239 COSMIC
COSN18723319 2439 COSMIC
COSN20098922 2626 COSMIC
COSN5865392 3014 COSMIC
COSN1910508 3121 COSMIC
COSN32176438 3130 COSMIC
COSN1910507 3174 COSMIC
COSN1910505 3512 COSMIC
COSN28365366 3521 COSMIC
COSN17212328 3531 COSMIC
COSN1910503 3678 COSMIC
COSN29533445 3730 COSMIC
COSN14935032 4001 COSMIC
COSN31962129 4254 COSMIC
COSN21514816 4284 COSMIC
COSN9233523 4352 COSMIC
COSN23364212 4543 COSMIC
COSN20098917 4658 COSMIC
COSN5518849 4778 COSMIC
COSN16377125 4939 COSMIC
COSN21734641 4958 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs141641235 2 dbSNP
rs1232892264 4 dbSNP
rs546174832 7 dbSNP
rs748262855 8 dbSNP
rs202040450 9 dbSNP
rs750209798 10 dbSNP
rs1315979333 12 dbSNP
rs1239441454 21 dbSNP
rs199546717 30 dbSNP
rs1426594445 36 dbSNP
rs968330945 38 dbSNP
rs542318284 44 dbSNP
rs751072793 45 dbSNP
rs907210559 49 dbSNP
rs1390278102 51 dbSNP
rs758941856 51 dbSNP
rs1382937924 58 dbSNP
rs767709239 65 dbSNP
rs763534104 71 dbSNP
rs762507594 72 dbSNP
rs897255086 85 dbSNP
rs199859509 89 dbSNP
rs1336099921 93 dbSNP
rs1468704511 95 dbSNP
rs1296737385 96 dbSNP
rs201590431 102 dbSNP
rs1360153357 103 dbSNP
rs746458626 103 dbSNP
rs759870561 103 dbSNP
rs941898738 104 dbSNP
rs1447980133 105 dbSNP
rs1257411907 106 dbSNP
rs777008186 107 dbSNP
rs200620630 110 dbSNP
rs887662264 117 dbSNP
rs530691026 123 dbSNP
rs761198888 124 dbSNP
rs72548714 129 dbSNP
rs779447242 132 dbSNP
rs1432607920 135 dbSNP
rs1340919293 138 dbSNP
rs931622469 140 dbSNP
rs72548715 141 dbSNP
rs750133756 152 dbSNP
rs1377288278 162 dbSNP
rs1334902414 164 dbSNP
rs1409521986 168 dbSNP
rs772335906 169 dbSNP
rs748255898 171 dbSNP
rs779051945 172 dbSNP
rs1417638176 176 dbSNP
rs1186349448 181 dbSNP
rs774629070 183 dbSNP
rs769024453 185 dbSNP
rs1210203907 186 dbSNP
rs1457219144 187 dbSNP
rs1432626259 188 dbSNP
rs756786679 191 dbSNP
rs1027590991 198 dbSNP
rs1436764558 199 dbSNP
rs1319705741 204 dbSNP
rs370966100 208 dbSNP
rs1166211536 214 dbSNP
rs1383270104 216 dbSNP
rs536026067 219 dbSNP
rs1249281793 220 dbSNP
rs577837728 222 dbSNP
rs1239195305 223 dbSNP
rs1262092989 224 dbSNP
rs1459070527 226 dbSNP
rs1208481660 227 dbSNP
rs753236238 228 dbSNP
rs1462942748 230 dbSNP
rs1180586188 235 dbSNP
rs913594829 239 dbSNP
rs1250867728 241 dbSNP
rs553338622 243 dbSNP
rs541401765 250 dbSNP
rs574103832 251 dbSNP
rs1034564302 254 dbSNP
rs1177424856 259 dbSNP
rs72548716 267 dbSNP
rs72548717 269 dbSNP
rs570170452 271 dbSNP
rs994198711 273 dbSNP
rs946690282 277 dbSNP
rs1017438369 280 dbSNP
rs1227330369 281 dbSNP
rs921842453 282 dbSNP
rs1283566609 285 dbSNP
rs558063028 286 dbSNP
rs887620870 291 dbSNP
rs966259734 295 dbSNP
rs1481278170 296 dbSNP
rs911699500 296 dbSNP
rs1050283416 298 dbSNP
rs983521021 306 dbSNP
rs1472323483 309 dbSNP
rs1200344952 315 dbSNP
rs950760740 321 dbSNP
rs1434654079 334 dbSNP
rs868705055 339 dbSNP
rs1390918153 342 dbSNP
rs901797779 344 dbSNP
rs1358495778 348 dbSNP
rs1294914944 351 dbSNP
rs1040006244 354 dbSNP
rs1451245650 355 dbSNP
rs550455934 356 dbSNP
rs1299824233 357 dbSNP
rs4331700 362 dbSNP
rs1368120174 367 dbSNP
rs945740914 380 dbSNP
rs1027622043 381 dbSNP
rs866818344 382 dbSNP
rs372065817 386 dbSNP
rs566210911 391 dbSNP
rs1300945732 398 dbSNP
rs1023621563 402 dbSNP
rs746478791 411 dbSNP
rs1273131528 416 dbSNP
rs777401016 417 dbSNP
rs66753817 418 dbSNP
rs999283883 426 dbSNP
rs186981433 437 dbSNP
rs1487662636 438 dbSNP
rs1190843140 451 dbSNP
rs778799438 454 dbSNP
rs1244087524 455 dbSNP
rs1428936615 462 dbSNP
rs1170361721 471 dbSNP
rs1269272927 477 dbSNP
rs1428506951 482 dbSNP
rs68194015 483 dbSNP
rs67881446 485 dbSNP
rs67889588 486 dbSNP
rs1292612173 493 dbSNP
rs1363033967 494 dbSNP
rs753706144 495 dbSNP
rs1217464059 506 dbSNP
rs1384323833 511 dbSNP
rs372898074 511 dbSNP
rs111356766 513 dbSNP
rs527817915 514 dbSNP
rs911727101 515 dbSNP
rs1246789218 522 dbSNP
rs983217098 523 dbSNP
rs929429164 525 dbSNP
rs1376763132 532 dbSNP
rs1221063529 544 dbSNP
rs1242942073 549 dbSNP
rs920678672 558 dbSNP
rs1486060781 579 dbSNP
rs1006069835 585 dbSNP
rs1246099167 586 dbSNP
rs375571367 587 dbSNP
rs973453267 590 dbSNP
rs970451838 591 dbSNP
rs1022937900 595 dbSNP
rs1164134038 601 dbSNP
rs1327216598 604 dbSNP
rs993505352 606 dbSNP
rs779834006 607 dbSNP
rs1403118372 609 dbSNP
rs954181112 622 dbSNP
rs1380133490 630 dbSNP
rs4331699 633 dbSNP
rs1028771676 634 dbSNP
rs1031878250 638 dbSNP
rs756130454 639 dbSNP
rs1364944772 645 dbSNP
rs562910651 649 dbSNP
rs1298213514 651 dbSNP
rs543387816 654 dbSNP
rs565055074 666 dbSNP
rs1373163484 670 dbSNP
rs1171913652 678 dbSNP
rs750461865 683 dbSNP
rs1009869521 687 dbSNP
rs927702542 697 dbSNP
rs181105632 700 dbSNP
rs1379121009 715 dbSNP
rs551271791 718 dbSNP
rs980568648 719 dbSNP
rs1184071630 732 dbSNP
rs1190797666 734 dbSNP
rs1239186703 735 dbSNP
rs935730842 740 dbSNP
rs927057141 745 dbSNP
rs1022449010 749 dbSNP
rs969264980 750 dbSNP
rs72548718 752 dbSNP
rs1262755799 753 dbSNP
rs1194390787 757 dbSNP
rs1458437081 762 dbSNP
rs900182872 773 dbSNP
rs1038656469 774 dbSNP
rs1489307696 775 dbSNP
rs1278352851 777 dbSNP
rs917471646 778 dbSNP
rs944636252 784 dbSNP
rs1296083699 788 dbSNP
rs1346369460 792 dbSNP
rs559658169 793 dbSNP
rs1357971194 798 dbSNP
rs973409477 801 dbSNP
rs1447388765 803 dbSNP
rs1280150501 810 dbSNP
rs773372138 817 dbSNP
rs890366617 825 dbSNP
rs1258087320 829 dbSNP
rs761963731 830 dbSNP
rs1204106059 838 dbSNP
rs961378767 844 dbSNP
rs188729062 845 dbSNP
rs1209353277 855 dbSNP
rs1278438875 856 dbSNP
rs751805152 863 dbSNP
rs929124991 864 dbSNP
rs984168678 869 dbSNP
rs148679423 871 dbSNP
rs973910428 872 dbSNP
rs764405097 876 dbSNP
rs183675338 877 dbSNP
rs915900379 880 dbSNP
rs1414331690 883 dbSNP
rs965857168 886 dbSNP
rs77368793 895 dbSNP
rs1408128078 896 dbSNP
rs1010587753 897 dbSNP
rs1346461995 907 dbSNP
rs1233686451 916 dbSNP
rs891734411 932 dbSNP
rs1424155387 933 dbSNP
rs1218535837 935 dbSNP
rs1273656642 947 dbSNP
rs1194636756 949 dbSNP
rs960316954 951 dbSNP
rs1478950799 954 dbSNP
rs1031909329 955 dbSNP
rs1186965017 976 dbSNP
rs1443442682 980 dbSNP
rs977613655 984 dbSNP
rs968886011 990 dbSNP
rs1376239101 991 dbSNP
rs2037547 1020 dbSNP
rs1317671379 1022 dbSNP
rs180780479 1024 dbSNP
rs189300766 1030 dbSNP
rs1220053954 1036 dbSNP
rs1427897627 1039 dbSNP
rs75575079 1040 dbSNP
rs1366286606 1043 dbSNP
rs950169610 1048 dbSNP
rs879149084 1050 dbSNP
rs1017724631 1072 dbSNP
rs760157379 1078 dbSNP
rs890397598 1085 dbSNP
rs1329089477 1091 dbSNP
rs539619910 1104 dbSNP
rs1047626466 1114 dbSNP
rs1298208268 1117 dbSNP
rs572310715 1121 dbSNP
rs1273215083 1123 dbSNP
rs1446017332 1126 dbSNP
rs1400727540 1127 dbSNP
rs910172421 1129 dbSNP
rs762910410 1132 dbSNP
rs1194422394 1134 dbSNP
rs79610052 1136 dbSNP
rs1448139754 1138 dbSNP
rs1411918304 1139 dbSNP
rs921311163 1142 dbSNP
rs976817421 1144 dbSNP
rs1459531554 1158 dbSNP
rs867184088 1159 dbSNP
rs1037501386 1164 dbSNP
rs1390341164 1167 dbSNP
rs1473165592 1170 dbSNP
rs772531912 1176 dbSNP
rs1370333760 1177 dbSNP
rs185646830 1178 dbSNP
rs1296806466 1180 dbSNP
rs915994879 1187 dbSNP
rs1019174195 1194 dbSNP
rs1246395054 1201 dbSNP
rs988689229 1202 dbSNP
rs562504663 1203 dbSNP
rs1032968794 1204 dbSNP
rs1270337116 1205 dbSNP
rs1463848362 1206 dbSNP
rs774114917 1208 dbSNP
rs1244349745 1216 dbSNP
rs1425601258 1218 dbSNP
rs905540719 1222 dbSNP
rs568461110 1226 dbSNP
rs924576839 1227 dbSNP
rs977685655 1232 dbSNP
rs746961563 1239 dbSNP
rs1022698559 1240 dbSNP
rs1390497199 1252 dbSNP
rs1013995732 1254 dbSNP
rs914730648 1258 dbSNP
rs1319768419 1265 dbSNP
rs1402904487 1282 dbSNP
rs895596547 1283 dbSNP
rs1309886008 1286 dbSNP
rs112822116 1295 dbSNP
rs1228580704 1297 dbSNP
rs548548313 1298 dbSNP
rs1466815300 1303 dbSNP
rs1289858366 1305 dbSNP
rs975602388 1307 dbSNP
rs1327497099 1311 dbSNP
rs150696846 1312 dbSNP
rs199790427 1312 dbSNP
rs964859621 1312 dbSNP
rs940244202 1314 dbSNP
rs1228594763 1316 dbSNP
rs888659172 1316 dbSNP
rs1357831465 1319 dbSNP
rs1277309849 1320 dbSNP
rs1239294234 1321 dbSNP
rs1017292182 1329 dbSNP
rs144189446 1332 dbSNP
rs954392403 1333 dbSNP
rs1025914238 1348 dbSNP
rs1438450460 1360 dbSNP
rs993378810 1373 dbSNP
rs1301046355 1374 dbSNP
rs1400816518 1376 dbSNP
rs149350172 1383 dbSNP
rs370827005 1390 dbSNP
rs1323128683 1394 dbSNP
rs1309439448 1402 dbSNP
rs1406223348 1411 dbSNP
rs1037978129 1412 dbSNP
rs1012734252 1413 dbSNP
rs1314317953 1415 dbSNP
rs1231663590 1429 dbSNP
rs542954663 1433 dbSNP
rs1483402786 1436 dbSNP
rs1207461706 1442 dbSNP
rs749019183 1450 dbSNP
rs944112240 1452 dbSNP
rs1156965026 1453 dbSNP
rs1267738455 1455 dbSNP
rs1434710367 1459 dbSNP
rs1439569128 1460 dbSNP
rs914023080 1466 dbSNP
rs532936566 1467 dbSNP
rs989048281 1480 dbSNP
rs938723510 1484 dbSNP
rs1180827661 1486 dbSNP
rs1408773193 1486 dbSNP
rs73175828 1491 dbSNP
rs1370124867 1492 dbSNP
rs1041704196 1493 dbSNP
rs1221814074 1498 dbSNP
rs1453008925 1501 dbSNP
rs1301179338 1527 dbSNP
rs947658729 1530 dbSNP
rs1231271652 1544 dbSNP
rs745533289 1545 dbSNP
rs1215280367 1546 dbSNP
rs1272482507 1550 dbSNP
rs1354249340 1560 dbSNP
rs1311369811 1561 dbSNP
rs914829801 1579 dbSNP
rs1222520276 1585 dbSNP
rs755934268 1586 dbSNP
rs1489322187 1587 dbSNP
rs978694516 1596 dbSNP
rs1366617832 1599 dbSNP
rs1252283099 1601 dbSNP
rs964232790 1603 dbSNP
rs912703467 1604 dbSNP
rs1437408182 1606 dbSNP
rs1387746253 1611 dbSNP
rs1351857693 1615 dbSNP
rs547650596 1617 dbSNP
rs1022626454 1624 dbSNP
rs529196619 1631 dbSNP
rs1456699018 1633 dbSNP
rs1013964355 1664 dbSNP
rs745829372 1674 dbSNP
rs1025945315 1675 dbSNP
rs1004753366 1685 dbSNP
rs781202840 1686 dbSNP
rs963649284 1691 dbSNP
rs1272241069 1692 dbSNP
rs1465209357 1693 dbSNP
rs561988591 1694 dbSNP
rs61570807 1701 dbSNP
rs1210463888 1705 dbSNP
rs888632569 1707 dbSNP
rs1048603042 1708 dbSNP
rs997034937 1709 dbSNP
rs1016168357 1713 dbSNP
rs34679567 1714 dbSNP
rs55910624 1714 dbSNP
rs1181992626 1716 dbSNP
rs1238758155 1719 dbSNP
rs1415347500 1728 dbSNP
rs1421620476 1731 dbSNP
rs1163798334 1733 dbSNP
rs1192167264 1734 dbSNP
rs894325640 1736 dbSNP
rs576408117 1747 dbSNP
rs1035481961 1748 dbSNP
rs1345188913 1761 dbSNP
rs1192574787 1767 dbSNP
rs756771200 1773 dbSNP
rs751682402 1777 dbSNP
rs764282374 1778 dbSNP
rs758704825 1783 dbSNP
rs1227920779 1784 dbSNP
rs944081264 1785 dbSNP
rs1207899572 1790 dbSNP
rs1002964087 1792 dbSNP
rs1052544865 1796 dbSNP
rs934466020 1797 dbSNP
rs1279011611 1805 dbSNP
rs1238659705 1806 dbSNP
rs903258848 1809 dbSNP
rs1220751209 1814 dbSNP
rs1041781236 1815 dbSNP
rs947394388 1818 dbSNP
rs1412306121 1822 dbSNP
rs1347545466 1825 dbSNP
rs893408743 1830 dbSNP
rs753000462 1831 dbSNP
rs1039970931 1835 dbSNP
rs942923784 1836 dbSNP
rs912734539 1840 dbSNP
rs978620991 1841 dbSNP
rs986895955 1851 dbSNP
rs915871337 1852 dbSNP
rs1352618699 1856 dbSNP
rs1226807409 1861 dbSNP
rs1286150311 1864 dbSNP
rs1349726162 1875 dbSNP
rs1219685288 1883 dbSNP
rs1341183063 1891 dbSNP
rs1300155412 1893 dbSNP
rs992457712 1894 dbSNP
rs1309901454 1896 dbSNP
rs1209613996 1898 dbSNP
rs562276586 1901 dbSNP
rs933106366 1913 dbSNP
rs1483799964 1921 dbSNP
rs564379157 1926 dbSNP
rs1177161874 1927 dbSNP
rs918988612 1950 dbSNP
rs1478575815 1955 dbSNP
rs1174810955 1971 dbSNP
rs1423736413 1976 dbSNP
rs972168294 1978 dbSNP
rs1434165047 1980 dbSNP
rs765640095 1981 dbSNP
rs1372487973 1982 dbSNP
rs138830070 1987 dbSNP
rs572247483 1990 dbSNP
rs1328458211 1992 dbSNP
rs1015728405 1997 dbSNP
rs145047652 1998 dbSNP
rs1436979655 1999 dbSNP
rs1003982390 2024 dbSNP
rs759904996 2034 dbSNP
rs1368771324 2037 dbSNP
rs952592464 2044 dbSNP
rs1027096315 2045 dbSNP
rs1343721905 2051 dbSNP
rs1016319346 2059 dbSNP
rs878917813 2062 dbSNP
rs1452523384 2065 dbSNP
rs1201555110 2078 dbSNP
rs1477967699 2082 dbSNP
rs193147776 2084 dbSNP
rs142829558 2099 dbSNP
rs188475324 2102 dbSNP
rs1427958941 2104 dbSNP
rs1167524355 2106 dbSNP
rs958576620 2109 dbSNP
rs1035554424 2120 dbSNP
rs1482853011 2121 dbSNP
rs536612926 2124 dbSNP
rs771322058 2134 dbSNP
rs1368531154 2141 dbSNP
rs1212233043 2142 dbSNP
rs900091559 2145 dbSNP
rs1366699808 2146 dbSNP
rs1224669046 2155 dbSNP
rs1269210906 2159 dbSNP
rs1002702170 2161 dbSNP
rs1041283447 2165 dbSNP
rs903294380 2166 dbSNP
rs1211283502 2178 dbSNP
rs567154860 2182 dbSNP
rs1008617259 2183 dbSNP
rs1468345646 2184 dbSNP
rs138341826 2192 dbSNP
rs1052888843 2194 dbSNP
rs1447719915 2199 dbSNP
rs1012047372 2203 dbSNP
rs1257238545 2204 dbSNP
rs1192650012 2207 dbSNP
rs893156029 2207 dbSNP
rs539508225 2208 dbSNP
rs1040072128 2218 dbSNP
rs1394372625 2222 dbSNP
rs753331328 2228 dbSNP
rs1378625660 2234 dbSNP
rs1460761896 2249 dbSNP
rs565824184 2251 dbSNP
rs1042910231 2257 dbSNP
rs1390814879 2260 dbSNP
rs1380017832 2262 dbSNP
rs1316953222 2272 dbSNP
rs1340578206 2275 dbSNP
rs1303924820 2281 dbSNP
rs368437717 2282 dbSNP
rs767031216 2290 dbSNP
rs942974838 2294 dbSNP
rs1334589402 2302 dbSNP
rs761384782 2307 dbSNP
rs150443898 2308 dbSNP
rs992755091 2311 dbSNP
rs1256891020 2313 dbSNP
rs1444228596 2318 dbSNP
rs568337523 2326 dbSNP
rs959948673 2328 dbSNP
rs553626468 2329 dbSNP
rs1474748926 2340 dbSNP
rs1159711149 2342 dbSNP
rs1413927565 2357 dbSNP
rs184371124 2358 dbSNP
rs763625858 2359 dbSNP
rs1422723006 2363 dbSNP
rs533878456 2364 dbSNP
rs918726458 2368 dbSNP
rs1402259185 2369 dbSNP
rs1397320276 2378 dbSNP
rs1310686053 2381 dbSNP
rs1183500030 2383 dbSNP
rs1191943008 2387 dbSNP
rs1354501527 2387 dbSNP
rs1290534042 2388 dbSNP
rs1456414884 2389 dbSNP
rs971856845 2393 dbSNP
rs1238910183 2394 dbSNP
rs1237295407 2396 dbSNP
rs952486283 2400 dbSNP
rs140556617 2401 dbSNP
rs1252360795 2407 dbSNP
rs557887560 2419 dbSNP
rs1378193784 2420 dbSNP
rs964188846 2420 dbSNP
rs1467129226 2421 dbSNP
rs1171124525 2427 dbSNP
rs1236159850 2428 dbSNP
rs1374334098 2428 dbSNP
rs908885017 2433 dbSNP
rs1019801143 2435 dbSNP
rs1482117414 2435 dbSNP
rs1391226583 2436 dbSNP
rs1302567475 2437 dbSNP
rs1333396023 2437 dbSNP
rs1491197380 2437 dbSNP
rs1207527607 2438 dbSNP
rs1249884712 2439 dbSNP
rs991552319 2439 dbSNP
rs958648681 2441 dbSNP
rs564497950 2443 dbSNP
rs1313582391 2447 dbSNP
rs1455488880 2449 dbSNP
rs1191692540 2451 dbSNP
rs1393913826 2455 dbSNP
rs774061989 2456 dbSNP
rs10546859 2459 dbSNP
rs1172056629 2459 dbSNP
rs1293699878 2459 dbSNP
rs1294414508 2459 dbSNP
rs143120054 2459 dbSNP
rs1453558817 2459 dbSNP
rs1461789757 2459 dbSNP
rs3835183 2459 dbSNP
rs56707568 2459 dbSNP
rs71729209 2459 dbSNP
rs780616760 2459 dbSNP
rs892740324 2460 dbSNP
rs1030993937 2466 dbSNP
rs928520401 2469 dbSNP
rs981303968 2473 dbSNP
rs1211707024 2483 dbSNP
rs1252351045 2483 dbSNP
rs1331033844 2484 dbSNP
rs1187829474 2490 dbSNP
rs967219096 2492 dbSNP
rs1427491802 2498 dbSNP
rs1020514874 2504 dbSNP
rs1165083114 2511 dbSNP
rs1420438998 2512 dbSNP
rs1447988444 2515 dbSNP
rs1399165804 2526 dbSNP
rs948508389 2530 dbSNP
rs1291416291 2536 dbSNP
rs1437910483 2549 dbSNP
rs1287132402 2550 dbSNP
rs1011664202 2559 dbSNP
rs545925425 2564 dbSNP
rs1229063395 2567 dbSNP
rs1315153640 2567 dbSNP
rs1361390142 2567 dbSNP
rs151325099 2590 dbSNP
rs1457136481 2595 dbSNP
rs1349919490 2606 dbSNP
rs560247801 2609 dbSNP
rs1166326626 2612 dbSNP
rs1217874969 2612 dbSNP
rs1239808901 2614 dbSNP
rs1485284476 2616 dbSNP
rs201745461 2628 dbSNP
rs938597050 2634 dbSNP
rs1323241387 2641 dbSNP
rs1474430380 2643 dbSNP
rs1164578200 2651 dbSNP
rs1413181392 2652 dbSNP
rs1018310915 2656 dbSNP
rs1402903343 2659 dbSNP
rs1157595693 2661 dbSNP
rs1379626269 2665 dbSNP
rs1448907508 2666 dbSNP
rs1179255940 2684 dbSNP
rs1353870475 2685 dbSNP
rs1441303661 2691 dbSNP
rs1265069245 2693 dbSNP
rs1006843665 2695 dbSNP
rs1329627088 2696 dbSNP
rs1488297347 2699 dbSNP
rs1266058463 2707 dbSNP
rs982465868 2713 dbSNP
rs1315801945 2721 dbSNP
rs1210295472 2728 dbSNP
rs1352062416 2732 dbSNP
rs930982660 2734 dbSNP
rs768185318 2735 dbSNP
rs748971212 2736 dbSNP
rs1241575351 2738 dbSNP
rs541984133 2751 dbSNP
rs775086093 2753 dbSNP
rs1051299278 2761 dbSNP
rs1407966649 2762 dbSNP
rs1337881626 2765 dbSNP
rs35607137 2766 dbSNP
rs994354970 2766 dbSNP
rs1175521020 2767 dbSNP
rs975151590 2770 dbSNP
rs963788394 2771 dbSNP
rs897331108 2780 dbSNP
rs1308896293 2781 dbSNP
rs1038908376 2784 dbSNP
rs1444194726 2786 dbSNP
rs191540673 2788 dbSNP
rs1372448415 2790 dbSNP
rs879581460 2806 dbSNP
rs941822609 2809 dbSNP
rs908950304 2824 dbSNP
rs1281784324 2827 dbSNP
rs1385833394 2829 dbSNP
rs1055487105 2836 dbSNP
rs1345158197 2842 dbSNP
rs1367891017 2846 dbSNP
rs576615064 2847 dbSNP
rs1417319302 2848 dbSNP
rs1000840832 2859 dbSNP
rs1232664531 2859 dbSNP
rs1478608587 2861 dbSNP
rs570898588 2863 dbSNP
rs1393298654 2866 dbSNP
rs981376059 2867 dbSNP
rs76949365 2868 dbSNP
rs1012317237 2869 dbSNP
rs1023699327 2869 dbSNP
rs1353732569 2869 dbSNP
rs1421486437 2870 dbSNP
rs1305589981 2871 dbSNP
rs1441496754 2871 dbSNP
rs1368122103 2872 dbSNP
rs1375681560 2874 dbSNP
rs1270403968 2875 dbSNP
rs1197932268 2877 dbSNP
rs1340957441 2884 dbSNP
rs1193728091 2897 dbSNP
rs1272678761 2901 dbSNP
rs1452576955 2905 dbSNP
rs114395791 2907 dbSNP
rs1468091609 2909 dbSNP
rs745755497 2911 dbSNP
rs1374880028 2913 dbSNP
rs55644728 2919 dbSNP
rs886990783 2920 dbSNP
rs1418492594 2922 dbSNP
rs878883329 2924 dbSNP
rs1327822533 2929 dbSNP
rs1461812930 2929 dbSNP
rs1487340536 2933 dbSNP
rs1392283089 2934 dbSNP
rs1047430851 2937 dbSNP
rs930951798 2943 dbSNP
rs1327701653 2945 dbSNP
rs565762822 2952 dbSNP
rs1335897475 2953 dbSNP
rs763283420 2962 dbSNP
rs1235604408 2963 dbSNP
rs553934048 2969 dbSNP
rs773458587 2971 dbSNP
rs1334708312 2972 dbSNP
rs975077766 2978 dbSNP
rs1263897271 2993 dbSNP
rs1006900667 2995 dbSNP
rs1192718923 2997 dbSNP
rs1238324770 2998 dbSNP
rs1475409471 3000 dbSNP
rs955392340 3009 dbSNP
rs1166742450 3013 dbSNP
rs1415410214 3027 dbSNP
rs1353504047 3031 dbSNP
rs1029577537 3032 dbSNP
rs765415143 3039 dbSNP
rs1232999597 3044 dbSNP
rs187094684 3045 dbSNP
rs1355627991 3053 dbSNP
rs1416263832 3071 dbSNP
rs1291770395 3081 dbSNP
rs568256672 3083 dbSNP
rs757238562 3089 dbSNP
rs1240350899 3090 dbSNP
rs957102207 3094 dbSNP
rs924189952 3096 dbSNP
rs747082607 3104 dbSNP
rs549752275 3105 dbSNP
rs1281132055 3106 dbSNP
rs777900007 3109 dbSNP
rs1038570931 3114 dbSNP
rs1006113695 3118 dbSNP
rs1255082927 3119 dbSNP
rs1335607928 3134 dbSNP
rs1182405310 3138 dbSNP
rs551051319 3142 dbSNP
rs1055569164 3149 dbSNP
rs1012286147 3155 dbSNP
rs960776791 3169 dbSNP
rs937052418 3174 dbSNP
rs762123336 3175 dbSNP
rs758486911 3176 dbSNP
rs1436154209 3177 dbSNP
rs1310739623 3179 dbSNP
rs1298317511 3185 dbSNP
rs1355203240 3190 dbSNP
rs1392395316 3195 dbSNP
rs945982237 3196 dbSNP
rs570682812 3198 dbSNP
rs990023668 3200 dbSNP
rs865914219 3205 dbSNP
rs1304193568 3209 dbSNP
rs1171714363 3212 dbSNP
rs911034088 3216 dbSNP
rs886955236 3218 dbSNP
rs985511005 3222 dbSNP
rs955422778 3227 dbSNP
rs1029650863 3228 dbSNP
rs972704640 3234 dbSNP
rs961672591 3248 dbSNP
rs1177974939 3251 dbSNP
rs1395130078 3252 dbSNP
rs552528462 3254 dbSNP
rs995371392 3260 dbSNP
rs1171352861 3261 dbSNP
rs182635086 3263 dbSNP
rs1462181688 3265 dbSNP
rs1039342814 3266 dbSNP
rs1394810730 3268 dbSNP
rs1391277289 3269 dbSNP
rs1304855604 3270 dbSNP
rs141933496 3270 dbSNP
rs746668687 3270 dbSNP
rs748695218 3270 dbSNP
rs942374439 3270 dbSNP
rs1308243161 3273 dbSNP
rs1229920332 3275 dbSNP
rs1252815497 3276 dbSNP
rs1479559658 3279 dbSNP
rs531342874 3286 dbSNP
rs1005775002 3287 dbSNP
rs190976553 3303 dbSNP
rs895324816 3309 dbSNP
rs752980525 3311 dbSNP
rs541922473 3312 dbSNP
rs765472399 3313 dbSNP
rs1469417037 3315 dbSNP
rs530191019 3316 dbSNP
rs1423870395 3322 dbSNP
rs924084001 3323 dbSNP
rs906944222 3329 dbSNP
rs187749667 3330 dbSNP
rs3732361 3338 dbSNP
rs184049790 3346 dbSNP
rs916873138 3347 dbSNP
rs1316945873 3349 dbSNP
rs1439362277 3356 dbSNP
rs1325250601 3360 dbSNP
rs990778568 3360 dbSNP
rs960997973 3361 dbSNP
rs1035081716 3364 dbSNP
rs1338259094 3365 dbSNP
rs891741052 3368 dbSNP
rs754300042 3370 dbSNP
rs1217856669 3374 dbSNP
rs935894208 3379 dbSNP
rs911062082 3380 dbSNP
rs559019438 3381 dbSNP
rs1211763538 3382 dbSNP
rs985252290 3388 dbSNP
rs1245582287 3396 dbSNP
rs1485931510 3405 dbSNP
rs768866398 3408 dbSNP
rs934115114 3414 dbSNP
rs1477695759 3419 dbSNP
rs922668950 3426 dbSNP
rs972735759 3428 dbSNP
rs545789563 3431 dbSNP
rs1396585436 3436 dbSNP
rs567851200 3437 dbSNP
rs1420507610 3439 dbSNP
rs56728675 3445 dbSNP
rs761327560 3450 dbSNP
rs1164746470 3453 dbSNP
rs553864511 3455 dbSNP
rs995340328 3474 dbSNP
rs535537573 3476 dbSNP
rs1423193397 3480 dbSNP
rs1033881463 3489 dbSNP
rs1476428121 3490 dbSNP
rs1415639824 3494 dbSNP
rs775638899 3498 dbSNP
rs1039606132 3504 dbSNP
rs1006485590 3507 dbSNP
rs890807594 3509 dbSNP
rs60393216 3511 dbSNP
rs1316968785 3513 dbSNP
rs763672291 3514 dbSNP
rs906976668 3517 dbSNP
rs1188257879 3521 dbSNP
rs556302460 3522 dbSNP
rs916799619 3530 dbSNP
rs946869339 3530 dbSNP
rs1009964147 3541 dbSNP
rs1402959567 3545 dbSNP
rs939342765 3546 dbSNP
rs1360004068 3559 dbSNP
rs571261034 3560 dbSNP
rs1197159924 3564 dbSNP
rs1377025618 3564 dbSNP
rs1445613985 3565 dbSNP
rs891457558 3566 dbSNP
rs1456991829 3577 dbSNP
rs373481195 3584 dbSNP
rs1197245868 3586 dbSNP
rs983506037 3605 dbSNP
rs1000554467 3607 dbSNP
rs1352396321 3623 dbSNP
rs1211136441 3624 dbSNP
rs1353615303 3627 dbSNP
rs1283132400 3631 dbSNP
rs1209774562 3634 dbSNP
rs1245376488 3634 dbSNP
rs1384935507 3636 dbSNP
rs537681129 3637 dbSNP
rs1471413386 3643 dbSNP
rs1176016151 3654 dbSNP
rs1379734408 3657 dbSNP
rs1454801537 3658 dbSNP
rs950860732 3671 dbSNP
rs1027698632 3672 dbSNP
rs1049570098 3678 dbSNP
rs1354929927 3680 dbSNP
rs1444261119 3685 dbSNP
rs1329290785 3686 dbSNP
rs762461832 3692 dbSNP
rs933811952 3700 dbSNP
rs1345225331 3701 dbSNP
rs922409212 3722 dbSNP
rs1400846881 3729 dbSNP
rs1018125576 3739 dbSNP
rs546908086 3739 dbSNP
rs59824213 3739 dbSNP
rs1468959519 3751 dbSNP
rs1411909109 3752 dbSNP
rs1195501503 3764 dbSNP
rs1006746861 3769 dbSNP
rs373001600 3770 dbSNP
rs1168757060 3773 dbSNP
rs1388625607 3775 dbSNP
rs1411515174 3785 dbSNP
rs1168441191 3788 dbSNP
rs1037543739 3797 dbSNP
rs1441564493 3799 dbSNP
rs940082411 3802 dbSNP
rs1162766502 3812 dbSNP
rs1435269360 3816 dbSNP
rs551471417 3817 dbSNP
rs1341895596 3825 dbSNP
rs984132669 3826 dbSNP
rs999237662 3829 dbSNP
rs1336025200 3834 dbSNP
rs902219431 3836 dbSNP
rs959930255 3843 dbSNP
rs1251187679 3845 dbSNP
rs1439460118 3857 dbSNP
rs191981565 3860 dbSNP
rs946839872 3865 dbSNP
rs1474554494 3866 dbSNP
rs895335372 3867 dbSNP
rs1206144132 3868 dbSNP
rs1461861259 3869 dbSNP
rs982307108 3870 dbSNP
rs1404301817 3874 dbSNP
rs1318557789 3877 dbSNP
rs928276307 3882 dbSNP
rs1397763358 3889 dbSNP
rs983817609 3891 dbSNP
rs185949833 3911 dbSNP
rs920649328 3926 dbSNP
rs1021093550 3930 dbSNP
rs1361420089 3932 dbSNP
rs1283788082 3933 dbSNP
rs1010408076 3935 dbSNP
rs1239405366 3963 dbSNP
rs973475674 3965 dbSNP
rs955807786 3967 dbSNP
rs181660262 3968 dbSNP
rs1193259459 3969 dbSNP
rs1018047047 3974 dbSNP
rs1475439169 3978 dbSNP
rs999843932 3984 dbSNP
rs1366711554 3986 dbSNP
rs955470685 3988 dbSNP
rs1158581459 3993 dbSNP
rs1029584771 3995 dbSNP
rs1386522605 4012 dbSNP
rs1322895427 4015 dbSNP
rs1417434926 4018 dbSNP
rs755322116 4025 dbSNP
rs1376432042 4040 dbSNP
rs999564666 4044 dbSNP
rs1157363071 4046 dbSNP
rs1340336621 4050 dbSNP
rs1240422304 4053 dbSNP
rs1281316447 4056 dbSNP
rs1351653463 4058 dbSNP
rs1216131270 4071 dbSNP
rs902195486 4084 dbSNP
rs1485871981 4091 dbSNP
rs1201893999 4094 dbSNP
rs1409121946 4095 dbSNP
rs889726395 4098 dbSNP
rs1049643841 4100 dbSNP
rs1441722129 4100 dbSNP
rs1476804136 4100 dbSNP
rs1182475610 4108 dbSNP
rs1010642673 4111 dbSNP
rs1437343531 4117 dbSNP
rs548217221 4131 dbSNP
rs775240907 4137 dbSNP
rs1225056368 4140 dbSNP
rs1199776612 4156 dbSNP
rs901017331 4157 dbSNP
rs1490692773 4163 dbSNP
rs894931232 4169 dbSNP
rs1301414962 4178 dbSNP
rs531704076 4192 dbSNP
rs143580214 4193 dbSNP
rs562730841 4198 dbSNP
rs909965907 4200 dbSNP
rs1392451933 4201 dbSNP
rs1331516614 4203 dbSNP
rs1048898425 4208 dbSNP
rs937982003 4222 dbSNP
rs926582772 4228 dbSNP
rs1374741412 4231 dbSNP
rs982362569 4232 dbSNP
rs1317474412 4244 dbSNP
rs1350251388 4255 dbSNP
rs906743514 4258 dbSNP
rs1047987987 4259 dbSNP
rs929273336 4260 dbSNP
rs920575587 4264 dbSNP
rs1286020204 4286 dbSNP
rs1037692469 4287 dbSNP
rs1217268662 4288 dbSNP
rs970934079 4291 dbSNP
rs1344123848 4293 dbSNP
rs1173574030 4295 dbSNP
rs562867275 4296 dbSNP
rs568834787 4299 dbSNP
rs1274474434 4301 dbSNP
rs1405836245 4305 dbSNP
rs1462866622 4309 dbSNP
rs1170140307 4311 dbSNP
rs111478298 4314 dbSNP
rs533955904 4320 dbSNP
rs914090473 4321 dbSNP
rs1398651607 4323 dbSNP
rs190739224 4325 dbSNP
rs1296453993 4341 dbSNP
rs985660838 4343 dbSNP
rs955243444 4344 dbSNP
rs565528731 4345 dbSNP
rs1413113777 4347 dbSNP
rs1227807981 4348 dbSNP
rs1273239463 4353 dbSNP
rs966641605 4353 dbSNP
rs978053654 4353 dbSNP
rs1032746707 4356 dbSNP
rs1021956114 4357 dbSNP
rs1266312829 4358 dbSNP
rs1000323499 4361 dbSNP
rs1010615089 4363 dbSNP
rs1196221868 4363 dbSNP
rs959071407 4367 dbSNP
rs1166337326 4368 dbSNP
rs1281761502 4380 dbSNP
rs1033441699 4382 dbSNP
rs1456516798 4388 dbSNP
rs1331331735 4390 dbSNP
rs1362853560 4391 dbSNP
rs1384158322 4401 dbSNP
rs1004089849 4404 dbSNP
rs540938969 4409 dbSNP
rs1217914795 4411 dbSNP
rs1293897645 4414 dbSNP
rs953729758 4416 dbSNP
rs1322990683 4422 dbSNP
rs1218652541 4432 dbSNP
rs1264360667 4438 dbSNP
rs548888073 4439 dbSNP
rs1218376867 4440 dbSNP
rs1048383605 4447 dbSNP
rs573623417 4458 dbSNP
rs998067373 4464 dbSNP
rs993696434 4475 dbSNP
rs901092415 4481 dbSNP
rs1189250196 4482 dbSNP
rs1260349211 4487 dbSNP
rs1422598102 4494 dbSNP
rs899456727 4498 dbSNP
rs1345897173 4502 dbSNP
rs1486118127 4503 dbSNP
rs1243771834 4509 dbSNP
rs1358380204 4511 dbSNP
rs1399237292 4512 dbSNP
rs1037666134 4515 dbSNP
rs904713228 4517 dbSNP
rs1381178024 4518 dbSNP
rs1226556850 4519 dbSNP
rs1311337183 4520 dbSNP
rs185634268 4522 dbSNP
rs943377511 4522 dbSNP
rs1441611012 4523 dbSNP
rs1263576171 4524 dbSNP
rs1224311833 4525 dbSNP
rs1325953974 4526 dbSNP
rs910604197 4530 dbSNP
rs1276321431 4532 dbSNP
rs1214067141 4533 dbSNP
rs1362825563 4542 dbSNP
rs1004031772 4543 dbSNP
rs142080058 4543 dbSNP
rs369943074 4544 dbSNP
rs1181833267 4545 dbSNP
rs1408785118 4545 dbSNP
rs1441688995 4545 dbSNP
rs71156775 4545 dbSNP
rs757260908 4545 dbSNP
rs888556754 4545 dbSNP
rs1376974316 4547 dbSNP
rs1448435429 4555 dbSNP
rs922444129 4555 dbSNP
rs1352467633 4556 dbSNP
rs978358864 4571 dbSNP
rs1048487903 4573 dbSNP
rs1234610135 4580 dbSNP
rs1331395711 4585 dbSNP
rs1446522509 4597 dbSNP
rs966614426 4598 dbSNP
rs938055305 4602 dbSNP
rs529049697 4606 dbSNP
rs915164744 4612 dbSNP
rs1459482615 4621 dbSNP
rs1046422881 4624 dbSNP
rs1470720718 4628 dbSNP
rs1491416049 4629 dbSNP
rs1491245347 4630 dbSNP
rs1454839669 4631 dbSNP
rs1169603625 4632 dbSNP
rs549078113 4634 dbSNP
rs1428580853 4635 dbSNP
rs989111007 4654 dbSNP
rs949656129 4655 dbSNP
rs1472443386 4658 dbSNP
rs747442101 4658 dbSNP
rs1491031592 4659 dbSNP
rs397965366 4659 dbSNP
rs1328638134 4660 dbSNP
rs1375571085 4661 dbSNP
rs1205345869 4662 dbSNP
rs1274162884 4668 dbSNP
rs1436727647 4668 dbSNP
rs59156758 4668 dbSNP
rs1257467329 4669 dbSNP
rs1491199386 4669 dbSNP
rs1491533469 4670 dbSNP
rs914139556 4672 dbSNP
rs988742231 4678 dbSNP
rs1440898662 4686 dbSNP
rs1204158285 4690 dbSNP
rs1477824746 4690 dbSNP
rs1308127006 4697 dbSNP
rs1033821634 4703 dbSNP
rs796663071 4704 dbSNP
rs560188953 4705 dbSNP
rs1405515215 4709 dbSNP
rs776469006 4710 dbSNP
rs1026473001 4717 dbSNP
rs1279189070 4717 dbSNP
rs1316087989 4719 dbSNP
rs1454914159 4724 dbSNP
rs993668759 4732 dbSNP
rs953763687 4737 dbSNP
rs181430681 4753 dbSNP
rs1462216390 4763 dbSNP
rs1355734845 4768 dbSNP
rs899386693 4771 dbSNP
rs1211642870 4779 dbSNP
rs574460461 4782 dbSNP
rs1236563081 4783 dbSNP
rs1385786140 4795 dbSNP
rs1216827981 4796 dbSNP
rs1007488417 4804 dbSNP
rs889142950 4809 dbSNP
rs1185409223 4831 dbSNP
rs1422757338 4839 dbSNP
rs1473095268 4840 dbSNP
rs1437574953 4843 dbSNP
rs1164436801 4846 dbSNP
rs1052223268 4851 dbSNP
rs1237393595 4853 dbSNP
rs1404359674 4867 dbSNP
rs1298481501 4872 dbSNP
rs114683853 4878 dbSNP
rs1398607881 4882 dbSNP
rs1015497346 4883 dbSNP
rs189438302 4887 dbSNP
rs1341532436 4891 dbSNP
rs10610184 4895 dbSNP
rs1282470320 4897 dbSNP
rs1219471959 4902 dbSNP
rs1355794418 4904 dbSNP
rs576967305 4905 dbSNP
rs1288510602 4907 dbSNP
rs888304860 4909 dbSNP
rs1027198729 4915 dbSNP
rs1214110806 4921 dbSNP
rs558390082 4926 dbSNP
rs1375112364 4927 dbSNP
rs1306779051 4930 dbSNP
rs1442888828 4937 dbSNP
rs1189584768 4939 dbSNP
rs1366175743 4940 dbSNP
rs905275708 4942 dbSNP
rs1158869712 4943 dbSNP
rs937932950 4946 dbSNP
rs926294589 4948 dbSNP
rs540482814 4950 dbSNP
rs184362355 4951 dbSNP
rs1026488235 4953 dbSNP
rs1165370360 4959 dbSNP
rs1417827843 4962 dbSNP
rs1332837852 4965 dbSNP
rs182224920 4967 dbSNP
rs548154585 4970 dbSNP
rs746957637 4972 dbSNP
rs777660585 4974 dbSNP
rs772218614 4975 dbSNP
rs1311579132 4976 dbSNP
rs1419826298 4976 dbSNP
rs1252924230 4979 dbSNP
rs1189753579 4983 dbSNP
rs1239729741 4985 dbSNP
rs1259893574 4989 dbSNP
rs1490201817 4999 dbSNP
rs536282396 5001 dbSNP
rs936877302 5003 dbSNP
rs1254076219 5008 dbSNP
rs1460818907 5015 dbSNP
rs1178652876 5022 dbSNP
rs1016448270 5026 dbSNP
rs1437404073 5033 dbSNP
rs1157728377 5050 dbSNP
rs925484069 5057 dbSNP
rs986256394 5060 dbSNP
rs1378563420 5077 dbSNP
rs1007748294 5078 dbSNP
rs1171194203 5088 dbSNP
rs1402052787 5091 dbSNP
rs1466626526 5092 dbSNP
rs1333398070 5096 dbSNP
rs1374811840 5100 dbSNP
rs932445195 5107 dbSNP
rs558076099 5111 dbSNP
rs1331467491 5121 dbSNP
rs889395629 5123 dbSNP
rs147553154 5124 dbSNP
rs190451853 5132 dbSNP
rs997964646 5134 dbSNP
rs779171605 5140 dbSNP
rs1199238824 5142 dbSNP
rs976416858 5143 dbSNP
rs370672513 5147 dbSNP
rs1319172061 5149 dbSNP
rs1298716882 5159 dbSNP
rs1404005977 5160 dbSNP
rs752047117 5162 dbSNP
rs1197146425 5175 dbSNP
rs1429069475 5176 dbSNP
rs754246763 5185 dbSNP
rs79593583 5186 dbSNP
rs1478415241 5197 dbSNP
rs200221532 5197 dbSNP
rs1173510515 5204 dbSNP
rs780569631 5208 dbSNP
rs1345560158 5209 dbSNP
rs952730618 5216 dbSNP
rs756630621 5225 dbSNP
rs750988917 5227 dbSNP
rs1294198185 5230 dbSNP
rs1393072234 5236 dbSNP
rs1385332353 5237 dbSNP
rs763470280 5240 dbSNP
rs969489876 5243 dbSNP
rs1344696021 5245 dbSNP
rs1219155552 5254 dbSNP
rs1398015739 5255 dbSNP
rs865799411 5261 dbSNP
rs1025074952 5272 dbSNP
rs1013650555 5277 dbSNP
rs184240292 5284 dbSNP
rs1053646936 5289 dbSNP
rs150176560 5291 dbSNP
rs1375772995 5297 dbSNP
rs1478384973 5297 dbSNP
rs1174184581 5301 dbSNP
rs1480252381 5307 dbSNP
rs926569926 5318 dbSNP
rs547265005 5328 dbSNP
rs1428453926 5336 dbSNP
rs1165510518 5338 dbSNP
rs1280118837 5346 dbSNP
rs981764346 5348 dbSNP
rs1430019727 5349 dbSNP
rs892466454 5358 dbSNP
rs1293219022 5363 dbSNP
rs1201698088 5371 dbSNP
rs1400314529 5374 dbSNP
rs1487554167 5375 dbSNP
rs1261630027 5376 dbSNP
rs1206295819 5380 dbSNP
rs949082233 5388 dbSNP
rs918986597 5390 dbSNP
rs1254667521 5396 dbSNP
rs1323046803 5396 dbSNP
rs1290660435 5398 dbSNP
rs1488414188 5404 dbSNP
rs1219171824 5407 dbSNP
rs1466984473 5408 dbSNP
rs1222477430 5410 dbSNP
rs1261507696 5412 dbSNP
rs1485803934 5413 dbSNP
rs1052827926 5414 dbSNP
rs1201995586 5416 dbSNP
rs1284569249 5421 dbSNP
rs963122269 5422 dbSNP
rs1381090566 5426 dbSNP
rs1421780338 5431 dbSNP
rs58437717 5433 dbSNP
rs1343260626 5438 dbSNP
rs1429918210 5446 dbSNP
rs74319567 5455 dbSNP
rs200385798 5456 dbSNP
rs757072645 5456 dbSNP
rs1313750971 5457 dbSNP
rs57215349 5457 dbSNP
rs796627121 5457 dbSNP
rs1353912515 5462 dbSNP
rs1241911423 5464 dbSNP
rs1383898194 5467 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.749 7.2e-5 0.774 3.1e-5 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.601 2.5e-3 -0.681 4.7e-4 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.533 4.4e-3 0.439 1.8e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.43 7.0e-3 0.077 3.4e-1 32 Click to see details
GSE21032 Prostate cancer 0.259 9.0e-3 0.211 2.8e-2 83 Click to see details
GSE26953 Aortic valvular endothelial cells -0.471 1.0e-2 -0.417 2.1e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.573 2.0e-2 -0.522 3.4e-2 13 Click to see details
GSE38226 Liver fibrosis 0.427 2.7e-2 0.234 1.5e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.387 2.8e-2 0.300 7.3e-2 25 Click to see details
GSE17306 Multiple myeloma 0.233 5.4e-2 0.117 2.1e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.142 9.1e-2 0.187 3.9e-2 90 Click to see details
GSE19536 Breast cancer -0.087 1.9e-1 -0.148 7.1e-2 100 Click to see details
GSE17498 Multiple myeloma -0.109 2.5e-1 0.158 1.7e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.171 3.0e-1 0.161 3.1e-1 12 Click to see details
GSE27834 Pluripotent stem cells -0.124 3.2e-1 -0.150 2.9e-1 16 Click to see details
GSE28544 Breast cancer -0.085 3.5e-1 -0.407 2.4e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.078 3.6e-1 0.068 3.7e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.041 3.7e-1 -0.021 4.3e-1 64 Click to see details
GSE19783 ER- ER- breast cancer -0.033 3.9e-1 -0.076 2.5e-1 79 Click to see details
GSE21849 B cell lymphoma -0.034 4.3e-1 -0.222 1.2e-1 29 Click to see details
GSE21849 B cell lymphoma -0.034 4.3e-1 -0.222 1.2e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.204 0.08 -0.202 0.08 49 Click to see details
HNSC -0.212 0.09 -0.191 0.11 42 Click to see details
CHOL -0.433 0.12 -0.367 0.17 9 Click to see details
KIRP -0.196 0.14 -0.210 0.12 32 Click to see details
ESCA -0.309 0.18 -0.427 0.1 11 Click to see details
LUAD 0.291 0.18 0.210 0.26 12 Click to see details
PRAD 0.132 0.18 0.058 0.34 50 Click to see details
CESC 0.752 0.23 0.500 0.33 3 Click to see details
BRCA 0.074 0.25 0.040 0.36 84 Click to see details
COAD 0.201 0.32 0.000 0.5 8 Click to see details
KICH 0.078 0.36 0.061 0.39 25 Click to see details
LUSC -0.061 0.36 -0.005 0.49 38 Click to see details
UCEC -0.087 0.36 -0.226 0.18 19 Click to see details
BLCA -0.085 0.37 -0.084 0.37 18 Click to see details
PAAD -0.137 0.43 -0.200 0.4 4 Click to see details
KIRC -0.017 0.45 -0.002 0.49 68 Click to see details
STAD 0.022 0.45 0.007 0.48 32 Click to see details
THCA 0.012 0.46 -0.089 0.25 59 Click to see details
PCPG -0.112 0.46 -0.500 0.33 3 Click to see details
PCPG -0.112 0.46 -0.500 0.33 3 Click to see details
PCPG -0.112 0.46 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein