miRTarBase - #MIRT727297 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LITAF   
Synonyms PIG7, SIMPLE, TP53I7
Description lipopolysaccharide induced TNF factor
Transcript NM_001136473   
Other Transcripts NM_001136472 , NM_004862   
Expression
Putative miRNA Targets on LITAF
3'UTR of LITAF
(miRNA target sites are highlighted)
>LITAF|NM_001136473|3'UTR
   1 GTACCTGGGACCACAGGTGCATAGCGGGCTGCTGCTTCATCCCCTTCTGCGTGGATGCCCTGCAGGACGTGGACCATTAC
  81 TGTCCCAACTGCAGAGCTCTCCTGGGCACCTACAAGCGTTTGTAGGACTCAGCCAGACGTGGAGGGAGCCGGGTGCCGCA
 161 GGAAGTCCTTTCCACCTCTCATCCAGCTTCACGCCTGGTGGAGGTTCTGCCCTGGTGGTCTCACCTCTCCAGGGGGCCCA
 241 CCTTCATGTCTTCTTTTGGGGGGAATACGTCGCAAAACTAACAAATCTCCAAACCCCAGAAATTGCTGCTTGGAGTCGTG
 321 CATAGGACTTGCAAAGACATTCCCCTTGAGTGTCAGTTCCACGGTTTCCTGCCTCCCTGAGACCCTGAGTCCTGCCATCT
 401 AACTGTGATCATTGCCCTATCCGAATATCTTCCTGTGATCTGCCATCAGTGGCTCTTTTTTCCTGCTTCCATGGGCCTTT
 481 CTGGTGGCAGTCTCAAACTGAGAAGCCACAGTTGCCTTATTTTTGAGGCTGTTCTGCCCAGAGCTCGGCTGAACCAGCCT
 561 TTAGTGCCTACCATTATCTTATCCGTCTCTTCCCGTCCCTGATGACAAAGATCTTGCCTTACAGACTTTACAGGCTTGGC
 641 TTTGAGATTCTGTAACTGCAGACTTCATTAGCACACAGATTCACTTTAATTTCTTAATTTTTTTTTTAAATACAAGGAGG
 721 GGGCTATTAACACCCAGTACAGACATATCCACAAGGTCGTAAATGCATGCTAGAAAAATAGGGCTGGATCTTATCACTGC
 801 CCTGTCTCCCCTTGTTTCTCTGTGCCAGATCTTCAGTGCCCCTTTCCATACAGGGATTTTTTTCTCATAGAGTAATTATA
 881 TGAACAGTTTTTATGACCTCCTTTTGGTCTGAAATACTTTTGAACAGAATTTCTTTTTTTTAAAAAAAAACAGAGATGGG
 961 GTCTTACTATGTTGCCCAGGCTGGTGTCGAACTCCTGGGCTCAAGCGATCCTTCTGCCTTGGCCTCCCGAAGTGCTGGGA
1041 TTGCAGGCATAAGCTACCATGCTGGGCCTGAACATAATTTCAAGAGGAGGATTTATAAAACCATTTTCTGTAATCAAATG
1121 ATTGGTGTCATTTTCCCATTTGCCAATGTAGTCTCACTTAAAAAAAAAAAAAAGAAAAAGAAATGGATAATTTCATCTAC
1201 TGCCTTTACTTGGGGTTAATGTGATTCTTAAACACCTTCATCATGGAACTCTCAGAGTGGGGTCCGTTTTGGTTTCCTGG
1281 TGGTGGGTTTTGAAAGATAAGGGAAAGCACATTTTGAGCATGTCTGGGTACCATGGTGCGGATGCTTGGGAACCAGAACT
1361 GTTTCAGAGGAATCTAAAGTCTGATTTTAGTTTTCAGAGACACAGCTTGTTGTAAAACATGAGAAGACATGATTTCTAGG
1441 ACTCAAGCAGCAAGCCAGGATTCTAGGTTGGCTGCTGTGTCATCTTTGAAGTCAAGACAAAGCTGGGCTCGACCTTCAAG
1521 GGTCCTCGTTTTGATAATACTTCAGAATAGGGAACTCATGTGAATACTACTATGTAGAAATAAAACCTAGACCTTGAGCG
1601 AACATCTGTATATTGGTTGAAAACGATAGTGGTAACCATTGATCCCCCTTCATTTGATGTTTGGAAAATTCCAGTAATTA
1681 TCATTTTTGCAACGAATATGGATACCACATAGTACTTTGGTGTTACCTGCTTTTGAAAAATAAAGTCTTTGGTTCACCCG
1761 GTGAACTATTTATGAGTTCTTTTGGTGTGAAGAAAGGGCTCATGTTGCATTTCCAGCCATTGCTACAAAGAACCTTTATT
1841 TGTTCAGTAACGGTAGAAAATCCTTCCCGATTAAAAACTTCAGACTTGCTGAATATCCTGCAATGTCAAGATGACCGATG
1921 TTGAGTTGGGTGGATTTGCTAACGAGTCAGATTTGAACATGAGGCTATTGGAACCCAATAGGCGTCATTGATGGCGGCAA
2001 GCCATAGCTTTCAAGTTTTAATAAAATGCACAAAAGAGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUU--GGUAAUACACGACGAu 5'
            ||||  |||  |  ||||||| 
Target 5' tcCAAACCCCAGAAATTGCTGCTt 3'
288 - 311 158.00 -14.34
2
miRNA  3' guGUUUG-GUAAUAC---ACGACGAu 5'
            ||::: ||| : |   ||||||| 
Target 5' caCAGGTGCATAGCGGGCTGCTGCTt 3'
12 - 37 148.00 -15.70
3
miRNA  3' guGUUUGG---UAA----UACACGACGAu 5'
            |||:||   |||    :|  |||||| 
Target 5' agCAAGCCAGGATTCTAGGTTGGCTGCTg 3'
1449 - 1477 126.00 -17.04
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1194970 57 ClinVar
683059 59 ClinVar
683086 59 ClinVar
1183497 61 ClinVar
671794 1683 ClinVar
671795 1723 ClinVar
1179283 1784 ClinVar
694879 1930 ClinVar
872382 1971 ClinVar
571959 1975 ClinVar
807994 1980 ClinVar
208245 1985 ClinVar
317780 1986 ClinVar
246593 1988 ClinVar
546771 1988 ClinVar
755830 1999 ClinVar
41230 2003 ClinVar
41231 2003 ClinVar
208246 2004 ClinVar
664834 2004 ClinVar
392274 2008 ClinVar
954546 2009 ClinVar
582795 2010 ClinVar
701778 2011 ClinVar
640744 2012 ClinVar
576085 2018 ClinVar
694878 2018 ClinVar
656748 2024 ClinVar
546770 2029 ClinVar
6061 2030 ClinVar
852504 2030 ClinVar
404112 2057 ClinVar
650636 2068 ClinVar
1038405 2073 ClinVar
637892 2077 ClinVar
245638 2078 ClinVar
221090 2079 ClinVar
694877 2110 ClinVar
884759 2119 ClinVar
317779 2123 ClinVar
694876 2134 ClinVar
317778 2154 ClinVar
317777 2185 ClinVar
694875 2202 ClinVar
694874 2224 ClinVar
317776 2229 ClinVar
1063503 2271 ClinVar
317775 2279 ClinVar
887907 2320 ClinVar
317774 2380 ClinVar
317773 2507 ClinVar
317772 2525 ClinVar
317771 2539 ClinVar
887906 2586 ClinVar
887905 2649 ClinVar
317770 2669 ClinVar
317769 2684 ClinVar
317768 2772 ClinVar
317767 2797 ClinVar
317766 2809 ClinVar
317765 2882 ClinVar
317764 2902 ClinVar
317763 2903 ClinVar
317762 2968 ClinVar
317761 2990 ClinVar
317760 3019 ClinVar
317759 3035 ClinVar
885643 3140 ClinVar
317758 3256 ClinVar
885642 3303 ClinVar
317757 3337 ClinVar
885641 3450 ClinVar
885640 3472 ClinVar
885639 3485 ClinVar
317756 3501 ClinVar
884702 3508 ClinVar
884701 3522 ClinVar
317755 3579 ClinVar
317754 3643 ClinVar
317753 3713 ClinVar
884700 3718 ClinVar
317752 3939 ClinVar
317751 3956 ClinVar
884699 3965 ClinVar
COSN19690840 16 COSMIC
COSN29314140 48 COSMIC
COSN6079603 268 COSMIC
COSN22700302 352 COSMIC
COSN1692749 826 COSMIC
COSN8485031 1010 COSMIC
COSN16096390 1111 COSMIC
COSN23929599 1233 COSMIC
COSN27012445 1387 COSMIC
COSN26806370 1757 COSMIC
COSN17240944 1841 COSMIC
COSN29393999 1850 COSMIC
COSN19736154 1955 COSMIC
COSN7297701 1955 COSMIC
COSN18447224 1960 COSMIC
COSM9062617 1983 COSMIC
COSM6343392 1990 COSMIC
COSM7889574 1999 COSMIC
COSM8341075 2008 COSMIC
COSM966992 2011 COSMIC
COSM325688 2015 COSMIC
COSM5585654 2035 COSMIC
COSM966991 2054 COSMIC
COSM6407342 2072 COSMIC
COSM9058211 2079 COSMIC
COSM2142274 2099 COSMIC
COSM1651284 2100 COSMIC
COSM8185783 2114 COSMIC
COSM8278936 2117 COSMIC
COSM9369813 2128 COSMIC
COSM5781735 2172 COSMIC
COSM8548143 2222 COSMIC
COSM8652513 2230 COSMIC
COSM9264278 2239 COSMIC
COSM9264047 2240 COSMIC
COSM8859997 2248 COSMIC
COSM4422327 2279 COSMIC
COSN30029403 2654 COSMIC
COSN20112616 2658 COSMIC
COSN7297700 2669 COSMIC
COSN17423634 2902 COSMIC
COSN17350598 2903 COSMIC
COSN20112615 3121 COSMIC
COSN23129043 3166 COSMIC
COSN5215165 3240 COSMIC
COSN22168588 3280 COSMIC
COSN29957268 3428 COSMIC
COSN22182449 3920 COSMIC
rs3784924 737 GWAS
rs71406254 2668 GWAS
rs7102 3337 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1251012600 3 dbSNP
rs1225491965 4 dbSNP
rs1318449614 6 dbSNP
rs1265728486 11 dbSNP
rs769879445 13 dbSNP
rs1313884717 16 dbSNP
rs1414483319 17 dbSNP
rs1357182928 18 dbSNP
rs1227172084 19 dbSNP
rs1224703279 22 dbSNP
rs1354172665 26 dbSNP
rs1246724540 28 dbSNP
rs762299505 29 dbSNP
rs1309766098 30 dbSNP
rs1409947070 31 dbSNP
rs1395114451 39 dbSNP
rs1419356643 41 dbSNP
rs1165600871 44 dbSNP
rs574933016 45 dbSNP
rs555099293 46 dbSNP
rs28482114 48 dbSNP
rs1353946789 49 dbSNP
rs769039302 50 dbSNP
rs75642914 57 dbSNP
rs1300016492 58 dbSNP
rs1374283403 59 dbSNP
rs199959810 59 dbSNP
rs57186247 59 dbSNP
rs7206280 59 dbSNP
rs201780637 60 dbSNP
rs371296032 61 dbSNP
rs922631568 63 dbSNP
rs1252597465 68 dbSNP
rs1457931402 68 dbSNP
rs976794643 76 dbSNP
rs964070015 77 dbSNP
rs560753753 85 dbSNP
rs1446828805 91 dbSNP
rs559316703 97 dbSNP
rs1419395162 98 dbSNP
rs1427299445 102 dbSNP
rs1172612977 104 dbSNP
rs984266117 106 dbSNP
rs1380094140 108 dbSNP
rs1469430718 110 dbSNP
rs1313860248 113 dbSNP
rs374252166 117 dbSNP
rs752457170 120 dbSNP
rs1328501997 122 dbSNP
rs927553634 132 dbSNP
rs1454396744 139 dbSNP
rs1284619101 143 dbSNP
rs1361148544 148 dbSNP
rs994866639 158 dbSNP
rs1316704063 159 dbSNP
rs1318021298 162 dbSNP
rs1202574219 167 dbSNP
rs1260904821 169 dbSNP
rs981708551 170 dbSNP
rs971610425 172 dbSNP
rs867172539 175 dbSNP
rs1188813496 178 dbSNP
rs1011931541 181 dbSNP
rs376689015 183 dbSNP
rs76278127 184 dbSNP
rs1174483846 186 dbSNP
rs182874026 196 dbSNP
rs146797337 215 dbSNP
rs1053955308 216 dbSNP
rs373681060 224 dbSNP
rs1344450346 229 dbSNP
rs1169422520 243 dbSNP
rs1428487495 244 dbSNP
rs936510555 251 dbSNP
rs1027139867 258 dbSNP
rs759131577 265 dbSNP
rs1222400343 269 dbSNP
rs995160436 270 dbSNP
rs963701100 271 dbSNP
rs1219502843 277 dbSNP
rs1283927256 281 dbSNP
rs1315508455 282 dbSNP
rs1218509363 285 dbSNP
rs1017869025 297 dbSNP
rs1264558657 298 dbSNP
rs1190831252 307 dbSNP
rs1042291515 309 dbSNP
rs933270299 314 dbSNP
rs1271223682 319 dbSNP
rs567256511 320 dbSNP
rs141062623 321 dbSNP
rs1224660539 323 dbSNP
rs1406893993 338 dbSNP
rs1398771445 339 dbSNP
rs891000293 342 dbSNP
rs1160337983 343 dbSNP
rs976699760 346 dbSNP
rs9921698 347 dbSNP
rs867396087 352 dbSNP
rs565164458 353 dbSNP
rs1436666306 356 dbSNP
rs561547047 359 dbSNP
rs763485646 360 dbSNP
rs551295558 361 dbSNP
rs1026256201 362 dbSNP
rs543105557 364 dbSNP
rs1054525497 366 dbSNP
rs972996306 371 dbSNP
rs1287240586 373 dbSNP
rs773724932 380 dbSNP
rs57792815 381 dbSNP
rs1220979657 393 dbSNP
rs762052864 395 dbSNP
rs905874588 397 dbSNP
rs1025248472 403 dbSNP
rs1011885641 407 dbSNP
rs1268785880 412 dbSNP
rs1430509664 415 dbSNP
rs1346669283 424 dbSNP
rs540236819 425 dbSNP
rs894848030 431 dbSNP
rs190766434 432 dbSNP
rs908116475 435 dbSNP
rs1423862755 436 dbSNP
rs74007590 437 dbSNP
rs1392207619 451 dbSNP
rs1329636351 454 dbSNP
rs930792259 454 dbSNP
rs920742296 460 dbSNP
rs544767283 465 dbSNP
rs963731740 466 dbSNP
rs997324684 473 dbSNP
rs1382519536 479 dbSNP
rs1244334621 482 dbSNP
rs1317817942 486 dbSNP
rs1357089627 488 dbSNP
rs1195285298 489 dbSNP
rs1429776148 499 dbSNP
rs1199519437 506 dbSNP
rs1238485816 510 dbSNP
rs79245913 511 dbSNP
rs1181624270 516 dbSNP
rs148161455 517 dbSNP
rs1473107769 518 dbSNP
rs955352556 518 dbSNP
rs1267543766 524 dbSNP
rs1393767491 525 dbSNP
rs1466811515 526 dbSNP
rs780039113 532 dbSNP
rs868180719 535 dbSNP
rs1048455557 538 dbSNP
rs1336617129 543 dbSNP
rs111266967 544 dbSNP
rs1032817326 548 dbSNP
rs1213647684 550 dbSNP
rs539383352 556 dbSNP
rs9941211 561 dbSNP
rs11644920 566 dbSNP
rs905907139 569 dbSNP
rs1285587622 575 dbSNP
rs879088977 580 dbSNP
rs1442922754 585 dbSNP
rs749277465 586 dbSNP
rs1370778734 589 dbSNP
rs1222157105 609 dbSNP
rs918166336 611 dbSNP
rs1428141321 616 dbSNP
rs991109041 616 dbSNP
rs1045799498 619 dbSNP
rs1032453629 624 dbSNP
rs1345499809 625 dbSNP
rs1280203798 637 dbSNP
rs1316879190 637 dbSNP
rs552962552 638 dbSNP
rs1400666610 641 dbSNP
rs535881813 645 dbSNP
rs886720472 650 dbSNP
rs1000552958 654 dbSNP
rs1257481541 657 dbSNP
rs1345460266 659 dbSNP
rs1048424704 663 dbSNP
rs1204441246 664 dbSNP
rs1259603485 665 dbSNP
rs773981664 678 dbSNP
rs1376872600 679 dbSNP
rs1193723107 687 dbSNP
rs1489260443 687 dbSNP
rs572928366 691 dbSNP
rs777562839 705 dbSNP
rs1177792586 710 dbSNP
rs974844264 713 dbSNP
rs942494056 716 dbSNP
rs1453520229 719 dbSNP
rs1157239972 720 dbSNP
rs868537350 728 dbSNP
rs3784924 737 dbSNP
rs986512085 751 dbSNP
rs955196741 754 dbSNP
rs550430815 758 dbSNP
rs997268126 761 dbSNP
rs1038923380 763 dbSNP
rs1019924599 764 dbSNP
rs9921352 765 dbSNP
rs1424428278 766 dbSNP
rs1355767637 767 dbSNP
rs957277083 768 dbSNP
rs1032848397 776 dbSNP
rs1217259348 776 dbSNP
rs1489654631 779 dbSNP
rs1001364190 780 dbSNP
rs571147867 781 dbSNP
rs1230706564 785 dbSNP
rs551260604 792 dbSNP
rs1420780926 793 dbSNP
rs1048846098 796 dbSNP
rs1363749463 797 dbSNP
rs1459532844 804 dbSNP
rs970161928 807 dbSNP
rs1461500484 810 dbSNP
rs1265370212 811 dbSNP
rs1389958887 824 dbSNP
rs528324285 825 dbSNP
rs754639348 831 dbSNP
rs751121389 832 dbSNP
rs886454673 840 dbSNP
rs1319904465 844 dbSNP
rs1223084694 845 dbSNP
rs1265586029 850 dbSNP
rs1047691588 851 dbSNP
rs995502774 854 dbSNP
rs899424152 864 dbSNP
rs1039211924 880 dbSNP
rs186049165 884 dbSNP
rs1279051396 886 dbSNP
rs868740117 890 dbSNP
rs1383904736 895 dbSNP
rs546555759 897 dbSNP
rs79944019 898 dbSNP
rs1468079964 899 dbSNP
rs1358382361 904 dbSNP
rs979469631 913 dbSNP
rs561414261 916 dbSNP
rs1402135734 917 dbSNP
rs1447215116 920 dbSNP
rs1335883642 921 dbSNP
rs966413278 923 dbSNP
rs1230015640 928 dbSNP
rs912896228 929 dbSNP
rs975842815 930 dbSNP
rs1216370063 935 dbSNP
rs1259618414 940 dbSNP
rs1177527161 945 dbSNP
rs1444860196 950 dbSNP
rs544416126 955 dbSNP
rs575785801 957 dbSNP
rs1203402955 964 dbSNP
rs565430926 973 dbSNP
rs1007360496 974 dbSNP
rs1483105764 975 dbSNP
rs756503384 987 dbSNP
rs887666564 992 dbSNP
rs979958047 994 dbSNP
rs1027573880 996 dbSNP
rs1261683396 998 dbSNP
rs1175426051 1001 dbSNP
rs1357220449 1003 dbSNP
rs1218490446 1007 dbSNP
rs1303380177 1013 dbSNP
rs1360612307 1014 dbSNP
rs1315724384 1015 dbSNP
rs1283646572 1022 dbSNP
rs995906379 1025 dbSNP
rs545625636 1027 dbSNP
rs897194373 1029 dbSNP
rs1222592099 1039 dbSNP
rs969859003 1039 dbSNP
rs1276860033 1041 dbSNP
rs1024116475 1048 dbSNP
rs1037099903 1065 dbSNP
rs1242017075 1069 dbSNP
rs748554610 1072 dbSNP
rs1487624211 1076 dbSNP
rs1313122377 1077 dbSNP
rs949478233 1084 dbSNP
rs1378085347 1085 dbSNP
rs373297725 1088 dbSNP
rs1432790850 1089 dbSNP
rs553721619 1098 dbSNP
rs1014764873 1103 dbSNP
rs1176572905 1112 dbSNP
rs574252891 1112 dbSNP
rs950793622 1120 dbSNP
rs979740688 1121 dbSNP
rs369270254 1122 dbSNP
rs994841988 1124 dbSNP
rs573589656 1125 dbSNP
rs1161214493 1127 dbSNP
rs146790317 1133 dbSNP
rs1262855265 1135 dbSNP
rs1220159078 1139 dbSNP
rs1284082165 1141 dbSNP
rs1039242950 1142 dbSNP
rs1219440372 1149 dbSNP
rs1188729883 1154 dbSNP
rs1286756507 1156 dbSNP
rs1490213544 1159 dbSNP
rs1196974483 1173 dbSNP
rs1248639578 1183 dbSNP
rs1478506628 1185 dbSNP
rs1191541112 1188 dbSNP
rs1007743250 1190 dbSNP
rs1437671955 1196 dbSNP
rs890637946 1202 dbSNP
rs765931295 1204 dbSNP
rs1160396546 1216 dbSNP
rs1017326145 1232 dbSNP
rs183554640 1235 dbSNP
rs951919927 1236 dbSNP
rs75256825 1237 dbSNP
rs190843228 1241 dbSNP
rs1375165255 1252 dbSNP
rs1242888350 1253 dbSNP
rs1171380036 1255 dbSNP
rs1490848217 1259 dbSNP
rs557490281 1260 dbSNP
rs765638745 1267 dbSNP
rs993453041 1272 dbSNP
rs1289685370 1275 dbSNP
rs1452397827 1278 dbSNP
rs755284745 1281 dbSNP
rs1237276282 1282 dbSNP
rs1308359787 1285 dbSNP
rs1347038269 1286 dbSNP
rs1380821191 1288 dbSNP
rs762260099 1290 dbSNP
rs1160948078 1292 dbSNP
rs1415340933 1294 dbSNP
rs935637227 1302 dbSNP
rs925882091 1304 dbSNP
rs1216151199 1306 dbSNP
rs980032260 1309 dbSNP
rs537695983 1319 dbSNP
rs1013612735 1327 dbSNP
rs917073842 1330 dbSNP
rs1382677232 1331 dbSNP
rs992675384 1332 dbSNP
rs1285959844 1335 dbSNP
rs950900218 1338 dbSNP
rs938172087 1344 dbSNP
rs1026385970 1348 dbSNP
rs1320339455 1351 dbSNP
rs143648003 1353 dbSNP
rs1457095547 1354 dbSNP
rs963367518 1355 dbSNP
rs1017531320 1357 dbSNP
rs1169388203 1365 dbSNP
rs1420991221 1370 dbSNP
rs1007772686 1373 dbSNP
rs890673167 1378 dbSNP
rs1401948258 1379 dbSNP
rs1030956374 1380 dbSNP
rs1427063332 1386 dbSNP
rs568923295 1387 dbSNP
rs775673809 1392 dbSNP
rs185992799 1394 dbSNP
rs1276453154 1402 dbSNP
rs910267922 1406 dbSNP
rs1219488970 1427 dbSNP
rs1258405408 1431 dbSNP
rs772203127 1433 dbSNP
rs1198621679 1434 dbSNP
rs745920745 1435 dbSNP
rs1280613463 1441 dbSNP
rs773255230 1442 dbSNP
rs985938065 1446 dbSNP
rs1052852449 1455 dbSNP
rs567596090 1457 dbSNP
rs1260494921 1466 dbSNP
rs1478559177 1467 dbSNP
rs1193948940 1468 dbSNP
rs141310707 1477 dbSNP
rs530983289 1480 dbSNP
rs1174715389 1483 dbSNP
rs1266843618 1488 dbSNP
rs1209385121 1489 dbSNP
rs1044048697 1493 dbSNP
rs948657316 1495 dbSNP
rs1179748592 1496 dbSNP
rs1481064280 1500 dbSNP
rs565391956 1506 dbSNP
rs1202733611 1507 dbSNP
rs993101126 1509 dbSNP
rs1230762942 1510 dbSNP
rs1013560732 1518 dbSNP
rs1315761687 1523 dbSNP
rs960734299 1524 dbSNP
rs929136922 1531 dbSNP
rs1034175069 1532 dbSNP
rs919061890 1537 dbSNP
rs544642644 1539 dbSNP
rs1224034615 1547 dbSNP
rs545587104 1549 dbSNP
rs1347394219 1557 dbSNP
rs1216830054 1561 dbSNP
rs1266185000 1565 dbSNP
rs963398179 1571 dbSNP
rs748008688 1572 dbSNP
rs528722273 1576 dbSNP
rs986091423 1578 dbSNP
rs955163616 1579 dbSNP
rs560072444 1580 dbSNP
rs780786382 1587 dbSNP
rs1157408778 1588 dbSNP
rs1010170802 1592 dbSNP
rs1362497560 1595 dbSNP
rs892651615 1597 dbSNP
rs754692436 1604 dbSNP
rs1293066501 1608 dbSNP
rs999950660 1612 dbSNP
rs1299481663 1614 dbSNP
rs892678942 1614 dbSNP
rs904272080 1614 dbSNP
rs1460152406 1628 dbSNP
rs1044121291 1638 dbSNP
rs1303049248 1639 dbSNP
rs1040611958 1640 dbSNP
rs375952117 1644 dbSNP
rs180736705 1658 dbSNP
rs779849316 1662 dbSNP
rs1487264950 1664 dbSNP
rs556638817 1667 dbSNP
rs1211281908 1669 dbSNP
rs1057067092 1676 dbSNP
rs1268438208 1676 dbSNP
rs1427861594 1677 dbSNP
rs1457626418 1677 dbSNP
rs74469401 1683 dbSNP
rs1419698361 1684 dbSNP
rs930382260 1699 dbSNP
rs919105699 1701 dbSNP
rs1459585676 1714 dbSNP
rs973170331 1717 dbSNP
rs189673023 1721 dbSNP
rs75012078 1723 dbSNP
rs1394893069 1726 dbSNP
rs961883193 1727 dbSNP
rs917165823 1729 dbSNP
rs992785998 1731 dbSNP
rs1391903853 1733 dbSNP
rs986123833 1734 dbSNP
rs954713208 1737 dbSNP
rs1319432475 1743 dbSNP
rs1257187133 1747 dbSNP
rs186689704 1752 dbSNP
rs1246486924 1753 dbSNP
rs1273393536 1755 dbSNP
rs1204109352 1760 dbSNP
rs960676758 1764 dbSNP
rs923238740 1766 dbSNP
rs988422280 1772 dbSNP
rs565576238 1779 dbSNP
rs59139387 1784 dbSNP
rs765803582 1785 dbSNP
rs535430984 1789 dbSNP
rs1254112138 1802 dbSNP
rs757636321 1807 dbSNP
rs1022803492 1808 dbSNP
rs1423151362 1809 dbSNP
rs1464313560 1824 dbSNP
rs181146164 1825 dbSNP
rs1402217132 1826 dbSNP
rs1442777606 1837 dbSNP
rs892669114 1838 dbSNP
rs550665590 1846 dbSNP
rs1397249837 1847 dbSNP
rs79852290 1852 dbSNP
rs1339439460 1856 dbSNP
rs1216416367 1863 dbSNP
rs1057167828 1869 dbSNP
rs1308468302 1872 dbSNP
rs575880873 1874 dbSNP
rs1182778530 1875 dbSNP
rs1254734715 1883 dbSNP
rs1484551547 1887 dbSNP
rs1483453131 1892 dbSNP
rs1249942263 1894 dbSNP
rs780496793 1897 dbSNP
rs897742547 1898 dbSNP
rs1037531077 1901 dbSNP
rs745527794 1902 dbSNP
rs778509073 1905 dbSNP
rs372368909 1907 dbSNP
rs910658056 1908 dbSNP
rs753822473 1910 dbSNP
rs777609884 1914 dbSNP
rs1196148255 1917 dbSNP
rs1326288342 1919 dbSNP
rs1387948211 1922 dbSNP
rs1050486471 1923 dbSNP
rs528687602 1925 dbSNP
rs752383184 1930 dbSNP
rs376632801 1931 dbSNP
rs763015827 1934 dbSNP
rs933370679 1939 dbSNP
rs9935945 1948 dbSNP
rs765301111 1949 dbSNP
rs775725208 1950 dbSNP
rs9936561 1951 dbSNP
rs767708904 1954 dbSNP
rs200167285 1955 dbSNP
rs200859827 1956 dbSNP
rs979622478 1966 dbSNP
rs1270450888 1969 dbSNP
rs769574395 1971 dbSNP
rs777378381 1971 dbSNP
rs969563231 1971 dbSNP
rs1209682693 1973 dbSNP
rs774213197 1975 dbSNP
rs1183927285 1981 dbSNP
rs867820855 1982 dbSNP
rs797044847 1985 dbSNP
rs201512884 1986 dbSNP
rs777363288 1987 dbSNP
rs879254325 1988 dbSNP
rs1314452619 1995 dbSNP
rs1012676457 1999 dbSNP
rs281865135 2003 dbSNP
rs797044848 2004 dbSNP
rs1302303519 2005 dbSNP
rs1057524422 2008 dbSNP
rs144232569 2010 dbSNP
rs748118642 2011 dbSNP
rs780788687 2012 dbSNP
rs754821950 2018 dbSNP
rs750617013 2020 dbSNP
rs1174214039 2024 dbSNP
rs374918259 2029 dbSNP
rs121908615 2030 dbSNP
rs757495685 2033 dbSNP
rs1477856461 2035 dbSNP
rs753876492 2039 dbSNP
rs867240284 2040 dbSNP
rs1190407701 2045 dbSNP
rs1422804373 2046 dbSNP
rs764240349 2047 dbSNP
rs764014476 2048 dbSNP
rs774258859 2049 dbSNP
rs897775080 2050 dbSNP
rs543022814 2057 dbSNP
rs760018833 2058 dbSNP
rs1037563204 2060 dbSNP
rs774123275 2068 dbSNP
rs770657396 2069 dbSNP
rs748977024 2071 dbSNP
rs772527709 2073 dbSNP
rs1429813288 2076 dbSNP
rs371453151 2077 dbSNP
rs748017885 2078 dbSNP
rs864622744 2079 dbSNP
rs376296739 2081 dbSNP
rs754748605 2082 dbSNP
rs927219695 2095 dbSNP
rs199839533 2099 dbSNP
rs540770781 2100 dbSNP
rs1352215775 2103 dbSNP
rs754104844 2105 dbSNP
rs1242390419 2106 dbSNP
rs372341839 2107 dbSNP
rs571908546 2110 dbSNP
rs776618890 2111 dbSNP
rs1486289266 2112 dbSNP
rs1244713321 2114 dbSNP
rs760141560 2117 dbSNP
rs751930907 2118 dbSNP
rs766852963 2119 dbSNP
rs1273326896 2120 dbSNP
rs554296676 2121 dbSNP
rs1336997596 2122 dbSNP
rs201429019 2123 dbSNP
rs769178755 2129 dbSNP
rs1354807409 2133 dbSNP
rs768639690 2134 dbSNP
rs1413057041 2135 dbSNP
rs1372465058 2137 dbSNP
rs776030637 2138 dbSNP
rs768543861 2139 dbSNP
rs746955632 2144 dbSNP
rs1404345474 2146 dbSNP
rs1165418166 2147 dbSNP
rs374924275 2153 dbSNP
rs189101115 2154 dbSNP
rs749467763 2155 dbSNP
rs778095903 2159 dbSNP
rs1232985155 2161 dbSNP
rs1203124869 2163 dbSNP
rs756124744 2165 dbSNP
rs752772007 2166 dbSNP
rs781450478 2168 dbSNP
rs916753465 2171 dbSNP
rs755466235 2172 dbSNP
rs1364813710 2173 dbSNP
rs959850464 2175 dbSNP
rs1375321880 2176 dbSNP
rs576227906 2178 dbSNP
rs1449660644 2180 dbSNP
rs752122912 2181 dbSNP
rs149712652 2185 dbSNP
rs1441497907 2188 dbSNP
rs1226782228 2192 dbSNP
rs763437274 2193 dbSNP
rs961703722 2194 dbSNP
rs1462335926 2198 dbSNP
rs750026699 2200 dbSNP
rs1163174662 2203 dbSNP
rs1473860352 2204 dbSNP
rs370168947 2207 dbSNP
rs761406838 2209 dbSNP
rs1468153580 2217 dbSNP
rs1248137815 2219 dbSNP
rs779874120 2220 dbSNP
rs1467716988 2223 dbSNP
rs898867952 2224 dbSNP
rs1210293288 2225 dbSNP
rs1801977 2229 dbSNP
rs768169728 2230 dbSNP
rs139593462 2232 dbSNP
rs371908378 2233 dbSNP
rs778226160 2234 dbSNP
rs997747149 2235 dbSNP
rs1370439629 2239 dbSNP
rs1412083518 2241 dbSNP
rs1330181521 2245 dbSNP
rs1324314489 2246 dbSNP
rs1340441862 2247 dbSNP
rs771823255 2248 dbSNP
rs1445882978 2256 dbSNP
rs1346378963 2257 dbSNP
rs35094281 2259 dbSNP
rs745725177 2264 dbSNP
rs1398500460 2270 dbSNP
rs565356536 2271 dbSNP
rs1218249753 2277 dbSNP
rs778594024 2278 dbSNP
rs886051652 2279 dbSNP
rs770017160 2280 dbSNP
rs748322027 2281 dbSNP
rs1486052603 2282 dbSNP
rs1260121225 2287 dbSNP
rs935375092 2295 dbSNP
rs1213581721 2304 dbSNP
rs1184775860 2305 dbSNP
rs535071324 2306 dbSNP
rs1282569444 2311 dbSNP
rs903863584 2312 dbSNP
rs1421883075 2317 dbSNP
rs1370604103 2320 dbSNP
rs927197463 2321 dbSNP
rs773679663 2323 dbSNP
rs946735900 2324 dbSNP
rs1402099329 2331 dbSNP
rs1363069634 2336 dbSNP
rs1288606255 2341 dbSNP
rs566174855 2342 dbSNP
rs1377733060 2343 dbSNP
rs916808449 2353 dbSNP
rs1433550973 2356 dbSNP
rs1392918584 2362 dbSNP
rs1399512057 2364 dbSNP
rs577291309 2369 dbSNP
rs781360553 2371 dbSNP
rs1428688621 2377 dbSNP
rs886051651 2380 dbSNP
rs755163608 2383 dbSNP
rs752104689 2384 dbSNP
rs1258120362 2394 dbSNP
rs1211771824 2396 dbSNP
rs1347204759 2397 dbSNP
rs754366895 2405 dbSNP
rs1344135416 2408 dbSNP
rs1406584109 2409 dbSNP
rs1229916817 2413 dbSNP
rs1308260388 2414 dbSNP
rs1368442943 2414 dbSNP
rs961734087 2416 dbSNP
rs1213122513 2422 dbSNP
rs1281784301 2423 dbSNP
rs558217205 2425 dbSNP
rs987568394 2430 dbSNP
rs549277955 2432 dbSNP
rs1373115242 2434 dbSNP
rs184329131 2437 dbSNP
rs1029246538 2438 dbSNP
rs1462180333 2439 dbSNP
rs1372082585 2448 dbSNP
rs984417525 2455 dbSNP
rs1194336864 2457 dbSNP
rs1168125208 2459 dbSNP
rs1476062556 2462 dbSNP
rs1418536256 2463 dbSNP
rs1173365492 2467 dbSNP
rs1477291587 2468 dbSNP
rs1187111441 2470 dbSNP
rs1176101672 2473 dbSNP
rs563808008 2474 dbSNP
rs1484621899 2486 dbSNP
rs1419149447 2493 dbSNP
rs1296491689 2494 dbSNP
rs1255535005 2497 dbSNP
rs1197562532 2498 dbSNP
rs1481091432 2500 dbSNP
rs13336723 2507 dbSNP
rs1225785716 2508 dbSNP
rs750764207 2512 dbSNP
rs142700369 2519 dbSNP
rs13337025 2525 dbSNP
rs568508478 2528 dbSNP
rs1308533150 2532 dbSNP
rs1014568118 2533 dbSNP
rs878876370 2535 dbSNP
rs1238774255 2536 dbSNP
rs901689257 2537 dbSNP
rs1030799941 2538 dbSNP
rs192516633 2539 dbSNP
rs895526435 2543 dbSNP
rs763590812 2545 dbSNP
rs1043783913 2546 dbSNP
rs1394971252 2550 dbSNP
rs1163893726 2554 dbSNP
rs760220179 2555 dbSNP
rs1439697960 2556 dbSNP
rs572009227 2556 dbSNP
rs905731290 2564 dbSNP
rs1454458695 2569 dbSNP
rs16958443 2570 dbSNP
rs1250132795 2571 dbSNP
rs1194313103 2579 dbSNP
rs1469955249 2583 dbSNP
rs767760361 2586 dbSNP
rs759612818 2587 dbSNP
rs774127734 2590 dbSNP
rs770332944 2591 dbSNP
rs1239187109 2595 dbSNP
rs1334637926 2604 dbSNP
rs770642237 2613 dbSNP
rs1442689916 2617 dbSNP
rs1304156435 2619 dbSNP
rs139403614 2620 dbSNP
rs1052348254 2625 dbSNP
rs1371193797 2626 dbSNP
rs1324987538 2627 dbSNP
rs1459669267 2628 dbSNP
rs935343305 2632 dbSNP
rs1037119861 2634 dbSNP
rs940482072 2635 dbSNP
rs1452903943 2638 dbSNP
rs1363327138 2640 dbSNP
rs1429356262 2641 dbSNP
rs1177908143 2654 dbSNP
rs79834068 2656 dbSNP
rs908954279 2658 dbSNP
rs398119229 2659 dbSNP
rs1455754755 2664 dbSNP
rs1253850905 2668 dbSNP
rs200004345 2669 dbSNP
rs71406254 2669 dbSNP
rs755296052 2669 dbSNP
rs1252711599 2672 dbSNP
rs953556069 2672 dbSNP
rs1366920126 2681 dbSNP
rs748386654 2683 dbSNP
rs367546754 2684 dbSNP
rs576217456 2687 dbSNP
rs1206263686 2688 dbSNP
rs973607151 2692 dbSNP
rs1258439604 2695 dbSNP
rs1235781606 2697 dbSNP
rs1348226670 2700 dbSNP
rs751675013 2703 dbSNP
rs1421245831 2705 dbSNP
rs1438498771 2706 dbSNP
rs1327961840 2709 dbSNP
rs1254382445 2714 dbSNP
rs777056658 2716 dbSNP
rs556174467 2719 dbSNP
rs766429293 2720 dbSNP
rs747040977 2726 dbSNP
rs1436654539 2728 dbSNP
rs1395960764 2729 dbSNP
rs142444271 2733 dbSNP
rs976412749 2741 dbSNP
rs1199246929 2742 dbSNP
rs1477134783 2743 dbSNP
rs1244226813 2756 dbSNP
rs1194262577 2757 dbSNP
rs1446947266 2760 dbSNP
rs1457006081 2763 dbSNP
rs780316108 2764 dbSNP
rs1481278960 2765 dbSNP
rs1212486856 2767 dbSNP
rs965950759 2768 dbSNP
rs13810 2769 dbSNP
rs190484543 2772 dbSNP
rs758876345 2778 dbSNP
rs959726810 2796 dbSNP
rs117082330 2797 dbSNP
rs1188945342 2799 dbSNP
rs1270562962 2807 dbSNP
rs968153162 2807 dbSNP
rs886051650 2809 dbSNP
rs1418252657 2812 dbSNP
rs1022369526 2813 dbSNP
rs1477353667 2815 dbSNP
rs1168133131 2825 dbSNP
rs1310201387 2825 dbSNP
rs1226398893 2826 dbSNP
rs779324905 2827 dbSNP
rs1314610799 2828 dbSNP
rs1416752733 2836 dbSNP
rs1301696018 2839 dbSNP
rs542573110 2840 dbSNP
rs1376165787 2841 dbSNP
rs1373117706 2842 dbSNP
rs768664386 2844 dbSNP
rs1012313833 2846 dbSNP
rs558141944 2847 dbSNP
rs1001715006 2850 dbSNP
rs905626462 2856 dbSNP
rs1406306323 2857 dbSNP
rs1421846431 2860 dbSNP
rs1168914516 2862 dbSNP
rs1317746012 2866 dbSNP
rs1298273439 2869 dbSNP
rs1429893555 2870 dbSNP
rs760577000 2874 dbSNP
rs1338141364 2875 dbSNP
rs1190672149 2881 dbSNP
rs1198 2882 dbSNP
rs1211733855 2883 dbSNP
rs1256194564 2883 dbSNP
rs879484652 2883 dbSNP
rs1207341216 2884 dbSNP
rs1159621428 2886 dbSNP
rs1485055000 2888 dbSNP
rs1056432697 2889 dbSNP
rs755785297 2894 dbSNP
rs1471389035 2901 dbSNP
rs7187810 2902 dbSNP
rs15035 2903 dbSNP
rs758850868 2903 dbSNP
rs1315810370 2905 dbSNP
rs1037194464 2910 dbSNP
rs1393241120 2911 dbSNP
rs1436019015 2912 dbSNP
rs199813387 2912 dbSNP
rs941515254 2916 dbSNP
rs1294844502 2919 dbSNP
rs910032238 2920 dbSNP
rs1301839439 2921 dbSNP
rs911918818 2922 dbSNP
rs1051846888 2923 dbSNP
rs1285403604 2925 dbSNP
rs1354666761 2927 dbSNP
rs1292763445 2928 dbSNP
rs1445897580 2930 dbSNP
rs1245137297 2938 dbSNP
rs1356566801 2945 dbSNP
rs1329756404 2947 dbSNP
rs759458884 2949 dbSNP
rs774210075 2950 dbSNP
rs1218240119 2952 dbSNP
rs1304704382 2955 dbSNP
rs766189439 2957 dbSNP
rs549484851 2967 dbSNP
rs535657236 2968 dbSNP
rs1470860830 2974 dbSNP
rs921600082 2975 dbSNP
rs371000671 2978 dbSNP
rs1233148230 2979 dbSNP
rs1180674584 2981 dbSNP
rs1456143198 2983 dbSNP
rs762877077 2986 dbSNP
rs184419090 2989 dbSNP
rs192766322 2990 dbSNP
rs1173639574 2993 dbSNP
rs1487032103 2995 dbSNP
rs1287639797 3001 dbSNP
rs1406621819 3004 dbSNP
rs1226724010 3010 dbSNP
rs963546357 3016 dbSNP
rs75472256 3019 dbSNP
rs923842675 3020 dbSNP
rs11544252 3022 dbSNP
rs747243389 3033 dbSNP
rs886051649 3035 dbSNP
rs1187112570 3040 dbSNP
rs983743085 3041 dbSNP
rs977941866 3046 dbSNP
rs572275631 3048 dbSNP
rs1163263160 3049 dbSNP
rs1402901656 3053 dbSNP
rs1408115406 3058 dbSNP
rs1289364271 3071 dbSNP
rs1371322151 3072 dbSNP
rs1225580894 3073 dbSNP
rs1035384336 3079 dbSNP
rs1157413882 3086 dbSNP
rs772103558 3090 dbSNP
rs746383677 3105 dbSNP
rs1194102165 3108 dbSNP
rs1244889945 3110 dbSNP
rs1467844348 3113 dbSNP
rs1244963439 3115 dbSNP
rs1212831165 3117 dbSNP
rs1217895554 3118 dbSNP
rs1317405841 3119 dbSNP
rs1285054320 3120 dbSNP
rs1239497220 3121 dbSNP
rs1001226446 3123 dbSNP
rs1305858740 3129 dbSNP
rs1194204316 3135 dbSNP
rs202101839 3135 dbSNP
rs71778957 3135 dbSNP
rs753992756 3135 dbSNP
rs765231535 3135 dbSNP
rs1021383692 3138 dbSNP
rs970173696 3138 dbSNP
rs1442160424 3139 dbSNP
rs967890581 3140 dbSNP
rs779328373 3141 dbSNP
rs1433509189 3143 dbSNP
rs767411511 3145 dbSNP
rs1346247572 3146 dbSNP
rs1157807529 3147 dbSNP
rs1397170573 3148 dbSNP
rs546958182 3150 dbSNP
rs757620431 3154 dbSNP
rs1396552748 3156 dbSNP
rs1173855188 3161 dbSNP
rs1453374304 3164 dbSNP
rs1422840689 3168 dbSNP
rs1328739491 3169 dbSNP
rs1022106232 3170 dbSNP
rs749605690 3172 dbSNP
rs1486184847 3179 dbSNP
rs1334566885 3181 dbSNP
rs1241438500 3182 dbSNP
rs1280286266 3184 dbSNP
rs1444450967 3184 dbSNP
rs1216031744 3185 dbSNP
rs1378628774 3194 dbSNP
rs1487335528 3196 dbSNP
rs778141655 3200 dbSNP
rs752041371 3201 dbSNP
rs1231697594 3203 dbSNP
rs771861665 3204 dbSNP
rs1235338860 3205 dbSNP
rs1336711937 3208 dbSNP
rs1311757667 3210 dbSNP
rs1299661139 3211 dbSNP
rs1389116974 3212 dbSNP
rs1012343257 3213 dbSNP
rs1214139319 3215 dbSNP
rs1216676883 3215 dbSNP
rs1486896377 3218 dbSNP
rs1163352245 3220 dbSNP
rs959445349 3221 dbSNP
rs747264942 3222 dbSNP
rs1397650576 3224 dbSNP
rs891057374 3226 dbSNP
rs527309321 3227 dbSNP
rs368949957 3229 dbSNP
rs1489128393 3237 dbSNP
rs1419632985 3238 dbSNP
rs1465242027 3241 dbSNP
rs1357019239 3244 dbSNP
rs745563124 3246 dbSNP
rs1195368168 3247 dbSNP
rs1167760343 3248 dbSNP
rs752357864 3251 dbSNP
rs1428859454 3253 dbSNP
rs886051648 3256 dbSNP
rs780737850 3258 dbSNP
rs778620775 3259 dbSNP
rs1374947073 3262 dbSNP
rs544378460 3263 dbSNP
rs1476123052 3268 dbSNP
rs34418307 3268 dbSNP
rs1003537457 3272 dbSNP
rs1314969136 3274 dbSNP
rs1211615356 3279 dbSNP
rs1483080990 3281 dbSNP
rs1254481181 3283 dbSNP
rs1207116271 3292 dbSNP
rs1356391615 3293 dbSNP
rs1233660918 3295 dbSNP
rs900549231 3296 dbSNP
rs754511267 3300 dbSNP
rs575378733 3301 dbSNP
rs942172049 3303 dbSNP
rs368796321 3304 dbSNP
rs1015817553 3305 dbSNP
rs1293552924 3307 dbSNP
rs1293392450 3311 dbSNP
rs1394919421 3312 dbSNP
rs770384591 3314 dbSNP
rs1299516242 3315 dbSNP
rs187538883 3316 dbSNP
rs1192841939 3319 dbSNP
rs1399283662 3320 dbSNP
rs1049848474 3326 dbSNP
rs1462968882 3330 dbSNP
rs1169027111 3332 dbSNP
rs531401810 3333 dbSNP
rs1418457071 3336 dbSNP
rs7102 3337 dbSNP
rs546029779 3338 dbSNP
rs1423313206 3340 dbSNP
rs1254403113 3342 dbSNP
rs538755212 3344 dbSNP
rs969785550 3352 dbSNP
rs1317315666 3358 dbSNP
rs1405982261 3360 dbSNP
rs1367829294 3362 dbSNP
rs1481042324 3364 dbSNP
rs750180727 3365 dbSNP
rs765141086 3366 dbSNP
rs900243042 3370 dbSNP
rs1274354256 3380 dbSNP
rs1040474431 3381 dbSNP
rs1243508840 3387 dbSNP
rs1338209369 3388 dbSNP
rs944368630 3389 dbSNP
rs923576096 3392 dbSNP
rs1375636437 3397 dbSNP
rs1464256908 3405 dbSNP
rs756577049 3409 dbSNP
rs760969440 3416 dbSNP
rs1442788589 3418 dbSNP
rs1231439881 3424 dbSNP
rs978014056 3428 dbSNP
rs1162572220 3431 dbSNP
rs955862439 3432 dbSNP
rs5031040 3439 dbSNP
rs1366800396 3444 dbSNP
rs1260033823 3445 dbSNP
rs1169738301 3447 dbSNP
rs1161325430 3448 dbSNP
rs775642546 3450 dbSNP
rs1237773012 3452 dbSNP
rs1477078159 3467 dbSNP
rs1177238205 3471 dbSNP
rs184312185 3472 dbSNP
rs990665272 3475 dbSNP
rs1028246867 3479 dbSNP
rs759584237 3480 dbSNP
rs1354815434 3481 dbSNP
rs1261998181 3482 dbSNP
rs774513067 3485 dbSNP
rs1035096477 3488 dbSNP
rs982582791 3489 dbSNP
rs1321060355 3498 dbSNP
rs961372660 3499 dbSNP
rs80119580 3501 dbSNP
rs1005760992 3508 dbSNP
rs1436873689 3517 dbSNP
rs541416009 3519 dbSNP
rs1237749044 3521 dbSNP
rs1258556510 3527 dbSNP
rs1322564162 3530 dbSNP
rs942121598 3534 dbSNP
rs1385035956 3545 dbSNP
rs888699172 3553 dbSNP
rs1290756676 3554 dbSNP
rs1420346692 3557 dbSNP
rs1028483853 3559 dbSNP
rs749800119 3560 dbSNP
rs1272949437 3561 dbSNP
rs77423500 3579 dbSNP
rs1196091977 3585 dbSNP
rs1040141694 3586 dbSNP
rs1418556846 3588 dbSNP
rs1455697096 3588 dbSNP
rs191762790 3590 dbSNP
rs1224692995 3595 dbSNP
rs1198541217 3602 dbSNP
rs938840244 3606 dbSNP
rs1264437937 3607 dbSNP
rs1216788655 3608 dbSNP
rs1441863582 3612 dbSNP
rs1355396064 3618 dbSNP
rs1487667958 3621 dbSNP
rs1283188102 3622 dbSNP
rs1327798704 3623 dbSNP
rs1391420895 3633 dbSNP
rs928874849 3634 dbSNP
rs747791767 3637 dbSNP
rs886051647 3643 dbSNP
rs1348102236 3648 dbSNP
rs1274047875 3649 dbSNP
rs1228638152 3650 dbSNP
rs902187244 3651 dbSNP
rs1042033587 3652 dbSNP
rs948373358 3654 dbSNP
rs1296196255 3655 dbSNP
rs946655718 3657 dbSNP
rs1359988799 3659 dbSNP
rs914274209 3660 dbSNP
rs1480632221 3662 dbSNP
rs1296376697 3668 dbSNP
rs138713866 3670 dbSNP
rs1177188415 3671 dbSNP
rs780745690 3673 dbSNP
rs989790230 3676 dbSNP
rs764566809 3680 dbSNP
rs1031383822 3681 dbSNP
rs1477242531 3688 dbSNP
rs1375346227 3692 dbSNP
rs754484936 3694 dbSNP
rs570056746 3705 dbSNP
rs1260447925 3706 dbSNP
rs1212341368 3707 dbSNP
rs1461424825 3708 dbSNP
rs62022848 3713 dbSNP
rs537166987 3716 dbSNP
rs74808365 3718 dbSNP
rs570786775 3720 dbSNP
rs547715732 3721 dbSNP
rs1206158015 3727 dbSNP
rs1217972977 3733 dbSNP
rs1338276665 3735 dbSNP
rs1235530243 3740 dbSNP
rs1276441338 3741 dbSNP
rs1416667229 3743 dbSNP
rs1341367239 3746 dbSNP
rs1333738231 3748 dbSNP
rs982226009 3749 dbSNP
rs1399085703 3759 dbSNP
rs527278842 3761 dbSNP
rs758357340 3762 dbSNP
rs1422077301 3765 dbSNP
rs1255649372 3768 dbSNP
rs886488921 3769 dbSNP
rs1421919064 3771 dbSNP
rs1236328595 3780 dbSNP
rs781480210 3788 dbSNP
rs1439156115 3791 dbSNP
rs1427798294 3792 dbSNP
rs1258495470 3793 dbSNP
rs187522232 3795 dbSNP
rs1316035400 3796 dbSNP
rs1274970328 3801 dbSNP
rs984080626 3803 dbSNP
rs952995860 3812 dbSNP
rs750446420 3813 dbSNP
rs1283604897 3823 dbSNP
rs1028557670 3824 dbSNP
rs755358385 3829 dbSNP
rs566434511 3830 dbSNP
rs8061998 3833 dbSNP
rs750569086 3837 dbSNP
rs1332518645 3842 dbSNP
rs1223618628 3845 dbSNP
rs1446463299 3849 dbSNP
rs1398818680 3851 dbSNP
rs1020164319 3854 dbSNP
rs765122841 3864 dbSNP
rs1281584208 3870 dbSNP
rs1233648839 3872 dbSNP
rs116033968 3877 dbSNP
rs914828826 3878 dbSNP
rs766593913 3879 dbSNP
rs1470988163 3882 dbSNP
rs1211113592 3884 dbSNP
rs762991750 3888 dbSNP
rs1237797056 3889 dbSNP
rs1054007155 3891 dbSNP
rs902260730 3893 dbSNP
rs1177850019 3894 dbSNP
rs149614171 3904 dbSNP
rs750491241 3905 dbSNP
rs1222223324 3911 dbSNP
rs934334217 3912 dbSNP
rs1450013641 3926 dbSNP
rs924354409 3928 dbSNP
rs1392753053 3929 dbSNP
rs1289268545 3931 dbSNP
rs1436156598 3935 dbSNP
rs1226655058 3936 dbSNP
rs1356167946 3937 dbSNP
rs759832566 3939 dbSNP
rs531394893 3940 dbSNP
rs1239948133 3943 dbSNP
rs1042109232 3944 dbSNP
rs138296050 3945 dbSNP
rs893749886 3949 dbSNP
rs1349790374 3951 dbSNP
rs1321058621 3955 dbSNP
rs150472475 3956 dbSNP
rs1373327319 3957 dbSNP
rs955365078 3957 dbSNP
rs1157690021 3962 dbSNP
rs760630375 3965 dbSNP
rs1396694730 3968 dbSNP
rs1191501746 3976 dbSNP
rs1488143865 3991 dbSNP
rs1315427642 3994 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.312 2.0e-3 0.256 9.7e-3 83 Click to see details
GSE38226 Liver fibrosis -0.494 1.1e-2 -0.456 1.9e-2 21 Click to see details
GSE19350 CNS germ cell tumors -0.61 1.8e-2 -0.462 6.5e-2 12 Click to see details
GSE32688 Pancreatic cancer 0.331 3.2e-2 0.422 8.1e-3 32 Click to see details
GSE14794 Lymphoblastoid cells 0.184 4.1e-2 0.256 7.4e-3 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.362 5.8e-2 -0.427 3.0e-2 20 Click to see details
GSE21849 B cell lymphoma -0.212 1.3e-1 -0.220 1.3e-1 29 Click to see details
GSE28544 Breast cancer -0.228 1.4e-1 -0.490 7.5e-3 24 Click to see details
GSE27834 Pluripotent stem cells 0.28 1.5e-1 0.209 2.2e-1 16 Click to see details
GSE28260 Renal cortex and medulla -0.295 1.6e-1 -0.253 2.0e-1 13 Click to see details
GSE19536 Breast cancer -0.093 1.8e-1 -0.139 8.4e-2 100 Click to see details
GSE21687 Ependynoma primary tumors -0.094 2.3e-1 -0.093 2.3e-1 64 Click to see details
GSE17306 Multiple myeloma 0.104 2.4e-1 0.065 3.3e-1 49 Click to see details
GSE17498 Multiple myeloma -0.114 2.4e-1 0.014 4.7e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.16 2.5e-1 0.137 2.8e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.141 2.5e-1 0.190 1.8e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.137 2.7e-1 -0.275 1.0e-1 23 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.09 3.3e-1 -0.228 1.4e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.031 3.9e-1 -0.122 1.4e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.037 4.3e-1 0.072 3.7e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.037 4.3e-1 0.072 3.7e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.36 0.01 0.350 0.02 38 Click to see details
CHOL -0.708 0.02 -0.767 0.01 9 Click to see details
THCA -0.267 0.02 -0.250 0.03 59 Click to see details
PRAD 0.223 0.06 0.159 0.14 50 Click to see details
HNSC -0.243 0.06 -0.258 0.05 42 Click to see details
PAAD -0.829 0.09 -0.200 0.4 4 Click to see details
KIRP -0.24 0.09 -0.209 0.13 32 Click to see details
COAD 0.462 0.12 0.143 0.37 8 Click to see details
BLCA 0.265 0.14 0.288 0.12 18 Click to see details
BRCA -0.103 0.18 -0.045 0.34 84 Click to see details
CESC -0.835 0.19 -0.500 0.33 3 Click to see details
UCEC -0.202 0.2 -0.309 0.1 19 Click to see details
STAD -0.123 0.25 -0.073 0.35 32 Click to see details
KIRC -0.076 0.27 -0.112 0.18 68 Click to see details
ESCA 0.208 0.27 0.400 0.11 11 Click to see details
LIHC 0.041 0.39 0.034 0.41 49 Click to see details
KICH 0.054 0.4 0.054 0.4 25 Click to see details
PCPG -0.186 0.44 0.500 0.33 3 Click to see details
LUAD 0.022 0.47 0.112 0.36 12 Click to see details
LUAD 0.022 0.47 0.112 0.36 12 Click to see details
LUAD 0.022 0.47 0.112 0.36 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A