miRTarBase - #MIRT727271 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LRPPRC   
Synonyms CLONE-23970, GP130, LRP130, LSFC
Description leucine rich pentatricopeptide repeat containing
Transcript NM_133259   
Expression
Putative miRNA Targets on LRPPRC
3'UTR of LRPPRC
(miRNA target sites are highlighted)
>LRPPRC|NM_133259|3'UTR
   1 AATAACCAGGCGATACTTTGTTTTGTATATATTTGTGATTCTGTGTCTACATGTTATTTTGAAGTATATCTGAGGGAAAA
  81 ATAAATGAAAATTTTCTTTATGTACTTATGTATGTGTGATGCATGTTCAAAGTCTTATTGACCATAACTCTGTGCACTTG
 161 GTTATTGGACATTTTTGGAGTTTTTTTCTCTGGGAAAAATCGATAGTGTTTTCTTCAATGCTGCTGCTGTGTGAAGCCAT
 241 ACTTTTTCAGGATTCTTCCCCTAATTGGCTCTTTGGTTTCCCTGCTCTGTTTCATTTATTTCATTAAAATGTTATTCCTT
 321 TATTTAAGATTCACTTATTAGTCTGCTGTTTCTCTGAAAAATTTTAGAGCTAGGTATAGTGACCGTGAACTTTCTAACGC
 401 ATAATATTCTGTGATACAGCCATTCCGTACATGTGTGAAGTCCTGCATAACTTTCGAACTTTGTTAAATGTTGGCACTAG
 481 GAGTCATCAGATCTAGGCTTCATCATTTTCCAGTGAGAAGCAGAGACCCAAAGGGCCTGTTACTTGTGCTTGGTCAGGGG
 561 ACTGTCTGTCATGCCTGGAGGCTCTTCGGCACACTTCCCCATCTTTCCCTTCTGCCACTGTGGCTTCAAGCACCTCTGTT
 641 CATAGAGCGTCTCTGAAATTGAGTCTCGGTCATGACTTATCCCGAAGTAGAGCAATGTGTTTCCTCTCATTGTAGTTTCA
 721 GGACTTTGTCAGTACAAGCTCTGCCCTAGGCTTGTTACTTTATACTCATATCCTGAAAAGATGTGATTTCATCTATGAAG
 801 GGGTAAAATATTGGTTTGTATTTAATTGTTTGAAATAAAAGTGATCCCTATATTGAATCTCATGCCTGTTAATATCTACA
 881 CTGTAAGTAGTGACTTCAAAAAAATTCTAAGATAGGTAGTCAGGAGAGTTTGCCATTATAAAAGGTGTCTTAATAATATG
 961 GAATATTGACCTAACTGGAGATGAGGTAATTAATTACCGAAATGTTGAAAATGTTTTGAGAACTCTCCCCATTTTGGGGT
1041 ATTCCTTGTTCATTTGAATTTGGTGACTCCCTACTGTTCCAGTTTCAGTGCCAACTTGGGTCACACTGTTCACATCAGGG
1121 GAGACCTTGCCTTGGGGACGTAGGCGGGCCTCTTGCAACTTGTGCTGTTGACCTTCTGTCTTGTGGAACTCTCTCTCCTG
1201 CATCTGCTACCTGCCCGCAGATGGTGTGAGGGAGGGTTGATGGCGGGAAGCCAGGAAGTAGATGTCATCATGGTATTGGC
1281 CAGGCTTTTACTTCAACTCTTTTTGTGGCGTTAGATTTAAGGAAGCAGGGGGCATGGCCAACGTTGAGTCTTGGCCCAGT
1361 GGACATAGTGCGGCTTTCCCTTGAGCACTGCCCAGATGCAGGACCTGCACATGTTACAGGTTTGCCAAAAGCATCTTTTT
1441 TTTTTTTTTTTTTTTTGAGATAGTCTTGCTCTGTTGCTTAAGCCAGAGTGCAGTGGCGCAATCTCAGCTCACTGCAACCT
1521 CCGCCTCCTGGGTTCAAGTGATTCTTGTGCCTCAGCCTCCCACGTAGCTGAGATTACAGGCTTGCACCACCATGTTCAGC
1601 TAATTTTTGTATGGTAAAGACGGAGTTTCACCATGTTGGCCAGGTTGGTCTCGAACTCCTGGCCCCAAGTGATCCTCCCC
1681 CTGCGCTCGCTTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCACGCCTGGCCAAGAGCCTCACTCCTGTCT
1761 TTAGTGATTGCACTGAAGCAGGCCTCATTTTTTTGCAGTCATGCTAACCACAAGTTAGTCAACATTCACTAATTGACATT
1841 CATTAGAATAGGTCTCCAAGGTGAGGCATAACGTTGGGGTGTAATCTGGATTTCGCAGTCATCTTTTTGGGGAAACTGAA
1921 AGTACCATCTCATTTGCATGAAGTGACTCCACACTGGCCCTGTATATGGACTCTGGTAAAATGTGAGTGTGGTACAGAGG
2001 AAATAGGTAAGACCCCCTTATCTAGCCCTCTCGGCAGCAGCGGGGGGGTGTTACAAAGGACTAGCTGTTCAAATATCTTT
2081 TGTATTGTATTGATTCCCCTATTGAATATAAATATTTAAAGTATAATAACTATACTGTAGGTGGGCTTATGAGTGTTCTA
2161 AATATCTAATAGCTAAATTGAAATAAGTAGAAATATAAACAATTTAGCAGCTTTCTGTAATACATTTACACTCAAATTAT
2241 AAGCAGCTAATTCTAAAAAAGATGTCACTGTAAACTATTGAGAACTATAGTATTTTATATATAATTATATGTTCATGTAT
2321 TTGAACCCAAAATAATTTTAACTGAAATGCTTTGAATAAAGTATACTGTAAATATCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUAC-ACGACGAu 5'
                :||  ||| ||||||| 
Target 5' ttttctTCA--ATGCTGCTGCTg 3'
209 - 229 148.00 -12.20
2
miRNA  3' guguUUGGUAAU-ACACGACGAu 5'
              | ::|||| | |||||:| 
Target 5' attcACTTATTAGTCTGCTGTTt 3'
329 - 351 142.00 -11.40
3
miRNA  3' guGUUUGG-UAAU-----ACACGACGAu 5'
            |:::||  ||:     |||||||:| 
Target 5' ggCGGGCCTCTTGCAACTTGTGCTGTTg 3'
1143 - 1170 136.00 -17.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
896786 110 ClinVar
896785 218 ClinVar
336142 343 ClinVar
336141 399 ClinVar
336140 409 ClinVar
896784 420 ClinVar
336139 456 ClinVar
336138 485 ClinVar
895386 518 ClinVar
336137 534 ClinVar
336136 556 ClinVar
336135 577 ClinVar
895385 587 ClinVar
336134 590 ClinVar
336133 647 ClinVar
336132 667 ClinVar
898369 734 ClinVar
898368 735 ClinVar
336131 825 ClinVar
898367 996 ClinVar
336130 1088 ClinVar
336129 1121 ClinVar
336128 1152 ClinVar
336127 1335 ClinVar
336126 1343 ClinVar
897197 1355 ClinVar
897196 1370 ClinVar
336125 1371 ClinVar
897195 1372 ClinVar
336124 1391 ClinVar
897194 1435 ClinVar
336123 1436 ClinVar
336121 1457 ClinVar
336122 1457 ClinVar
897193 1458 ClinVar
336120 1498 ClinVar
336119 1563 ClinVar
336118 1564 ClinVar
336117 1584 ClinVar
336116 1587 ClinVar
896724 1652 ClinVar
336114 1653 ClinVar
336115 1653 ClinVar
336112 1665 ClinVar
336113 1665 ClinVar
895304 1684 ClinVar
895303 1685 ClinVar
895302 1689 ClinVar
895301 1717 ClinVar
895300 1719 ClinVar
898293 1752 ClinVar
336111 1806 ClinVar
336110 1816 ClinVar
336109 1872 ClinVar
898292 1894 ClinVar
336108 1895 ClinVar
898291 1895 ClinVar
336107 1911 ClinVar
336106 1961 ClinVar
336105 1981 ClinVar
336103 2041 ClinVar
336104 2041 ClinVar
897130 2042 ClinVar
336102 2049 ClinVar
336101 2099 ClinVar
897129 2157 ClinVar
336100 2176 ClinVar
896669 2192 ClinVar
896668 2224 ClinVar
896667 2230 ClinVar
336099 2245 ClinVar
336098 2277 ClinVar
896666 2289 ClinVar
336097 2376 ClinVar
COSN30161743 7 COSMIC
COSN31586308 11 COSMIC
COSN31535225 12 COSMIC
COSN20074556 31 COSMIC
COSN22645703 72 COSMIC
COSN30179948 72 COSMIC
COSN30483371 83 COSMIC
COSN31530021 93 COSMIC
COSN30121225 96 COSMIC
COSN31528622 98 COSMIC
COSN30494746 102 COSMIC
COSN30162209 140 COSMIC
COSN31586083 178 COSMIC
COSN30159773 188 COSMIC
COSN30169120 218 COSMIC
COSN21992023 515 COSMIC
COSN20896635 574 COSMIC
COSN22579447 765 COSMIC
COSN28162819 897 COSMIC
COSN31961644 2042 COSMIC
rs1136998 556 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs557542485 1 dbSNP
rs377493253 7 dbSNP
rs1245880423 9 dbSNP
rs1306552183 10 dbSNP
rs752744805 11 dbSNP
rs765322876 12 dbSNP
rs1306615929 13 dbSNP
rs1164909616 14 dbSNP
rs536377628 15 dbSNP
rs766295933 17 dbSNP
rs1164136276 18 dbSNP
rs1355399029 19 dbSNP
rs1472875052 20 dbSNP
rs760500188 21 dbSNP
rs768505442 25 dbSNP
rs1244435288 27 dbSNP
rs567408497 27 dbSNP
rs147974983 28 dbSNP
rs761484235 29 dbSNP
rs773737683 30 dbSNP
rs746038924 35 dbSNP
rs768156296 37 dbSNP
rs1331821796 38 dbSNP
rs748737002 43 dbSNP
rs1391148155 44 dbSNP
rs958560079 47 dbSNP
rs781781603 48 dbSNP
rs1293766515 49 dbSNP
rs771536641 51 dbSNP
rs1156624713 57 dbSNP
rs917817722 59 dbSNP
rs769199230 60 dbSNP
rs1461504725 64 dbSNP
rs1470412400 65 dbSNP
rs1339009554 66 dbSNP
rs1416439846 67 dbSNP
rs1185365389 70 dbSNP
rs1308279144 72 dbSNP
rs1338083134 75 dbSNP
rs1478572162 76 dbSNP
rs990706166 77 dbSNP
rs1242523378 81 dbSNP
rs747768734 83 dbSNP
rs959208478 84 dbSNP
rs1192168639 86 dbSNP
rs1016024030 87 dbSNP
rs1005947284 89 dbSNP
rs1459542340 90 dbSNP
rs996485750 99 dbSNP
rs751984775 100 dbSNP
rs1269353430 102 dbSNP
rs1179635198 105 dbSNP
rs867369307 106 dbSNP
rs1178784096 109 dbSNP
rs1214467581 109 dbSNP
rs997583952 110 dbSNP
rs1465574441 114 dbSNP
rs1298791565 117 dbSNP
rs1271286624 119 dbSNP
rs899553252 120 dbSNP
rs1328862645 123 dbSNP
rs1346467804 124 dbSNP
rs1340269764 126 dbSNP
rs1041697979 130 dbSNP
rs1040777027 142 dbSNP
rs1270020129 143 dbSNP
rs530836731 144 dbSNP
rs886942029 146 dbSNP
rs1251360541 152 dbSNP
rs1333400412 156 dbSNP
rs1327171443 158 dbSNP
rs537963933 160 dbSNP
rs1047360225 167 dbSNP
rs192776097 171 dbSNP
rs1194001851 176 dbSNP
rs188181819 181 dbSNP
rs1037668600 188 dbSNP
rs552418054 188 dbSNP
rs1393130666 191 dbSNP
rs1162126397 200 dbSNP
rs185357379 201 dbSNP
rs924006936 202 dbSNP
rs1168438016 204 dbSNP
rs1366754864 213 dbSNP
rs926644428 213 dbSNP
rs982216033 215 dbSNP
rs949524933 218 dbSNP
rs1474299169 220 dbSNP
rs367668787 224 dbSNP
rs1177925407 225 dbSNP
rs1295932382 226 dbSNP
rs112242789 227 dbSNP
rs988726633 228 dbSNP
rs1327617531 243 dbSNP
rs990712152 250 dbSNP
rs958259453 256 dbSNP
rs1360024312 261 dbSNP
rs1194198061 267 dbSNP
rs1289303537 271 dbSNP
rs1488071721 275 dbSNP
rs959260805 275 dbSNP
rs1187259070 277 dbSNP
rs1264145033 280 dbSNP
rs1032558226 281 dbSNP
rs1251249037 282 dbSNP
rs1426764654 285 dbSNP
rs1188044920 289 dbSNP
rs909076813 293 dbSNP
rs984576218 298 dbSNP
rs1427086959 313 dbSNP
rs1162287128 314 dbSNP
rs1349660850 316 dbSNP
rs192120940 317 dbSNP
rs1289036994 326 dbSNP
rs1386722254 327 dbSNP
rs1438657031 338 dbSNP
rs1432498378 340 dbSNP
rs144519599 343 dbSNP
rs1019277039 346 dbSNP
rs773939391 350 dbSNP
rs1382955393 351 dbSNP
rs1007957411 352 dbSNP
rs1212959043 365 dbSNP
rs975819895 370 dbSNP
rs1320834523 373 dbSNP
rs966107492 375 dbSNP
rs1017240835 377 dbSNP
rs529783501 383 dbSNP
rs751275402 384 dbSNP
rs1304567480 385 dbSNP
rs560979297 388 dbSNP
rs1243811439 394 dbSNP
rs868223800 398 dbSNP
rs149268737 399 dbSNP
rs1182212307 400 dbSNP
rs1001024384 401 dbSNP
rs1452286007 404 dbSNP
rs762389367 407 dbSNP
rs187382374 409 dbSNP
rs1455303048 411 dbSNP
rs1354819175 420 dbSNP
rs1327766986 422 dbSNP
rs1055711828 426 dbSNP
rs902634138 427 dbSNP
rs1042867288 431 dbSNP
rs758432286 432 dbSNP
rs1378393864 433 dbSNP
rs558579879 434 dbSNP
rs1393169939 435 dbSNP
rs1308855146 436 dbSNP
rs1326885371 439 dbSNP
rs896498992 440 dbSNP
rs1263996269 441 dbSNP
rs867939296 451 dbSNP
rs1179092929 454 dbSNP
rs765306183 455 dbSNP
rs886056052 456 dbSNP
rs1046862029 459 dbSNP
rs1289387653 461 dbSNP
rs1202724045 463 dbSNP
rs949467636 463 dbSNP
rs913991604 467 dbSNP
rs530559366 470 dbSNP
rs374114054 478 dbSNP
rs527260010 483 dbSNP
rs886056051 485 dbSNP
rs1472469252 486 dbSNP
rs1210593237 488 dbSNP
rs1429588355 490 dbSNP
rs1346420097 493 dbSNP
rs909125708 494 dbSNP
rs984630302 496 dbSNP
rs1358123224 498 dbSNP
rs566691836 501 dbSNP
rs1442821873 507 dbSNP
rs925486398 508 dbSNP
rs1299886453 509 dbSNP
rs1348322915 512 dbSNP
rs1409003253 515 dbSNP
rs138559252 518 dbSNP
rs1325887475 527 dbSNP
rs964284291 531 dbSNP
rs553327890 534 dbSNP
rs752229013 536 dbSNP
rs1277983084 537 dbSNP
rs1207155469 546 dbSNP
rs1231682786 548 dbSNP
rs929135954 550 dbSNP
rs1200647823 551 dbSNP
rs1271554566 552 dbSNP
rs1481202613 555 dbSNP
rs1136998 556 dbSNP
rs1410047116 560 dbSNP
rs1172375178 568 dbSNP
rs1368653817 570 dbSNP
rs567493340 573 dbSNP
rs183378286 577 dbSNP
rs1347229728 579 dbSNP
rs1434573173 581 dbSNP
rs1017303142 584 dbSNP
rs537108237 585 dbSNP
rs1216420633 586 dbSNP
rs760992842 587 dbSNP
rs571347571 588 dbSNP
rs772553791 589 dbSNP
rs886056050 590 dbSNP
rs551748245 592 dbSNP
rs1475428840 597 dbSNP
rs34997996 601 dbSNP
rs954310874 603 dbSNP
rs1433853204 607 dbSNP
rs1448777391 608 dbSNP
rs1164206982 615 dbSNP
rs1373321048 616 dbSNP
rs1367129147 618 dbSNP
rs1403404197 629 dbSNP
rs1323081748 636 dbSNP
rs995292129 642 dbSNP
rs886056049 647 dbSNP
rs1034210383 648 dbSNP
rs557012670 649 dbSNP
rs1317784342 652 dbSNP
rs1354620836 655 dbSNP
rs902695034 666 dbSNP
rs533028399 667 dbSNP
rs566741940 668 dbSNP
rs546542434 671 dbSNP
rs1258476076 672 dbSNP
rs538813384 679 dbSNP
rs1055085499 680 dbSNP
rs1184061504 683 dbSNP
rs140977797 684 dbSNP
rs1471663002 694 dbSNP
rs892515644 695 dbSNP
rs1052937846 696 dbSNP
rs1217158430 704 dbSNP
rs936797307 707 dbSNP
rs759563125 708 dbSNP
rs1162405139 709 dbSNP
rs1316800806 712 dbSNP
rs1402655301 723 dbSNP
rs561016106 724 dbSNP
rs1039876978 727 dbSNP
rs1453492312 727 dbSNP
rs1048975539 731 dbSNP
rs114517881 734 dbSNP
rs919101190 738 dbSNP
rs1280491170 739 dbSNP
rs1040187250 744 dbSNP
rs1229778251 748 dbSNP
rs912809993 755 dbSNP
rs1265861317 763 dbSNP
rs1464008394 764 dbSNP
rs1203784960 769 dbSNP
rs202017188 770 dbSNP
rs1413726335 775 dbSNP
rs1233240605 780 dbSNP
rs138139019 781 dbSNP
rs986449843 783 dbSNP
rs765355185 784 dbSNP
rs774722291 785 dbSNP
rs368384898 795 dbSNP
rs1353355122 801 dbSNP
rs1290374030 804 dbSNP
rs1178640161 811 dbSNP
rs1400230576 814 dbSNP
rs1395952223 816 dbSNP
rs1330149380 818 dbSNP
rs17031753 825 dbSNP
rs1408407608 828 dbSNP
rs985832162 828 dbSNP
rs1157089228 830 dbSNP
rs1328006272 831 dbSNP
rs544975449 831 dbSNP
rs957028189 832 dbSNP
rs1418576841 833 dbSNP
rs1342347046 834 dbSNP
rs769306744 837 dbSNP
rs925574395 847 dbSNP
rs980111633 849 dbSNP
rs1483886983 850 dbSNP
rs1179787915 855 dbSNP
rs962483110 858 dbSNP
rs865788168 859 dbSNP
rs1480878275 868 dbSNP
rs1021569745 872 dbSNP
rs1164493037 875 dbSNP
rs1034158026 883 dbSNP
rs1465618393 886 dbSNP
rs1001386862 890 dbSNP
rs769604180 890 dbSNP
rs1428421932 893 dbSNP
rs77291236 899 dbSNP
rs1013746889 902 dbSNP
rs1264333820 903 dbSNP
rs1405179301 905 dbSNP
rs961117813 911 dbSNP
rs1302965312 913 dbSNP
rs1375269798 916 dbSNP
rs1231919246 920 dbSNP
rs1251779216 929 dbSNP
rs1344188029 930 dbSNP
rs1187438701 932 dbSNP
rs971297507 944 dbSNP
rs1485854556 945 dbSNP
rs1024648551 947 dbSNP
rs1206354491 949 dbSNP
rs1336325081 951 dbSNP
rs1010186202 954 dbSNP
rs1265560861 959 dbSNP
rs1033730223 961 dbSNP
rs892460341 963 dbSNP
rs1052469480 966 dbSNP
rs1000891137 968 dbSNP
rs903959593 970 dbSNP
rs1448186830 971 dbSNP
rs1168592119 978 dbSNP
rs1319523318 992 dbSNP
rs1294873672 993 dbSNP
rs572718388 996 dbSNP
rs1295650334 997 dbSNP
rs1385914500 997 dbSNP
rs1039809618 998 dbSNP
rs942880747 999 dbSNP
rs1359826536 1004 dbSNP
rs1246753942 1005 dbSNP
rs1287057365 1006 dbSNP
rs1488264852 1008 dbSNP
rs1206002158 1012 dbSNP
rs1249980411 1018 dbSNP
rs1463606679 1019 dbSNP
rs1442934533 1023 dbSNP
rs887793513 1025 dbSNP
rs1049026877 1026 dbSNP
rs560017245 1029 dbSNP
rs542906199 1035 dbSNP
rs1368305051 1038 dbSNP
rs1457085953 1046 dbSNP
rs573906522 1048 dbSNP
rs1320813224 1051 dbSNP
rs1390126418 1053 dbSNP
rs993844489 1057 dbSNP
rs1277154863 1066 dbSNP
rs190916102 1069 dbSNP
rs1230003145 1071 dbSNP
rs1040642212 1072 dbSNP
rs944553517 1073 dbSNP
rs79225555 1088 dbSNP
rs375051924 1090 dbSNP
rs1050179881 1100 dbSNP
rs1051781421 1102 dbSNP
rs1208222171 1111 dbSNP
rs930269186 1113 dbSNP
rs371325663 1121 dbSNP
rs1180685103 1123 dbSNP
rs973748253 1124 dbSNP
rs150371069 1126 dbSNP
rs1420062655 1127 dbSNP
rs377748945 1130 dbSNP
rs1413756308 1131 dbSNP
rs1455349959 1136 dbSNP
rs927031211 1137 dbSNP
rs979895787 1138 dbSNP
rs1469273438 1139 dbSNP
rs187644515 1140 dbSNP
rs1212501225 1141 dbSNP
rs1378103649 1143 dbSNP
rs565905000 1145 dbSNP
rs182764724 1146 dbSNP
rs776272264 1148 dbSNP
rs562361644 1152 dbSNP
rs1279410232 1162 dbSNP
rs1030931422 1165 dbSNP
rs1208567679 1167 dbSNP
rs1255942522 1173 dbSNP
rs1002261142 1178 dbSNP
rs567517015 1178 dbSNP
rs1184743839 1180 dbSNP
rs952110266 1181 dbSNP
rs1028096729 1183 dbSNP
rs1000838670 1184 dbSNP
rs191289444 1190 dbSNP
rs1018306665 1191 dbSNP
rs543968543 1192 dbSNP
rs1007014215 1195 dbSNP
rs1009195006 1196 dbSNP
rs762122753 1198 dbSNP
rs888964069 1198 dbSNP
rs1050234413 1199 dbSNP
rs1275675541 1202 dbSNP
rs891273206 1204 dbSNP
rs1369755405 1207 dbSNP
rs1217575370 1209 dbSNP
rs1300725275 1215 dbSNP
rs1051302600 1216 dbSNP
rs768464170 1217 dbSNP
rs904265656 1232 dbSNP
rs1203927898 1233 dbSNP
rs140471585 1235 dbSNP
rs1188920367 1236 dbSNP
rs1038001538 1244 dbSNP
rs941011693 1245 dbSNP
rs926977766 1251 dbSNP
rs979843383 1261 dbSNP
rs746797688 1264 dbSNP
rs1185135769 1267 dbSNP
rs949853426 1270 dbSNP
rs917055776 1274 dbSNP
rs1324400153 1291 dbSNP
rs1455121247 1292 dbSNP
rs1394992436 1294 dbSNP
rs1351803528 1299 dbSNP
rs916869013 1300 dbSNP
rs1430950734 1301 dbSNP
rs1231169336 1309 dbSNP
rs551163358 1310 dbSNP
rs1341842018 1319 dbSNP
rs992437521 1322 dbSNP
rs988674352 1326 dbSNP
rs1196044273 1328 dbSNP
rs1480086067 1330 dbSNP
rs1219004482 1331 dbSNP
rs956125250 1332 dbSNP
rs1251832240 1333 dbSNP
rs76970610 1335 dbSNP
rs978683591 1342 dbSNP
rs75002669 1343 dbSNP
rs543346730 1349 dbSNP
rs1415763211 1354 dbSNP
rs1018254166 1357 dbSNP
rs1302582299 1360 dbSNP
rs1403806353 1362 dbSNP
rs980890840 1364 dbSNP
rs1007375933 1365 dbSNP
rs1437397825 1368 dbSNP
rs891226575 1369 dbSNP
rs1319087266 1370 dbSNP
rs111381413 1371 dbSNP
rs750310194 1372 dbSNP
rs972518909 1380 dbSNP
rs1354769435 1383 dbSNP
rs1272167431 1388 dbSNP
rs886056048 1391 dbSNP
rs1329189715 1395 dbSNP
rs1210021108 1397 dbSNP
rs994350756 1400 dbSNP
rs1245719971 1401 dbSNP
rs1307742703 1410 dbSNP
rs1238917979 1413 dbSNP
rs1471694089 1424 dbSNP
rs1243311964 1433 dbSNP
rs78163628 1435 dbSNP
rs886056047 1436 dbSNP
rs75248019 1437 dbSNP
rs1315253731 1438 dbSNP
rs1435719582 1447 dbSNP
rs1038622915 1451 dbSNP
rs1375147035 1456 dbSNP
rs1233375133 1457 dbSNP
rs1336725408 1457 dbSNP
rs1339016578 1457 dbSNP
rs1388077195 1457 dbSNP
rs1415541680 1457 dbSNP
rs1427128584 1457 dbSNP
rs1447799764 1457 dbSNP
rs370567436 1457 dbSNP
rs397765288 1457 dbSNP
rs57494476 1457 dbSNP
rs749846219 1457 dbSNP
rs755308534 1457 dbSNP
rs1276151312 1458 dbSNP
rs371572374 1458 dbSNP
rs143205987 1459 dbSNP
rs1275090422 1460 dbSNP
rs1455764820 1461 dbSNP
rs962076624 1462 dbSNP
rs1203214974 1464 dbSNP
rs1250108512 1465 dbSNP
rs1181869537 1466 dbSNP
rs563568324 1471 dbSNP
rs1201061476 1474 dbSNP
rs1418201115 1477 dbSNP
rs1249148223 1479 dbSNP
rs905506413 1480 dbSNP
rs1454216727 1485 dbSNP
rs11681603 1486 dbSNP
rs1044097316 1492 dbSNP
rs561823531 1497 dbSNP
rs142253135 1498 dbSNP
rs1395284100 1499 dbSNP
rs1387045400 1500 dbSNP
rs917023738 1508 dbSNP
rs1328924027 1517 dbSNP
rs1233389647 1518 dbSNP
rs989010728 1522 dbSNP
rs1343981167 1524 dbSNP
rs1028865626 1532 dbSNP
rs1250596283 1535 dbSNP
rs1261434962 1542 dbSNP
rs376887272 1544 dbSNP
rs1238402805 1551 dbSNP
rs925828757 1553 dbSNP
rs1189715390 1554 dbSNP
rs377323893 1561 dbSNP
rs186518252 1563 dbSNP
rs142436911 1564 dbSNP
rs757335680 1567 dbSNP
rs11681588 1572 dbSNP
rs534760362 1573 dbSNP
rs1439555956 1577 dbSNP
rs753954611 1579 dbSNP
rs985498507 1581 dbSNP
rs372330583 1584 dbSNP
rs769015511 1585 dbSNP
rs886056046 1587 dbSNP
rs994692776 1592 dbSNP
rs961532985 1593 dbSNP
rs1247189071 1602 dbSNP
rs1263923514 1606 dbSNP
rs1334201137 1608 dbSNP
rs1209402129 1610 dbSNP
rs1456246335 1611 dbSNP
rs939631902 1614 dbSNP
rs1017135278 1621 dbSNP
rs1005793965 1622 dbSNP
rs1425944366 1624 dbSNP
rs1166663115 1625 dbSNP
rs926867989 1630 dbSNP
rs980943075 1632 dbSNP
rs1460635351 1634 dbSNP
rs1159239858 1635 dbSNP
rs764292508 1636 dbSNP
rs1475307905 1637 dbSNP
rs540314846 1637 dbSNP
rs906126488 1638 dbSNP
rs181660885 1639 dbSNP
rs920726443 1640 dbSNP
rs1379562254 1641 dbSNP
rs1397594363 1643 dbSNP
rs972187137 1647 dbSNP
rs1256589583 1649 dbSNP
rs1139249 1652 dbSNP
rs886056045 1653 dbSNP
rs1327171614 1654 dbSNP
rs1448721321 1657 dbSNP
rs1257125474 1659 dbSNP
rs1484421163 1662 dbSNP
rs1139250 1665 dbSNP
rs1474672344 1669 dbSNP
rs1052871883 1671 dbSNP
rs953315534 1673 dbSNP
rs1158235982 1682 dbSNP
rs1416814771 1682 dbSNP
rs190524585 1684 dbSNP
rs774874630 1685 dbSNP
rs1234170522 1688 dbSNP
rs185767322 1689 dbSNP
rs943269290 1699 dbSNP
rs746444641 1700 dbSNP
rs113545857 1702 dbSNP
rs1314437968 1707 dbSNP
rs1209433647 1708 dbSNP
rs1279971675 1711 dbSNP
rs1483592475 1720 dbSNP
rs1205362849 1721 dbSNP
rs1253562997 1728 dbSNP
rs571309999 1733 dbSNP
rs551465491 1734 dbSNP
rs528164545 1736 dbSNP
rs1056757151 1740 dbSNP
rs1425329816 1740 dbSNP
rs1171692259 1744 dbSNP
rs1327601322 1746 dbSNP
rs112911907 1754 dbSNP
rs1310048863 1755 dbSNP
rs1352953548 1756 dbSNP
rs1441822198 1761 dbSNP
rs766846077 1762 dbSNP
rs1369822275 1763 dbSNP
rs1232663393 1768 dbSNP
rs995469109 1771 dbSNP
rs1385832859 1772 dbSNP
rs985832695 1773 dbSNP
rs181941155 1782 dbSNP
rs1271385245 1789 dbSNP
rs922631345 1793 dbSNP
rs1305385517 1794 dbSNP
rs34702166 1795 dbSNP
rs930868796 1795 dbSNP
rs920790290 1797 dbSNP
rs1489183744 1801 dbSNP
rs1036917885 1802 dbSNP
rs972821413 1803 dbSNP
rs1252336336 1805 dbSNP
rs886056044 1806 dbSNP
rs1170232185 1812 dbSNP
rs940821198 1814 dbSNP
rs886056043 1816 dbSNP
rs911962015 1821 dbSNP
rs1017084240 1828 dbSNP
rs1412601627 1829 dbSNP
rs1351637978 1831 dbSNP
rs776347572 1833 dbSNP
rs1325353425 1835 dbSNP
rs1366530190 1835 dbSNP
rs1005741705 1843 dbSNP
rs11688719 1846 dbSNP
rs1339145696 1848 dbSNP
rs970256944 1852 dbSNP
rs1161312080 1861 dbSNP
rs1476271771 1866 dbSNP
rs1336243514 1868 dbSNP
rs147686285 1872 dbSNP
rs546479716 1873 dbSNP
rs1195328161 1877 dbSNP
rs1463454717 1877 dbSNP
rs1240081531 1879 dbSNP
rs529577116 1880 dbSNP
rs1474971557 1883 dbSNP
rs1182623045 1886 dbSNP
rs1416188953 1889 dbSNP
rs563480210 1894 dbSNP
rs886056042 1895 dbSNP
rs998534484 1896 dbSNP
rs879091284 1898 dbSNP
rs190578201 1903 dbSNP
rs533572540 1911 dbSNP
rs1216481276 1919 dbSNP
rs1356955635 1919 dbSNP
rs1329248127 1925 dbSNP
rs959853928 1929 dbSNP
rs1446395152 1931 dbSNP
rs1035402775 1934 dbSNP
rs1259422669 1937 dbSNP
rs1474345434 1943 dbSNP
rs1269926524 1945 dbSNP
rs910410137 1947 dbSNP
rs1412727031 1949 dbSNP
rs1226892750 1958 dbSNP
rs1051682935 1959 dbSNP
rs541683193 1961 dbSNP
rs184466584 1973 dbSNP
rs1415597457 1974 dbSNP
rs972741925 1975 dbSNP
rs1374098859 1978 dbSNP
rs180886841 1981 dbSNP
rs909969831 1983 dbSNP
rs1048026359 1985 dbSNP
rs984253792 1991 dbSNP
rs970212591 1992 dbSNP
rs1349853788 1996 dbSNP
rs1396983371 1999 dbSNP
rs1219807126 2002 dbSNP
rs1282109699 2006 dbSNP
rs1484576296 2011 dbSNP
rs1167698703 2012 dbSNP
rs1252851857 2015 dbSNP
rs555767893 2018 dbSNP
rs995122586 2018 dbSNP
rs542262231 2022 dbSNP
rs993082266 2023 dbSNP
rs1477743533 2026 dbSNP
rs1434517856 2032 dbSNP
rs960581665 2033 dbSNP
rs7581308 2041 dbSNP
rs998481979 2042 dbSNP
rs932033215 2044 dbSNP
rs115795646 2045 dbSNP
rs1275150222 2046 dbSNP
rs1350766243 2047 dbSNP
rs1341722946 2048 dbSNP
rs546907287 2049 dbSNP
rs1452273249 2055 dbSNP
rs1281670155 2056 dbSNP
rs978746877 2056 dbSNP
rs968696148 2062 dbSNP
rs1021323717 2065 dbSNP
rs1007301558 2066 dbSNP
rs1169604639 2066 dbSNP
rs1375208927 2076 dbSNP
rs796391895 2077 dbSNP
rs557605901 2083 dbSNP
rs988703819 2083 dbSNP
rs1461539399 2093 dbSNP
rs1327380191 2096 dbSNP
rs1368671394 2096 dbSNP
rs1440158008 2098 dbSNP
rs771863074 2099 dbSNP
rs1327987950 2101 dbSNP
rs1035458371 2103 dbSNP
rs1443971400 2104 dbSNP
rs1052058602 2115 dbSNP
rs1001257136 2122 dbSNP
rs537303052 2123 dbSNP
rs969760031 2126 dbSNP
rs1335963228 2127 dbSNP
rs375618674 2129 dbSNP
rs933220825 2130 dbSNP
rs1307249565 2132 dbSNP
rs1190527410 2133 dbSNP
rs897753598 2133 dbSNP
rs1372112260 2134 dbSNP
rs1461687874 2136 dbSNP
rs1036995002 2137 dbSNP
rs1427577971 2140 dbSNP
rs1391737984 2141 dbSNP
rs1401318062 2147 dbSNP
rs745696250 2150 dbSNP
rs8057 2153 dbSNP
rs1376980323 2157 dbSNP
rs536044941 2163 dbSNP
rs1289391856 2164 dbSNP
rs896779852 2166 dbSNP
rs1413789784 2170 dbSNP
rs73924082 2176 dbSNP
rs948846616 2177 dbSNP
rs557665852 2183 dbSNP
rs1235438562 2185 dbSNP
rs1470668173 2187 dbSNP
rs1291442012 2191 dbSNP
rs1334275975 2191 dbSNP
rs189755235 2192 dbSNP
rs993425456 2197 dbSNP
rs1263049936 2199 dbSNP
rs960282153 2199 dbSNP
rs1180201406 2203 dbSNP
rs752219128 2203 dbSNP
rs4437011 2207 dbSNP
rs932085563 2210 dbSNP
rs1032348849 2216 dbSNP
rs1204897606 2217 dbSNP
rs900578055 2219 dbSNP
rs1475330099 2221 dbSNP
rs1043099515 2223 dbSNP
rs757205247 2224 dbSNP
rs866243257 2230 dbSNP
rs565623607 2233 dbSNP
rs758080975 2245 dbSNP
rs369491973 2248 dbSNP
rs1288066344 2249 dbSNP
rs1375842168 2255 dbSNP
rs1311316021 2261 dbSNP
rs1354857235 2261 dbSNP
rs34738090 2261 dbSNP
rs938588713 2261 dbSNP
rs928493758 2271 dbSNP
rs1309306504 2272 dbSNP
rs1315645917 2273 dbSNP
rs1007249081 2275 dbSNP
rs886056041 2277 dbSNP
rs530075449 2278 dbSNP
rs752173897 2281 dbSNP
rs888873742 2288 dbSNP
rs777772528 2289 dbSNP
rs997761683 2290 dbSNP
rs1407554267 2299 dbSNP
rs1409607205 2301 dbSNP
rs897705723 2302 dbSNP
rs1158307742 2304 dbSNP
rs1357161608 2309 dbSNP
rs973814895 2310 dbSNP
rs1447252248 2328 dbSNP
rs1375051279 2330 dbSNP
rs548632642 2332 dbSNP
rs1299965735 2337 dbSNP
rs1371286323 2340 dbSNP
rs1391265005 2346 dbSNP
rs1015238632 2356 dbSNP
rs1232518428 2361 dbSNP
rs1280134297 2362 dbSNP
rs756190657 2367 dbSNP
rs528878345 2372 dbSNP
rs886056040 2376 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.555 5.5e-3 0.678 5.1e-4 20 Click to see details
GSE21032 Prostate cancer 0.234 1.7e-2 0.196 3.8e-2 83 Click to see details
GSE28260 Renal cortex and medulla -0.489 4.5e-2 -0.516 3.6e-2 13 Click to see details
GSE14794 Lymphoblastoid cells 0.141 9.2e-2 0.124 1.2e-1 90 Click to see details
GSE21687 Ependynoma primary tumors -0.165 9.6e-2 -0.132 1.5e-1 64 Click to see details
GSE19536 Breast cancer 0.129 1.0e-1 0.093 1.8e-1 100 Click to see details
GSE38226 Liver fibrosis 0.287 1.0e-1 0.307 8.8e-2 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.232 1.3e-1 0.296 7.5e-2 25 Click to see details
GSE21849 B cell lymphoma 0.187 1.7e-1 0.500 2.9e-3 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.155 2.3e-1 0.178 2.0e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.17 2.4e-1 0.192 2.1e-1 20 Click to see details
GSE17306 Multiple myeloma 0.09 2.7e-1 0.091 2.7e-1 49 Click to see details
GSE28544 Breast cancer 0.111 3.0e-1 0.360 4.2e-2 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.113 3.0e-1 -0.179 2.1e-1 23 Click to see details
GSE32688 Pancreatic cancer -0.042 4.1e-1 0.084 3.2e-1 32 Click to see details
GSE27834 Pluripotent stem cells -0.046 4.3e-1 0.015 4.8e-1 16 Click to see details
GSE19350 CNS germ cell tumors -0.051 4.4e-1 -0.280 1.9e-1 12 Click to see details
GSE17498 Multiple myeloma -0.023 4.4e-1 0.040 4.0e-1 40 Click to see details
GSE19783 ER- ER- breast cancer -0.009 4.7e-1 -0.037 3.7e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.01 4.8e-1 -0.089 3.4e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.01 4.8e-1 -0.089 3.4e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.38 0 -0.324 0.01 59 Click to see details
KIRP -0.451 0 -0.405 0.01 32 Click to see details
KIRC -0.238 0.03 -0.225 0.03 68 Click to see details
CHOL -0.561 0.06 -0.383 0.15 9 Click to see details
LIHC -0.215 0.07 -0.223 0.06 49 Click to see details
BLCA -0.344 0.08 -0.352 0.08 18 Click to see details
LUSC -0.219 0.09 -0.165 0.16 38 Click to see details
KICH -0.24 0.12 -0.191 0.18 25 Click to see details
HNSC 0.146 0.18 0.078 0.31 42 Click to see details
STAD -0.168 0.18 -0.254 0.08 32 Click to see details
PAAD 0.628 0.19 0.400 0.3 4 Click to see details
PRAD 0.12 0.2 -0.042 0.39 50 Click to see details
PCPG -0.792 0.21 -1.000 0.5 3 Click to see details
LUAD 0.252 0.21 0.189 0.28 12 Click to see details
CESC 0.65 0.27 0.500 0.33 3 Click to see details
COAD 0.169 0.34 -0.024 0.48 8 Click to see details
UCEC 0.087 0.36 -0.075 0.38 19 Click to see details
ESCA -0.112 0.37 -0.136 0.35 11 Click to see details
BRCA 0.002 0.49 -0.070 0.26 84 Click to see details
BRCA 0.002 0.49 -0.070 0.26 84 Click to see details
BRCA 0.002 0.49 -0.070 0.26 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*