miRTarBase - #MIRT727198 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MIB1   
Synonyms DIP-1, DIP1, LVNC7, MIB, ZZANK2, ZZZ6
Description mindbomb E3 ubiquitin protein ligase 1
Transcript NM_020774   
Expression
Putative miRNA Targets on MIB1
3'UTR of MIB1
(miRNA target sites are highlighted)
>MIB1|NM_020774|3'UTR
   1 CTAAGACACATGGTGTATTTTGTTAGCTAATGTATCTAGTCATGAGATCTTAATAGGCTTTTGATCTAGTTGGAAGTTCT
  81 GATGAGTTAATTTCTAATATCATAGTTTCTTTACTAGAGTATAATTGGGCTGTAAATGTACCAGAACAAAAAACCCTACA
 161 AAATGGTGTTGGAAATTGTGTTTTTTGTTTTTGTTTTAAATTTGAAACATCAAATTCATGTAACTCATAGGATAATTTAC
 241 CTTTGGCTTCTAAGAGGAAAGTCCTTTAAGGATATCCTTTTTTAAAAAATTGCATTTTTCTCTTATAATTTGTAAATTTG
 321 TTGGATCTCAAAAGACATAATTCTTTGTGATCAGTTATCCTTCATTTCATCGTGGTTTTACACAGTGAGTTGATAACAGG
 401 TTCTCTGAGAAGTCATGCATCAAATAAAAGAGGCAGGTCAAACAATTATGTCACATGGTAAATTATAAAATGACAGTACA
 481 AGTTCCAGATAGTTAAGGGAATACCGAAGGGATGATTCTTTTTTTAAGATAACAGGAAGTTACCCACATGTTTGTTTCTG
 561 AATTCTTAGAGTAAATGGAAGCATAGAATGAGGGAATAATGACTTTGCATTTCTCTTGTTTTCTAGATTCAAAAGGAACA
 641 TTGTTTAACTTGAATCAGATTACCAGTTTCAAGGTGACTGATAGACAAGAAAAGGAAAAATAAGCAATAATAGTGGGCAA
 721 CTGAAGAGAAAAAAAAAACGAGTATCTATTAACTGGCCACTAACAGTTGCCTTTCTTACATTAATTTATACACTATTTTG
 801 TTCAGCCAGTGTTTTTAAAAAAAATCTATGAAAAGTGTACTTCCGGTTTTCTGTGATTACTTATCTGGGCTTGATCTGAC
 881 CAGTGAAATGACATTGCCCTATTTGGACCTCTGAGGTTCTATTTAGCTTTGCAGATGTACATAGTATCCCAGTGATCTGC
 961 AAAATTAATGCCTTTTCCAAGAAAAAATCTTTTCTTCTCTGTATCAGTTAATTCTGACAGTGTTAGTGATTCTGTCTTCA
1041 TTATAGGCCTTATTTCCATTATCTCTTTCTTTATAGTATTTTTTGTTATAAAGAAAACAGTCTTTCTGTGTATACCTACG
1121 GATGAGGGTATTATTTAAACTGCCAACAATATCCAAGACATGGTCAATAACCTAATTATAAATACTTTAGAAAGAGTGAC
1201 CAGGACATGTATAGAAATGTCTGCTTACCTGTAGACTTTAAAAACAAACAAAATTTTTGGAGCATTTAATCATTTTTTTT
1281 CTCCTTTTATCTCCTTTGTAATCTTATTGTCTCCTGAGTAAATATACACATAAATGTTTGGGGATTCATTGCTGCTAGAT
1361 TATATCAGGTGTTTACATAGTGTCTACTATATGCTGTTGATAAGCTTTTTCCTAAAAATAGTTATCCTCTTTTGTAGTTT
1441 TTTTCCCTCCTTTAAATCTGGCTAGCTTTTCTTACTTCAGTTTTTATAGAACACCAACTAAATTTGAAAGTATGAAGTCT
1521 CTAGCCCTCTTACACTGTTTCTGGCTGTTTAATCCTTGCTGCCTTTGCAAGTCCTGGTGAAAGCAATGGGGAGCTTTGCT
1601 GGCTGGTTTTGTAGTCTCAACAATTCCATGTCTGTGTTTAGCTGAGTAACTGCTATCATTTAGAACAGTAAAATTTTTAT
1681 AGATTTCAAATTTGAAAATTCATGTACACTCAGTTATCTAATAAGGGGCCACCGACGCTGTTTTTAAAACTATTTTGAAG
1761 TTATAAAAAGGTAGAACATCTGACTGATGATGTTCACATAAAGAGACAGACAGACTATCATGTTGCAGACATGAAAACAG
1841 CATGTCAGGTTTTTCCTTTCCTTCCATGCCATGGGCTACCCATCTCTTCCCACTAGATCACCTGGTGAGGAGGGAGCACC
1921 TGGCTGACTCATGCAGAGTTTGGCCAATCAGAGAATTGTGTGGTCTCCAGCTCTACTTTCCTTAAACAAATCCTTTCTGT
2001 TTTCTGAGCTGCAGTGCTAAAACAGATCCCTAAAAGGTAATAGCATCTTCCAGACTAGTTTAATTATTTCCTTTATAAGA
2081 ATATGACATAAATTTTTATTATAGAAATAATGTCATTATAATTTTAGTGCTAGTACTTGTGGGTTTTCTGTATTTGTATC
2161 ACCTTGAAATTTGTTCCATGAATAGAAAATACTTCTTTATTCATGTTTTCAATCACTTAGAATTATTTTAAATTTATTTT
2241 GGGTTTGTGAGAGATAATAAGATTAAGAACTTCATCATTTCAGTGACTTTCCTCCAACTCTCTGAATCTGCTACCTCTTA
2321 TTATATGTCCCTTAGCAGTACTTTTCCAGTTAGGTTCGTTACCCTGCTCATTAGCTAAACCTCTTTATCTTGTGCCTCAA
2401 AAGAGCTTTTACTTTTCTTAGAAACATTTATAAAAAAGAAAAAAACTGACACGCATTCATTCAAAAAAGTATTTATTGGG
2481 CTTTAGGGATTAGATACACAACAGTGGAAAAATGGCATCTTAGCACACTCAGAATTTATTGTGCAGCAGTTGTGTATTTT
2561 AAGGAATCTGTAGTTAAAAGGAAGAGATCCAAAGGTCCTGATAACATTTCCTAACGTTTCAGAAGAGTTGTCATTGAGTA
2641 GTGTTTGGATTTCCTCTCTGTATCCCTCACCCTACCATTTTCTCCTTTATTCTTCTAAGATTGTTAGCGTTGTTACTCAA
2721 AACATACACATACAACATACCAGATGGTGCTGTTCTAATGGTATTTGTTCACGTAATTTAACGTTCTTACTGCTTATACT
2801 ATATACATATTTAATTTTGTTGGGAGCAAGAAGGTTTTCAAGAAAAGATAATTTTGTATTAGTGTAGGAATATATTAGAC
2881 AAATGTTTAGTTGGTCAAATTATGCATAAGATATTTGTAACTTTAAACATTGCAAATTGACCAGCTAGCTATGGAAGCAT
2961 AAAATTAATTGATAATTAATGTTGGAAATACATTTCTAAAATTTATATTTTTATGGTGTTAGCCTGTAAGAGCATTTTAG
3041 CATATTGAAATGCATGCTGCTTAAGATGTGTCTGGTTCAAATATCAAAACTTGCTGGGTCATTTTTACATAGTAGAAACA
3121 TACTGTCTATGTGTTGCCCAATTGCTGTTTGTCCACTCTGAATTCTGGACCCTTTTTGGACTAAGAATTAGTTAAATTCA
3201 TGAACTAAGAGAATTAGAGATGGGGTAGAGTAGGATCAGGACAGTGGGGTTACAACAGATAGGAAAGGAAAGTCAGCATT
3281 TGAGTGTAGAGAAAAAAAGAGGATCATACAGATGTCATCAAATTATAGGCTTTAATACAGGTTGCTTTTTTTAATCCAAA
3361 AGGAAAAGCACTTATCCTATCAGAATGTCTACCATGTTTTATAGTAATAATTTGTGTAAAAAATTGAATTTTTGAATAGT
3441 TTTTTGTATTTTTTGTGATGAAAAACTCATAACATAAAATTTACCATATTAACTGTTTCTAAAGAATACAGTTCAGCCAT
3521 GTGAAGTACATTTACACTGTTGTGAAGCAGATCTCCAGAACTTTTTCATCTTGCAAAACTGAAACTCCATACCCATTAAA
3601 CAACTCCCCTTTTTGTTTTCTCCTCAGTGGAATAGAATTTTGACTCCATATAAATCAAGAAACACCTAAATTCTTTAGTT
3681 GTTTGTGTTTGCAAGATCTAAGGTCATGGTAAACATTAAGTTCTTAAAATTTTTGGGAGGGACAGTGCACCTCTCCTCTG
3761 AATTGTTAGCAATTAAATTGAGTAGGTTTTAAATGTCTATTCATTGGAAGGGTTTGTTATTTCATTTTGAGCCAGAGGGG
3841 AGAGGCACATTTTAAATATCAGAATTAGATTAGCTTTGAGTTTGTACAATTGGGAACATAATAGATTTTCATAAATTATG
3921 TGTGCCTTGTTGGAAGTGTCAACTGTCTTTATGTCTGCTTGTAAAAGTTTCAAAATATGTTTTCCCTCAAAAAGGCAACG
4001 TTACTTCATTTGCTTGAATATTATGATAGGAATGCTTACTGATATTACTTGATAGTCATATATAGCCTAGGAAATTTAAC
4081 ATATATATAACTATAGCAGTATTAATAATGATAGTTGTACTTCTTTAAAACATTAAATTTGAGGAAACTTTAATGCTGTC
4161 TCGTGTACATTGCTTTACTACAGTGAGGGGGAATATCCTTTAGATTGAGCCTCAATTTACTGGTTAGTAGTATGTGAAAC
4241 TCTGGTATAAAAACGTAAACTAGACAGTAGAGCCGATGAATTAAAATTGTAAATTGCTACATTGGCATTTTCTACCTCCT
4321 TTTCTGTCAGAGTATTACTTTTTCCAGCATTTATTCTTATTTGTGAGTAAAGAGGAAATGGGAACCTGAGGTTAAAATTG
4401 ACATTTTTGTTTCATTGAGAATTTAAGCAGTAGGTACAGGAGAAGTGACTTGTCACATTAATTTGGTGCCTAAATCTGTA
4481 ACTACAAGTTGTGATCGACATGTACAAAATGTCTAAGAAAGGTCATATGCTGAATATTTTACTTTTCCTGTATAGTCTGC
4561 ATGATTTGTTTCATAAACCCAGCTTATTTCCTCCAAAAAGCAAAATGGTCCTGTAATTTTTAAAGTAAAATAAACGTGCC
4641 ATTTTGTCTGCAATCTATAATTTCAGGAAGTTATTGAAAGTTCTGACTCAGGGCTTTTTAACAGTTCAAGCAATTGTCAG
4721 TTATATTTTGGAAACTCCATCTGTGTAATTCTCCAGTGCCTTGAAAGAATTATTAACTTGGCAACACTATTAAAACTTTA
4801 TAAAAGATGGTCTTTAGTGCACGTGTATCATTATATACACGTTTTAAAGTCATATTGCTTAGCTTGTTAATAATGATTCT
4881 GCATGTGTGCTGGGTTTGGGTAATTCTTTAAAGGAAGTTTTCTAGATTTGCACTTGATGTTTGTTTTTTAAAAACTGATT
4961 ATTTATGGCCGTGACACTGTTACCAGAAAAGTAATTCTAATTAAGTTATTATGCAAAGTCATCTATAAGTAGCATCTGGG
5041 AAGAGGAGATCGAGGCCACAGTTTGCTATTTTAGTATGAAAGGAGGATCTGTTTGGGAAACATAGATTGTCTTCCCCTCA
5121 AATGAGGGGAAAAAAAAAAGACCCTTTGTTCAAATGGATTCTGTTGTAAAAAATTATTTTTAAAGGAAATCACAAATTGT
5201 ATGTCATTCTTAATGCTAGTCTTATAGAATAAATCCATAAAATTGTTTTTATGTTCAGTATGTTTATGTCATTCTAAATG
5281 CAGCAAATTCAATGATAGCAGTTCAATTGACTCATAGCAGTGTTTTGTATTTTTTCTAATTCTTTAGCTTTCAATATTGG
5361 ATTAAAGTCTTGTTTGTGAATATAGTTTCCGTATGGCAAATGATTTCTTGCTTATTAGCTTTTGTTAAAGAATGCTTAGT
5441 AAGAGCTAAGCTTTTAAAAGTAATGCAAACATTTATCGTTAATAAAACCTATGGTGTAATATCATATAATGCTTTTCTTT
5521 GATCTTTGGAGAATTATTCTTTTATAGTAGTATACATGAATTTTGATTTTTAAAGCATTTAAAAACAAATCTCAATACAT
5601 TAAAAAACCTGTTATTGTTAAAAAGGAAATTACCATGCCTTTAAGAAACAAGGATGTACATCTTCAATTCAGCATAAGTG
5681 TCCACATCTAGAAGGCTCTCATTGCAGTTGTTTACAGTTAAGGTACCTCTATCTAAAGGGCCAAAGAAGCATTTCATATT
5761 TTAACACCTCACATTCTTTCAGGATTAAGACATATGAAAATAGTCTGAATAGGATAAATTTGATAGGAAGTAACTTAACC
5841 AGTCTGGAAGATTCAGCTTTTTCTATAAAAAGCTTATTCCTCTTCACAACTCAGATGTAGATTTCATTTTCAAGAGGTAG
5921 ATATTTTAAAGCAATGATCTATTTGGGTTTTAGTTTTATGAGTAAATCATTAATTGTATGGTTTGGGGGTTATTTTATTT
6001 TCCATGTTAATATAAGCACTTATTTCTGAAGTTATTGAGAGGTCATCTAGCTCCAGTTCAAAAGATTATGTATATCTGAT
6081 GTTTAAGAGGAAAAACATCTGAAAAAATATCTTTTGTTTATTTGAAAAAAGCATATATATTCCAACTTTAAAATTGTGAA
6161 TTTATTTTGAGTAACCTCTAATTAACTGTATTTTTTTGTTTCTGTTGCTGTATAGTTAGAAATTTCATGGCAATATTTTT
6241 TACTAAATTGAAACTATAGGTTTTAAAAATAAAGACATTTTAGAAAATTTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUAC--ACGACGAu 5'
            || |:::  |||  ||||||| 
Target 5' agCATATTGAAATGCATGCTGCTt 3'
3039 - 3062 154.00 -11.90
2
miRNA  3' guguuuggUAA-UACACGACGAu 5'
                  ||| || ||||||| 
Target 5' gtttggggATTCAT-TGCTGCTa 3'
1336 - 1357 149.00 -10.70
3
miRNA  3' guGUUUGGUAAUA-CACGACGAu 5'
            || ||||  || ||||||:| 
Target 5' aaCATACCA-GATGGTGCTGTTc 3'
2734 - 2755 147.00 -18.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30691508 3 COSMIC
COSN26390946 5 COSMIC
COSN20085759 6 COSMIC
COSN31529686 110 COSMIC
COSN8604416 117 COSMIC
COSN30125288 167 COSMIC
COSN4771221 273 COSMIC
COSN20966303 393 COSMIC
COSN9327469 511 COSMIC
COSN6115615 700 COSMIC
COSN32062901 715 COSMIC
COSN29076307 739 COSMIC
COSN32063490 862 COSMIC
COSN31523353 922 COSMIC
COSN31551004 988 COSMIC
COSN9676478 1053 COSMIC
COSN31556500 1080 COSMIC
COSN16380962 1113 COSMIC
COSN6115616 1121 COSMIC
COSN20114768 1254 COSMIC
COSN18723878 1255 COSMIC
COSN28201831 1529 COSMIC
COSN29806103 1900 COSMIC
COSN28654641 2232 COSMIC
COSN31534617 2235 COSMIC
COSN31585378 2301 COSMIC
COSN31513922 2408 COSMIC
COSN31578616 2448 COSMIC
COSN31609657 2683 COSMIC
COSN6115617 2747 COSMIC
COSN24306436 2793 COSMIC
COSN31570042 2813 COSMIC
COSN31570061 2848 COSMIC
COSN31607153 3186 COSMIC
COSN31567803 3196 COSMIC
COSN8604417 3671 COSMIC
COSN31606826 3672 COSMIC
COSN5422313 3701 COSMIC
COSN31516119 3724 COSMIC
COSN25884150 3875 COSMIC
COSN31519232 3906 COSMIC
COSN31572532 4145 COSMIC
COSN31589399 4157 COSMIC
COSN31563143 4231 COSMIC
COSN31593213 4304 COSMIC
COSN31572529 4389 COSMIC
COSN26635144 4467 COSMIC
COSN31556721 4491 COSMIC
COSN31565234 4621 COSMIC
COSN31482546 4733 COSMIC
COSN30176563 4790 COSMIC
COSN31579550 4864 COSMIC
COSN31606819 4907 COSMIC
COSN31607325 4914 COSMIC
COSN30172691 5049 COSMIC
COSN20114774 5140 COSMIC
COSN9327471 5316 COSMIC
COSN20993950 5328 COSMIC
COSN6549771 5329 COSMIC
COSN31568932 5478 COSMIC
COSN31532089 5479 COSMIC
COSN17296489 5730 COSMIC
COSN16799131 5760 COSMIC
COSN21868587 5763 COSMIC
COSN25014821 5893 COSMIC
rs184701424 4065 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1450643077 1 dbSNP
rs758827497 2 dbSNP
rs1364890323 3 dbSNP
rs778041164 9 dbSNP
rs539605596 11 dbSNP
rs771088911 23 dbSNP
rs1198166517 28 dbSNP
rs990886841 31 dbSNP
rs1277831153 33 dbSNP
rs76056004 35 dbSNP
rs1212132647 43 dbSNP
rs746014652 44 dbSNP
rs768506739 45 dbSNP
rs1048076872 48 dbSNP
rs558951895 49 dbSNP
rs1392204640 52 dbSNP
rs374608852 66 dbSNP
rs970480883 74 dbSNP
rs1349399264 77 dbSNP
rs1264264505 82 dbSNP
rs977814709 87 dbSNP
rs1195413575 89 dbSNP
rs1489759118 97 dbSNP
rs1290543528 114 dbSNP
rs370764179 126 dbSNP
rs567024844 150 dbSNP
rs1322948782 153 dbSNP
rs1270838034 156 dbSNP
rs1213855394 157 dbSNP
rs1368985180 158 dbSNP
rs1279925871 159 dbSNP
rs1402864002 174 dbSNP
rs1343911500 177 dbSNP
rs1006510663 181 dbSNP
rs1437306772 181 dbSNP
rs1307583069 182 dbSNP
rs1168955821 194 dbSNP
rs1465509681 195 dbSNP
rs1023639388 211 dbSNP
rs536122354 214 dbSNP
rs1356267227 227 dbSNP
rs1479649045 227 dbSNP
rs1191375138 228 dbSNP
rs1489179723 230 dbSNP
rs970218985 259 dbSNP
rs1203195627 285 dbSNP
rs1241899311 289 dbSNP
rs1259872850 291 dbSNP
rs1221510275 294 dbSNP
rs767113193 299 dbSNP
rs1300884364 306 dbSNP
rs555830488 307 dbSNP
rs1218816884 313 dbSNP
rs936810928 321 dbSNP
rs1247943956 337 dbSNP
rs1054078018 338 dbSNP
rs1177913034 350 dbSNP
rs922175528 353 dbSNP
rs1401724092 354 dbSNP
rs576784780 356 dbSNP
rs754944685 357 dbSNP
rs1179498213 370 dbSNP
rs956132992 372 dbSNP
rs145915452 373 dbSNP
rs1405344263 376 dbSNP
rs371148635 390 dbSNP
rs988798561 394 dbSNP
rs1457800809 395 dbSNP
rs1004940742 398 dbSNP
rs1239961182 399 dbSNP
rs1036386377 400 dbSNP
rs1403797148 404 dbSNP
rs778041192 420 dbSNP
rs747047260 422 dbSNP
rs558245848 424 dbSNP
rs576985575 437 dbSNP
rs1038033387 439 dbSNP
rs1465606451 444 dbSNP
rs1329846168 448 dbSNP
rs1379613041 449 dbSNP
rs543687884 452 dbSNP
rs959552246 454 dbSNP
rs781417989 455 dbSNP
rs1012139879 457 dbSNP
rs760734250 457 dbSNP
rs1312104923 458 dbSNP
rs1399317391 459 dbSNP
rs776475326 467 dbSNP
rs1451027822 473 dbSNP
rs1378077533 475 dbSNP
rs1303865052 480 dbSNP
rs1467869314 481 dbSNP
rs985361011 488 dbSNP
rs1157621699 491 dbSNP
rs1439803447 506 dbSNP
rs1025082190 510 dbSNP
rs970364824 513 dbSNP
rs977867044 515 dbSNP
rs911142654 519 dbSNP
rs943862315 519 dbSNP
rs1291470475 534 dbSNP
rs923678979 539 dbSNP
rs1041298898 544 dbSNP
rs1183431414 548 dbSNP
rs1334873092 549 dbSNP
rs958232320 555 dbSNP
rs1354522869 569 dbSNP
rs990057776 573 dbSNP
rs766395261 583 dbSNP
rs1314033146 595 dbSNP
rs1182324366 600 dbSNP
rs922090243 608 dbSNP
rs929759762 619 dbSNP
rs1360259711 621 dbSNP
rs746222836 622 dbSNP
rs932238271 624 dbSNP
rs148161553 627 dbSNP
rs1456940508 644 dbSNP
rs1369011138 650 dbSNP
rs559479583 659 dbSNP
rs1189485379 661 dbSNP
rs1044625688 664 dbSNP
rs1477513096 683 dbSNP
rs1262132959 689 dbSNP
rs911915477 690 dbSNP
rs1169182084 691 dbSNP
rs1265574123 695 dbSNP
rs1403160680 719 dbSNP
rs1466597755 721 dbSNP
rs1333970188 722 dbSNP
rs1357766524 723 dbSNP
rs1445392778 724 dbSNP
rs940681374 726 dbSNP
rs1285553478 727 dbSNP
rs1266576581 729 dbSNP
rs1355664077 729 dbSNP
rs906128536 729 dbSNP
rs75131564 730 dbSNP
rs1003027387 737 dbSNP
rs898707416 738 dbSNP
rs141988839 739 dbSNP
rs528410759 740 dbSNP
rs1300847349 741 dbSNP
rs754780074 743 dbSNP
rs891879211 743 dbSNP
rs1275741030 748 dbSNP
rs1319997125 749 dbSNP
rs1390743657 755 dbSNP
rs1164947190 761 dbSNP
rs1010364766 768 dbSNP
rs894957203 769 dbSNP
rs1459479895 780 dbSNP
rs1440432899 781 dbSNP
rs1478670292 786 dbSNP
rs1012604131 789 dbSNP
rs1196971508 792 dbSNP
rs183127647 794 dbSNP
rs968719133 794 dbSNP
rs1211699338 803 dbSNP
rs1258408150 806 dbSNP
rs1257943756 809 dbSNP
rs188060542 817 dbSNP
rs759453964 817 dbSNP
rs530377795 818 dbSNP
rs1232006068 833 dbSNP
rs1331313756 843 dbSNP
rs999190537 844 dbSNP
rs550270343 845 dbSNP
rs958035879 857 dbSNP
rs989215797 860 dbSNP
rs1425833449 862 dbSNP
rs1331893121 870 dbSNP
rs1467016999 876 dbSNP
rs1476056432 879 dbSNP
rs1029593430 891 dbSNP
rs1423546930 909 dbSNP
rs770256510 912 dbSNP
rs988157783 913 dbSNP
rs912136937 917 dbSNP
rs918456742 922 dbSNP
rs940733428 934 dbSNP
rs1375738133 940 dbSNP
rs1399003036 942 dbSNP
rs1361712381 945 dbSNP
rs1459381318 947 dbSNP
rs1295852060 948 dbSNP
rs1341811406 952 dbSNP
rs972039545 956 dbSNP
rs570416828 969 dbSNP
rs1200241304 973 dbSNP
rs533595213 979 dbSNP
rs74847814 998 dbSNP
rs930743230 999 dbSNP
rs150619413 1000 dbSNP
rs1375460091 1001 dbSNP
rs77716497 1011 dbSNP
rs573537839 1012 dbSNP
rs1448822867 1019 dbSNP
rs138681506 1020 dbSNP
rs1046387536 1026 dbSNP
rs906452783 1035 dbSNP
rs999409879 1048 dbSNP
rs1353313784 1049 dbSNP
rs538211622 1063 dbSNP
rs1174485908 1064 dbSNP
rs1417944267 1066 dbSNP
rs893448321 1076 dbSNP
rs1011095646 1080 dbSNP
rs1028727915 1086 dbSNP
rs891931516 1088 dbSNP
rs558307321 1090 dbSNP
rs987595858 1092 dbSNP
rs1021694690 1093 dbSNP
rs11872304 1102 dbSNP
rs574492412 1111 dbSNP
rs1006878351 1117 dbSNP
rs143113406 1119 dbSNP
rs962275300 1120 dbSNP
rs552933731 1121 dbSNP
rs45576836 1126 dbSNP
rs1376934046 1141 dbSNP
rs1025521790 1143 dbSNP
rs541724544 1147 dbSNP
rs952069319 1148 dbSNP
rs1448511025 1149 dbSNP
rs951191382 1155 dbSNP
rs1336416690 1162 dbSNP
rs1174726885 1164 dbSNP
rs992019573 1177 dbSNP
rs915996326 1187 dbSNP
rs983939996 1189 dbSNP
rs1159374190 1191 dbSNP
rs909616338 1202 dbSNP
rs1418760472 1203 dbSNP
rs1163150066 1208 dbSNP
rs1473330338 1210 dbSNP
rs950139454 1215 dbSNP
rs1487794854 1223 dbSNP
rs1156404255 1227 dbSNP
rs1218223625 1232 dbSNP
rs980456419 1235 dbSNP
rs1289098541 1236 dbSNP
rs199765788 1238 dbSNP
rs200976745 1239 dbSNP
rs146036337 1240 dbSNP
rs201653265 1240 dbSNP
rs1426158013 1241 dbSNP
rs1323488904 1245 dbSNP
rs1361931417 1246 dbSNP
rs1169040725 1253 dbSNP
rs61639099 1254 dbSNP
rs867077634 1255 dbSNP
rs1382232128 1258 dbSNP
rs114606110 1260 dbSNP
rs1195346631 1261 dbSNP
rs574909191 1268 dbSNP
rs1487227008 1272 dbSNP
rs1221654992 1273 dbSNP
rs1329339227 1282 dbSNP
rs1438484034 1284 dbSNP
rs1256052342 1285 dbSNP
rs1303943370 1290 dbSNP
rs939001189 1293 dbSNP
rs927754608 1294 dbSNP
rs935253148 1304 dbSNP
rs1052333653 1307 dbSNP
rs1215748676 1308 dbSNP
rs1365745159 1314 dbSNP
rs893490400 1316 dbSNP
rs1274410843 1318 dbSNP
rs1010563652 1326 dbSNP
rs543775736 1327 dbSNP
rs1050637262 1341 dbSNP
rs79442880 1350 dbSNP
rs1329849118 1355 dbSNP
rs1465462489 1372 dbSNP
rs892071074 1375 dbSNP
rs1287801988 1378 dbSNP
rs1453874047 1387 dbSNP
rs1431158796 1389 dbSNP
rs1423990052 1390 dbSNP
rs1194777250 1399 dbSNP
rs532916951 1401 dbSNP
rs1043645601 1408 dbSNP
rs1197856695 1415 dbSNP
rs1458053846 1428 dbSNP
rs1438177562 1430 dbSNP
rs546663811 1433 dbSNP
rs904597674 1438 dbSNP
rs1310709934 1450 dbSNP
rs1300823942 1458 dbSNP
rs1007423438 1462 dbSNP
rs962168509 1467 dbSNP
rs993740951 1481 dbSNP
rs1307715974 1489 dbSNP
rs760232108 1498 dbSNP
rs952184433 1514 dbSNP
rs73430129 1522 dbSNP
rs998151591 1533 dbSNP
rs1464838023 1535 dbSNP
rs915864305 1536 dbSNP
rs1358239720 1538 dbSNP
rs1025494092 1540 dbSNP
rs1436044258 1556 dbSNP
rs971486130 1559 dbSNP
rs1377881214 1563 dbSNP
rs981502187 1587 dbSNP
rs1440317222 1599 dbSNP
rs927805344 1603 dbSNP
rs879712045 1605 dbSNP
rs1482779145 1606 dbSNP
rs1255664129 1607 dbSNP
rs1052385295 1608 dbSNP
rs1017215575 1616 dbSNP
rs1284055097 1621 dbSNP
rs1239476609 1624 dbSNP
rs34372407 1626 dbSNP
rs1355105139 1631 dbSNP
rs915158940 1642 dbSNP
rs946584316 1653 dbSNP
rs1050100331 1665 dbSNP
rs1444239976 1672 dbSNP
rs1416301270 1678 dbSNP
rs888749228 1680 dbSNP
rs1358230158 1682 dbSNP
rs1311171092 1686 dbSNP
rs1157573839 1687 dbSNP
rs1008618418 1690 dbSNP
rs1040089397 1691 dbSNP
rs1244288377 1695 dbSNP
rs898033333 1703 dbSNP
rs529459386 1704 dbSNP
rs980890445 1708 dbSNP
rs1256524641 1712 dbSNP
rs927743843 1718 dbSNP
rs1486799133 1722 dbSNP
rs189525284 1723 dbSNP
rs368576188 1730 dbSNP
rs147482523 1731 dbSNP
rs1354450813 1733 dbSNP
rs1214895357 1734 dbSNP
rs952338395 1735 dbSNP
rs1013558378 1737 dbSNP
rs1022985426 1738 dbSNP
rs1200979775 1747 dbSNP
rs374055254 1751 dbSNP
rs1235495055 1753 dbSNP
rs971368549 1756 dbSNP
rs1297150954 1760 dbSNP
rs1400115383 1764 dbSNP
rs1386410074 1766 dbSNP
rs1291731332 1769 dbSNP
rs1457398071 1771 dbSNP
rs754998073 1775 dbSNP
rs1043226761 1780 dbSNP
rs1251652323 1785 dbSNP
rs140548107 1791 dbSNP
rs182224514 1795 dbSNP
rs942888499 1797 dbSNP
rs1186343141 1798 dbSNP
rs1040161948 1799 dbSNP
rs1366238582 1804 dbSNP
rs901285727 1807 dbSNP
rs1208127753 1813 dbSNP
rs998125780 1813 dbSNP
rs1266528119 1816 dbSNP
rs1488465894 1816 dbSNP
rs1031752871 1817 dbSNP
rs956565367 1821 dbSNP
rs116895103 1832 dbSNP
rs1463998599 1839 dbSNP
rs1299703219 1841 dbSNP
rs1005464904 1843 dbSNP
rs1327819094 1846 dbSNP
rs915022886 1852 dbSNP
rs1298610755 1857 dbSNP
rs1385712211 1860 dbSNP
rs1391389248 1862 dbSNP
rs527258918 1865 dbSNP
rs986427941 1870 dbSNP
rs1463868758 1872 dbSNP
rs542738227 1876 dbSNP
rs1395691098 1877 dbSNP
rs944370106 1878 dbSNP
rs1171103751 1880 dbSNP
rs552075933 1893 dbSNP
rs1374975860 1909 dbSNP
rs897583835 1921 dbSNP
rs186784994 1922 dbSNP
rs1432621074 1930 dbSNP
rs1035164553 1931 dbSNP
rs1216028310 1933 dbSNP
rs1277629429 1935 dbSNP
rs1257885766 1937 dbSNP
rs1049241816 1938 dbSNP
rs1341097272 1939 dbSNP
rs887920424 1941 dbSNP
rs9945541 1948 dbSNP
rs1331109632 1950 dbSNP
rs1305547651 1957 dbSNP
rs1023624779 1959 dbSNP
rs967707403 1960 dbSNP
rs907235292 1969 dbSNP
rs1002872399 1980 dbSNP
rs1031636898 2007 dbSNP
rs75090149 2009 dbSNP
rs1199532879 2014 dbSNP
rs1398940273 2020 dbSNP
rs564067869 2024 dbSNP
rs1465614643 2031 dbSNP
rs201399290 2039 dbSNP
rs111663544 2040 dbSNP
rs1188134166 2041 dbSNP
rs1238078182 2041 dbSNP
rs1422243248 2043 dbSNP
rs1039898259 2050 dbSNP
rs968266948 2051 dbSNP
rs1439878293 2052 dbSNP
rs769880902 2054 dbSNP
rs1199466956 2059 dbSNP
rs1348136137 2073 dbSNP
rs1281921354 2082 dbSNP
rs1237281551 2092 dbSNP
rs1373460660 2107 dbSNP
rs934113331 2112 dbSNP
rs556719890 2117 dbSNP
rs910468107 2119 dbSNP
rs1444153547 2120 dbSNP
rs568521974 2127 dbSNP
rs1332455610 2132 dbSNP
rs1395726647 2133 dbSNP
rs866309958 2140 dbSNP
rs1175647462 2141 dbSNP
rs575187658 2143 dbSNP
rs1415623216 2144 dbSNP
rs185701485 2145 dbSNP
rs1338458606 2151 dbSNP
rs780434071 2153 dbSNP
rs905132063 2163 dbSNP
rs1367144645 2174 dbSNP
rs929090846 2180 dbSNP
rs891306687 2186 dbSNP
rs78113435 2203 dbSNP
rs1311990085 2205 dbSNP
rs45475595 2206 dbSNP
rs45510197 2213 dbSNP
rs1349656790 2221 dbSNP
rs896233608 2234 dbSNP
rs1211124477 2238 dbSNP
rs1261857969 2254 dbSNP
rs1225339756 2256 dbSNP
rs1044708149 2258 dbSNP
rs1486997802 2290 dbSNP
rs1009278874 2291 dbSNP
rs1233642080 2295 dbSNP
rs907456029 2298 dbSNP
rs967674888 2299 dbSNP
rs979137306 2301 dbSNP
rs1432512676 2303 dbSNP
rs1173776200 2312 dbSNP
rs1403018121 2316 dbSNP
rs1003090326 2318 dbSNP
rs1163086169 2318 dbSNP
rs757404921 2321 dbSNP
rs1475713894 2322 dbSNP
rs1419618133 2323 dbSNP
rs1033662979 2324 dbSNP
rs1477219256 2325 dbSNP
rs560161535 2338 dbSNP
rs1396638038 2339 dbSNP
rs1449834430 2341 dbSNP
rs1031687435 2349 dbSNP
rs1435596213 2358 dbSNP
rs529535677 2359 dbSNP
rs7449 2367 dbSNP
rs563059629 2374 dbSNP
rs372177257 2401 dbSNP
rs1367605932 2413 dbSNP
rs922814543 2425 dbSNP
rs967947786 2426 dbSNP
rs868553198 2431 dbSNP
rs934164364 2432 dbSNP
rs1234607181 2439 dbSNP
rs1325778934 2439 dbSNP
rs1284779754 2446 dbSNP
rs982796563 2447 dbSNP
rs1017359949 2450 dbSNP
rs148487055 2453 dbSNP
rs941336320 2454 dbSNP
rs1217382966 2458 dbSNP
rs1246058161 2459 dbSNP
rs765049766 2461 dbSNP
rs1469754889 2464 dbSNP
rs1255988872 2465 dbSNP
rs1488139592 2467 dbSNP
rs1307182317 2470 dbSNP
rs1038401137 2478 dbSNP
rs1216438432 2480 dbSNP
rs1365500245 2482 dbSNP
rs975947839 2482 dbSNP
rs918947879 2487 dbSNP
rs1442362222 2493 dbSNP
rs1373823634 2496 dbSNP
rs571554431 2498 dbSNP
rs1189349514 2503 dbSNP
rs1329780986 2539 dbSNP
rs950422462 2548 dbSNP
rs760416924 2571 dbSNP
rs937980743 2580 dbSNP
rs766091514 2587 dbSNP
rs113258713 2593 dbSNP
rs908951894 2595 dbSNP
rs948457994 2598 dbSNP
rs1254692293 2605 dbSNP
rs1455560301 2611 dbSNP
rs1044592129 2614 dbSNP
rs1236259443 2615 dbSNP
rs375158959 2616 dbSNP
rs776592599 2617 dbSNP
rs1233674315 2623 dbSNP
rs1053345256 2644 dbSNP
rs1310656425 2655 dbSNP
rs1279791659 2665 dbSNP
rs1235076077 2669 dbSNP
rs1350742168 2678 dbSNP
rs1307647433 2685 dbSNP
rs891822393 2687 dbSNP
rs1378764775 2689 dbSNP
rs1402664437 2693 dbSNP
rs1011991489 2704 dbSNP
rs527644409 2710 dbSNP
rs1374439936 2716 dbSNP
rs889878680 2719 dbSNP
rs1435986116 2724 dbSNP
rs1328464062 2727 dbSNP
rs1006950113 2734 dbSNP
rs1017307617 2738 dbSNP
rs868012731 2741 dbSNP
rs1333598474 2747 dbSNP
rs975598905 2751 dbSNP
rs1446429878 2756 dbSNP
rs1017410759 2758 dbSNP
rs1179900979 2762 dbSNP
rs1482423049 2764 dbSNP
rs1029878367 2773 dbSNP
rs142654284 2774 dbSNP
rs73961204 2783 dbSNP
rs1026179907 2784 dbSNP
rs1307113181 2793 dbSNP
rs1318042214 2796 dbSNP
rs1320550553 2801 dbSNP
rs1211747801 2826 dbSNP
rs941488050 2827 dbSNP
rs974477687 2830 dbSNP
rs1313063738 2857 dbSNP
rs926605442 2859 dbSNP
rs938015570 2864 dbSNP
rs117584875 2869 dbSNP
rs150933106 2876 dbSNP
rs1346865783 2881 dbSNP
rs758251427 2883 dbSNP
rs970222881 2889 dbSNP
rs979822280 2891 dbSNP
rs1188842294 2896 dbSNP
rs1476301623 2897 dbSNP
rs568700406 2898 dbSNP
rs1204599547 2899 dbSNP
rs1486505435 2901 dbSNP
rs1177944797 2907 dbSNP
rs1413201529 2908 dbSNP
rs537794033 2942 dbSNP
rs1000662704 2952 dbSNP
rs868516832 2958 dbSNP
rs763449770 2965 dbSNP
rs1293546586 2973 dbSNP
rs1039199158 2982 dbSNP
rs1395926086 2984 dbSNP
rs140653659 2992 dbSNP
rs577572624 2993 dbSNP
rs997151588 2995 dbSNP
rs913479738 2999 dbSNP
rs540201327 3006 dbSNP
rs947632511 3027 dbSNP
rs1043466571 3030 dbSNP
rs1291675357 3035 dbSNP
rs1460734576 3035 dbSNP
rs955645803 3037 dbSNP
rs1166818391 3046 dbSNP
rs1463248261 3054 dbSNP
rs368948467 3057 dbSNP
rs1192586242 3069 dbSNP
rs1443965219 3087 dbSNP
rs573816647 3091 dbSNP
rs138487602 3094 dbSNP
rs1015801412 3098 dbSNP
rs1468419803 3106 dbSNP
rs1274274539 3109 dbSNP
rs1006953240 3110 dbSNP
rs1215911673 3112 dbSNP
rs1298329470 3113 dbSNP
rs750435418 3119 dbSNP
rs1315735404 3125 dbSNP
rs1250366280 3128 dbSNP
rs1377827338 3129 dbSNP
rs1230989039 3130 dbSNP
rs1299124945 3131 dbSNP
rs1440161412 3132 dbSNP
rs1371598346 3137 dbSNP
rs1327727492 3142 dbSNP
rs1294594813 3152 dbSNP
rs188534400 3156 dbSNP
rs963206185 3156 dbSNP
rs974150217 3157 dbSNP
rs1462572363 3179 dbSNP
rs1374921759 3182 dbSNP
rs1171846662 3184 dbSNP
rs1217916855 3184 dbSNP
rs1254156686 3185 dbSNP
rs1195919506 3186 dbSNP
rs756387896 3196 dbSNP
rs373125839 3203 dbSNP
rs1195963394 3208 dbSNP
rs1205489621 3215 dbSNP
rs1341030263 3218 dbSNP
rs1277624881 3221 dbSNP
rs1232899190 3223 dbSNP
rs1348531711 3225 dbSNP
rs1237058998 3226 dbSNP
rs1237688028 3228 dbSNP
rs1334888435 3239 dbSNP
rs1041097196 3245 dbSNP
rs1484804973 3257 dbSNP
rs1392254098 3260 dbSNP
rs959375111 3261 dbSNP
rs992181891 3267 dbSNP
rs1434138016 3274 dbSNP
rs1396244699 3289 dbSNP
rs551154354 3292 dbSNP
rs945311805 3296 dbSNP
rs1363645042 3297 dbSNP
rs11083391 3301 dbSNP
rs1439243441 3304 dbSNP
rs997300389 3307 dbSNP
rs1026108055 3310 dbSNP
rs886363100 3312 dbSNP
rs1209564551 3324 dbSNP
rs1485672546 3326 dbSNP
rs1006108485 3329 dbSNP
rs1203376378 3331 dbSNP
rs1016359972 3339 dbSNP
rs1358287027 3340 dbSNP
rs1412507252 3342 dbSNP
rs969730140 3346 dbSNP
rs1337781308 3347 dbSNP
rs1038753157 3351 dbSNP
rs545387811 3370 dbSNP
rs565539198 3373 dbSNP
rs1035429701 3375 dbSNP
rs527705564 3380 dbSNP
rs1399356169 3386 dbSNP
rs997121838 3388 dbSNP
rs369876147 3392 dbSNP
rs1051410337 3395 dbSNP
rs891374930 3396 dbSNP
rs1004382497 3400 dbSNP
rs1215000809 3405 dbSNP
rs959739882 3410 dbSNP
rs988988290 3416 dbSNP
rs1277647534 3418 dbSNP
rs1475321312 3425 dbSNP
rs1346040242 3426 dbSNP
rs1016267051 3429 dbSNP
rs1284811910 3436 dbSNP
rs373305150 3436 dbSNP
rs1206708713 3440 dbSNP
rs557869719 3440 dbSNP
rs996094861 3449 dbSNP
rs755405822 3458 dbSNP
rs979019518 3461 dbSNP
rs1033749260 3467 dbSNP
rs1258345879 3468 dbSNP
rs530171282 3470 dbSNP
rs1428662511 3474 dbSNP
rs959470459 3481 dbSNP
rs911242622 3485 dbSNP
rs779239904 3487 dbSNP
rs1319479819 3496 dbSNP
rs192950093 3498 dbSNP
rs1191679639 3502 dbSNP
rs1244388842 3503 dbSNP
rs1476023788 3504 dbSNP
rs1392808457 3507 dbSNP
rs1041150751 3531 dbSNP
rs576123010 3537 dbSNP
rs1419545741 3542 dbSNP
rs1184283670 3543 dbSNP
rs1474774276 3545 dbSNP
rs12961054 3548 dbSNP
rs966705666 3561 dbSNP
rs930027952 3574 dbSNP
rs1048034855 3588 dbSNP
rs978003001 3589 dbSNP
rs886247804 3590 dbSNP
rs538003067 3591 dbSNP
rs1214066955 3592 dbSNP
rs772428137 3596 dbSNP
rs772811141 3605 dbSNP
rs539818214 3614 dbSNP
rs1175080424 3616 dbSNP
rs1375530001 3621 dbSNP
rs1418502924 3623 dbSNP
rs1315600790 3624 dbSNP
rs1212885674 3629 dbSNP
rs1016166775 3631 dbSNP
rs1270832784 3642 dbSNP
rs1437983358 3643 dbSNP
rs905560375 3650 dbSNP
rs1369386177 3660 dbSNP
rs975006298 3669 dbSNP
rs1351288803 3682 dbSNP
rs1167798284 3685 dbSNP
rs1001205444 3686 dbSNP
rs557791250 3689 dbSNP
rs1169142968 3696 dbSNP
rs959792833 3704 dbSNP
rs1368456158 3720 dbSNP
rs1252241852 3731 dbSNP
rs571547910 3735 dbSNP
rs1469592583 3740 dbSNP
rs1281235205 3751 dbSNP
rs1353239812 3753 dbSNP
rs988539407 3755 dbSNP
rs1202765507 3792 dbSNP
rs1437457793 3795 dbSNP
rs11905 3800 dbSNP
rs770718897 3803 dbSNP
rs979458284 3804 dbSNP
rs1303263712 3819 dbSNP
rs776355470 3826 dbSNP
rs1370115104 3827 dbSNP
rs1198713057 3836 dbSNP
rs1296800921 3840 dbSNP
rs911476684 3840 dbSNP
rs1251551457 3841 dbSNP
rs34402759 3843 dbSNP
rs1195130413 3846 dbSNP
rs995675657 3861 dbSNP
rs976727715 3863 dbSNP
rs765181988 3880 dbSNP
rs1034296031 3881 dbSNP
rs1394405437 3884 dbSNP
rs1174116868 3888 dbSNP
rs1395369161 3889 dbSNP
rs895230446 3895 dbSNP
rs1013637569 3898 dbSNP
rs1469308015 3899 dbSNP
rs1469859583 3901 dbSNP
rs1233620135 3908 dbSNP
rs1025074920 3912 dbSNP
rs1280258856 3914 dbSNP
rs1212304867 3925 dbSNP
rs573676704 3938 dbSNP
rs542747410 3943 dbSNP
rs1223556269 3944 dbSNP
rs1322768820 3944 dbSNP
rs1392036984 3947 dbSNP
rs1442903604 3950 dbSNP
rs1303868292 3952 dbSNP
rs1376488524 3956 dbSNP
rs1237121909 3958 dbSNP
rs143315734 3968 dbSNP
rs1289757907 3978 dbSNP
rs570292086 3979 dbSNP
rs1374376938 3981 dbSNP
rs1209769126 3986 dbSNP
rs1312952403 3987 dbSNP
rs749252189 3989 dbSNP
rs1467558353 3996 dbSNP
rs542129527 3999 dbSNP
rs114050699 4000 dbSNP
rs958224509 4001 dbSNP
rs565314443 4009 dbSNP
rs974599312 4024 dbSNP
rs1184543503 4025 dbSNP
rs1474343793 4038 dbSNP
rs1256989527 4040 dbSNP
rs751250382 4044 dbSNP
rs1444380536 4053 dbSNP
rs905787875 4058 dbSNP
rs528022751 4063 dbSNP
rs184701424 4065 dbSNP
rs1056839515 4068 dbSNP
rs45620231 4081 dbSNP
rs749690695 4081 dbSNP
rs763870262 4081 dbSNP
rs774183699 4081 dbSNP
rs1436916475 4086 dbSNP
rs895467711 4088 dbSNP
rs1231145844 4095 dbSNP
rs1293425161 4102 dbSNP
rs1354395335 4102 dbSNP
rs1397216355 4114 dbSNP
rs987151600 4125 dbSNP
rs1288150724 4127 dbSNP
rs1010430844 4132 dbSNP
rs1454133953 4135 dbSNP
rs907646305 4140 dbSNP
rs1020025860 4144 dbSNP
rs1460112809 4149 dbSNP
rs940340797 4163 dbSNP
rs1163564048 4164 dbSNP
rs1037800174 4166 dbSNP
rs373399420 4168 dbSNP
rs1260274809 4172 dbSNP
rs898738932 4180 dbSNP
rs1465737562 4181 dbSNP
rs1250334157 4182 dbSNP
rs747890184 4187 dbSNP
rs1333731223 4188 dbSNP
rs1055384214 4199 dbSNP
rs1246358897 4200 dbSNP
rs969332273 4202 dbSNP
rs895284744 4223 dbSNP
rs560991175 4226 dbSNP
rs1382778616 4234 dbSNP
rs58541665 4240 dbSNP
rs868767180 4240 dbSNP
rs529987493 4243 dbSNP
rs1018362317 4245 dbSNP
rs1394030440 4247 dbSNP
rs549870203 4248 dbSNP
rs1458012054 4250 dbSNP
rs188717141 4255 dbSNP
rs778843307 4256 dbSNP
rs1244232012 4258 dbSNP
rs560165190 4275 dbSNP
rs958066178 4276 dbSNP
rs1468267386 4279 dbSNP
rs922626607 4292 dbSNP
rs975030623 4300 dbSNP
rs551588296 4303 dbSNP
rs754120683 4304 dbSNP
rs1250312773 4312 dbSNP
rs755174794 4314 dbSNP
rs779376026 4315 dbSNP
rs983303314 4316 dbSNP
rs1344259281 4320 dbSNP
rs748422351 4322 dbSNP
rs1193722814 4340 dbSNP
rs941409987 4345 dbSNP
rs571348347 4351 dbSNP
rs1233305663 4354 dbSNP
rs987287503 4355 dbSNP
rs1252299864 4357 dbSNP
rs758967986 4361 dbSNP
rs937267006 4362 dbSNP
rs907615145 4368 dbSNP
rs181410295 4370 dbSNP
rs1394574605 4373 dbSNP
rs895518247 4377 dbSNP
rs1009902635 4386 dbSNP
rs1430439891 4387 dbSNP
rs1372950409 4388 dbSNP
rs183770003 4404 dbSNP
rs567280001 4418 dbSNP
rs937032113 4420 dbSNP
rs1476158279 4423 dbSNP
rs536221784 4431 dbSNP
rs1000323695 4433 dbSNP
rs1018416420 4437 dbSNP
rs964162690 4443 dbSNP
rs1372290476 4446 dbSNP
rs949513860 4451 dbSNP
rs1460223763 4453 dbSNP
rs1277552003 4455 dbSNP
rs1210154558 4456 dbSNP
rs750934543 4467 dbSNP
rs146691391 4471 dbSNP
rs1029860294 4475 dbSNP
rs778086741 4477 dbSNP
rs999978735 4485 dbSNP
rs576114981 4493 dbSNP
rs375928346 4497 dbSNP
rs951498257 4498 dbSNP
rs1410532646 4502 dbSNP
rs1053882648 4508 dbSNP
rs1311142458 4511 dbSNP
rs1434685611 4513 dbSNP
rs1403511469 4526 dbSNP
rs893770068 4528 dbSNP
rs1452031904 4532 dbSNP
rs1362869476 4535 dbSNP
rs1357395792 4539 dbSNP
rs1415973547 4547 dbSNP
rs538337669 4551 dbSNP
rs1278051808 4553 dbSNP
rs982804181 4577 dbSNP
rs1186572940 4578 dbSNP
rs1442956109 4586 dbSNP
rs559145598 4588 dbSNP
rs1280600872 4611 dbSNP
rs1203164889 4612 dbSNP
rs909846469 4615 dbSNP
rs1349609091 4617 dbSNP
rs1230165029 4618 dbSNP
rs962848129 4623 dbSNP
rs572542287 4626 dbSNP
rs541710710 4636 dbSNP
rs927142220 4637 dbSNP
rs1229313289 4644 dbSNP
rs1352529259 4652 dbSNP
rs1028846768 4654 dbSNP
rs1414198892 4658 dbSNP
rs1252218712 4660 dbSNP
rs113252003 4678 dbSNP
rs1381006305 4685 dbSNP
rs1384778247 4703 dbSNP
rs1209643697 4705 dbSNP
rs1458530608 4708 dbSNP
rs1415146718 4722 dbSNP
rs1277609869 4726 dbSNP
rs1008675766 4732 dbSNP
rs1472801034 4734 dbSNP
rs1239146321 4744 dbSNP
rs76507188 4751 dbSNP
rs1188581508 4756 dbSNP
rs1446354738 4766 dbSNP
rs1248455938 4778 dbSNP
rs541575148 4790 dbSNP
rs961908974 4808 dbSNP
rs1271467323 4809 dbSNP
rs945921999 4810 dbSNP
rs1426662493 4818 dbSNP
rs1041394759 4823 dbSNP
rs973530295 4823 dbSNP
rs1286021910 4824 dbSNP
rs958594890 4826 dbSNP
rs1365069224 4828 dbSNP
rs1373410835 4833 dbSNP
rs772154863 4841 dbSNP
rs1437674440 4842 dbSNP
rs1331595634 4856 dbSNP
rs1434363911 4868 dbSNP
rs1324731419 4870 dbSNP
rs1405579712 4871 dbSNP
rs1415418719 4874 dbSNP
rs1165622267 4880 dbSNP
rs1475071715 4899 dbSNP
rs1171968126 4900 dbSNP
rs1190313320 4904 dbSNP
rs935785996 4905 dbSNP
rs1251389135 4910 dbSNP
rs1466921437 4910 dbSNP
rs1221195566 4914 dbSNP
rs916822482 4925 dbSNP
rs758136813 4926 dbSNP
rs1377359285 4933 dbSNP
rs563328094 4934 dbSNP
rs1435358307 4936 dbSNP
rs1212827521 4937 dbSNP
rs1342113018 4950 dbSNP
rs1298898725 4951 dbSNP
rs56921654 4971 dbSNP
rs138254129 4972 dbSNP
rs1274627779 4977 dbSNP
rs1436803521 4978 dbSNP
rs1384395380 4979 dbSNP
rs998305369 4984 dbSNP
rs1296767240 4997 dbSNP
rs1326307686 4999 dbSNP
rs924070720 5017 dbSNP
rs935525481 5018 dbSNP
rs1370661108 5022 dbSNP
rs1233112371 5025 dbSNP
rs1029745725 5026 dbSNP
rs1277673139 5027 dbSNP
rs1191528894 5028 dbSNP
rs1349579137 5031 dbSNP
rs1211067531 5034 dbSNP
rs1478490843 5036 dbSNP
rs45495193 5052 dbSNP
rs1484882293 5053 dbSNP
rs1206774593 5058 dbSNP
rs1202530475 5061 dbSNP
rs1262209068 5068 dbSNP
rs893913505 5084 dbSNP
rs1004848626 5087 dbSNP
rs1346304813 5090 dbSNP
rs1192001550 5102 dbSNP
rs996118580 5103 dbSNP
rs1369327177 5113 dbSNP
rs1397181446 5120 dbSNP
rs1277343976 5121 dbSNP
rs1454849007 5123 dbSNP
rs1016960461 5127 dbSNP
rs1309279355 5130 dbSNP
rs35282916 5130 dbSNP
rs398032098 5130 dbSNP
rs79504680 5130 dbSNP
rs77285649 5131 dbSNP
rs866869786 5132 dbSNP
rs980889422 5136 dbSNP
rs1033763531 5143 dbSNP
rs1455832375 5147 dbSNP
rs1008728088 5151 dbSNP
rs960744289 5158 dbSNP
rs149152441 5168 dbSNP
rs368776412 5174 dbSNP
rs1252680789 5178 dbSNP
rs992670081 5182 dbSNP
rs1484991472 5196 dbSNP
rs188394913 5202 dbSNP
rs1211273962 5217 dbSNP
rs547731527 5225 dbSNP
rs946001516 5241 dbSNP
rs1314253165 5242 dbSNP
rs1282586546 5246 dbSNP
rs977721239 5248 dbSNP
rs925667422 5257 dbSNP
rs1227478162 5261 dbSNP
rs375216224 5275 dbSNP
rs74996624 5277 dbSNP
rs1219428575 5282 dbSNP
rs1027801508 5287 dbSNP
rs1378351162 5291 dbSNP
rs549835024 5293 dbSNP
rs1039467670 5299 dbSNP
rs569540250 5301 dbSNP
rs1314574120 5307 dbSNP
rs1450109659 5307 dbSNP
rs991146358 5308 dbSNP
rs45461894 5312 dbSNP
rs1268622171 5314 dbSNP
rs933707596 5327 dbSNP
rs1161506223 5330 dbSNP
rs1422065058 5335 dbSNP
rs1256088140 5350 dbSNP
rs1211630734 5352 dbSNP
rs1051224850 5355 dbSNP
rs866316578 5358 dbSNP
rs982331675 5372 dbSNP
rs924235564 5379 dbSNP
rs1269551891 5387 dbSNP
rs935478955 5391 dbSNP
rs558320374 5392 dbSNP
rs182321736 5394 dbSNP
rs1359756992 5397 dbSNP
rs1319669205 5403 dbSNP
rs932106343 5405 dbSNP
rs1050471257 5408 dbSNP
rs898538193 5419 dbSNP
rs1002209681 5428 dbSNP
rs1368042623 5433 dbSNP
rs1033647404 5440 dbSNP
rs1426095077 5443 dbSNP
rs944724588 5460 dbSNP
rs1188329465 5470 dbSNP
rs1465581002 5477 dbSNP
rs1250273564 5478 dbSNP
rs534854223 5479 dbSNP
rs1417852547 5492 dbSNP
rs1487936754 5496 dbSNP
rs1460313601 5497 dbSNP
rs1265567802 5500 dbSNP
rs1223066028 5501 dbSNP
rs1328407230 5506 dbSNP
rs960796245 5514 dbSNP
rs1046933 5518 dbSNP
rs1436795138 5529 dbSNP
rs1297180487 5532 dbSNP
rs1228886330 5533 dbSNP
rs1370560110 5537 dbSNP
rs992219252 5540 dbSNP
rs1225027426 5541 dbSNP
rs543656842 5550 dbSNP
rs1385353972 5551 dbSNP
rs561744446 5553 dbSNP
rs1288425096 5566 dbSNP
rs1036666771 5569 dbSNP
rs1294224435 5573 dbSNP
rs897767788 5577 dbSNP
rs995066258 5581 dbSNP
rs1024163866 5596 dbSNP
rs967600772 5597 dbSNP
rs1392460867 5599 dbSNP
rs1197172964 5608 dbSNP
rs1231325903 5614 dbSNP
rs1432259002 5620 dbSNP
rs1027523134 5627 dbSNP
rs554862728 5635 dbSNP
rs894214645 5636 dbSNP
rs977399320 5639 dbSNP
rs1481754376 5641 dbSNP
rs1322026871 5654 dbSNP
rs1205871517 5657 dbSNP
rs1204105314 5661 dbSNP
rs1344192205 5666 dbSNP
rs1012634135 5668 dbSNP
rs761728930 5676 dbSNP
rs14062 5677 dbSNP
rs187237440 5681 dbSNP
rs975054989 5683 dbSNP
rs920906978 5686 dbSNP
rs1388726959 5699 dbSNP
rs753884395 5702 dbSNP
rs868683563 5711 dbSNP
rs1177898272 5714 dbSNP
rs933766831 5717 dbSNP
rs557376164 5739 dbSNP
rs1227065192 5748 dbSNP
rs759785222 5756 dbSNP
rs191716296 5757 dbSNP
rs1046936 5760 dbSNP
rs908744483 5763 dbSNP
rs915371531 5768 dbSNP
rs1471404818 5776 dbSNP
rs1250485140 5781 dbSNP
rs1182246687 5782 dbSNP
rs559554619 5784 dbSNP
rs932158424 5792 dbSNP
rs1167685863 5796 dbSNP
rs1345519171 5797 dbSNP
rs1419039572 5807 dbSNP
rs940183773 5810 dbSNP
rs1409693031 5835 dbSNP
rs1225623850 5840 dbSNP
rs986151819 5843 dbSNP
rs1168760440 5848 dbSNP
rs1352468591 5857 dbSNP
rs911997288 5866 dbSNP
rs566209791 5871 dbSNP
rs1354222739 5874 dbSNP
rs1332707782 5876 dbSNP
rs1395945843 5896 dbSNP
rs1403440221 5917 dbSNP
rs1412862573 5942 dbSNP
rs1036395601 5946 dbSNP
rs1455365262 5947 dbSNP
rs897728897 5948 dbSNP
rs930616354 5949 dbSNP
rs1473252017 5953 dbSNP
rs898753333 5956 dbSNP
rs1186830856 5961 dbSNP
rs1442901456 5966 dbSNP
rs1002430238 5972 dbSNP
rs1206535241 5975 dbSNP
rs1463737788 5977 dbSNP
rs894280706 5981 dbSNP
rs1229103371 5987 dbSNP
rs1012773617 5989 dbSNP
rs1055146812 5998 dbSNP
rs1282499343 5998 dbSNP
rs1244754326 6003 dbSNP
rs1341575508 6005 dbSNP
rs1336586564 6006 dbSNP
rs1270580537 6027 dbSNP
rs1387465681 6036 dbSNP
rs1320877968 6045 dbSNP
rs758621434 6050 dbSNP
rs778193794 6055 dbSNP
rs1162103254 6057 dbSNP
rs1473097802 6058 dbSNP
rs896468543 6062 dbSNP
rs752168281 6065 dbSNP
rs1045489006 6068 dbSNP
rs1206082576 6069 dbSNP
rs181726687 6074 dbSNP
rs1448928644 6077 dbSNP
rs558614842 6091 dbSNP
rs967276167 6101 dbSNP
rs957263150 6102 dbSNP
rs1475372146 6108 dbSNP
rs999096831 6111 dbSNP
rs1011122699 6112 dbSNP
rs1298754658 6112 dbSNP
rs1022984938 6113 dbSNP
rs1347704014 6113 dbSNP
rs541257546 6118 dbSNP
rs1422033572 6128 dbSNP
rs1392811489 6129 dbSNP
rs1411331834 6129 dbSNP
rs1168762240 6131 dbSNP
rs561047305 6134 dbSNP
rs953525710 6140 dbSNP
rs1314168821 6144 dbSNP
rs1032811965 6146 dbSNP
rs1198282835 6150 dbSNP
rs1452309472 6157 dbSNP
rs957297087 6160 dbSNP
rs1429916795 6179 dbSNP
rs1268225863 6187 dbSNP
rs975283608 6188 dbSNP
rs1363770575 6191 dbSNP
rs1275818553 6193 dbSNP
rs1365090085 6197 dbSNP
rs1229422819 6199 dbSNP
rs1273829920 6200 dbSNP
rs1302882727 6203 dbSNP
rs1345977095 6205 dbSNP
rs1213197103 6208 dbSNP
rs1436722255 6209 dbSNP
rs780886049 6211 dbSNP
rs955034699 6228 dbSNP
rs972471765 6230 dbSNP
rs986606989 6232 dbSNP
rs1214221833 6234 dbSNP
rs930648467 6246 dbSNP
rs1412498294 6248 dbSNP
rs745327738 6252 dbSNP
rs1172257995 6254 dbSNP
rs1450416469 6257 dbSNP
rs1271214913 6258 dbSNP
rs915853309 6271 dbSNP
rs1483018664 6274 dbSNP
rs1253117408 6288 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.514 6.1e-3 -0.416 2.4e-2 23 Click to see details
GSE21032 Prostate cancer 0.225 2.0e-2 0.175 5.7e-2 83 Click to see details
GSE21687 Ependynoma primary tumors 0.236 3.0e-2 0.129 1.5e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.53 3.1e-2 -0.527 3.2e-2 13 Click to see details
GSE14794 Lymphoblastoid cells -0.19 3.6e-2 -0.061 2.8e-1 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.397 4.2e-2 -0.368 5.5e-2 20 Click to see details
GSE19350 CNS germ cell tumors 0.472 6.1e-2 0.490 5.3e-2 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.276 9.1e-2 0.326 5.6e-2 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.307 9.4e-2 0.651 9.4e-4 20 Click to see details
GSE17306 Multiple myeloma -0.154 1.5e-1 -0.204 8.0e-2 49 Click to see details
GSE32688 Pancreatic cancer 0.155 2.0e-1 0.091 3.1e-1 32 Click to see details
GSE38226 Liver fibrosis 0.184 2.1e-1 0.127 2.9e-1 21 Click to see details
GSE21849 B cell lymphoma 0.11 2.9e-1 0.274 7.5e-2 29 Click to see details
GSE26953 Aortic valvular endothelial cells 0.117 2.9e-1 0.104 3.1e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.052 4.0e-1 -0.211 1.6e-1 25 Click to see details
GSE19783 ER- ER- breast cancer 0.015 4.5e-1 0.005 4.8e-1 79 Click to see details
GSE28544 Breast cancer 0.019 4.6e-1 0.415 2.2e-2 24 Click to see details
GSE27834 Pluripotent stem cells -0.022 4.7e-1 0.112 3.4e-1 16 Click to see details
GSE19536 Breast cancer 0.002 4.9e-1 -0.038 3.5e-1 100 Click to see details
GSE19536 Breast cancer 0.002 4.9e-1 -0.038 3.5e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.308 0.02 -0.354 0.01 42 Click to see details
BLCA -0.439 0.03 -0.360 0.07 18 Click to see details
STAD -0.298 0.05 -0.313 0.04 32 Click to see details
CHOL -0.522 0.07 -0.400 0.14 9 Click to see details
PCPG -0.963 0.09 -1.000 0.5 3 Click to see details
ESCA 0.395 0.11 0.009 0.49 11 Click to see details
LIHC -0.157 0.14 -0.124 0.2 49 Click to see details
LUSC -0.159 0.17 -0.191 0.13 38 Click to see details
BRCA -0.105 0.17 -0.141 0.1 84 Click to see details
KIRP -0.171 0.17 -0.261 0.07 32 Click to see details
THCA -0.109 0.21 -0.170 0.1 59 Click to see details
LUAD -0.182 0.29 -0.147 0.32 12 Click to see details
KICH 0.116 0.29 0.122 0.28 25 Click to see details
CESC 0.5 0.33 0.500 0.33 3 Click to see details
COAD -0.16 0.35 -0.643 0.04 8 Click to see details
PAAD -0.294 0.35 -0.400 0.3 4 Click to see details
KIRC -0.024 0.42 0.010 0.47 68 Click to see details
PRAD 0.028 0.42 0.042 0.39 50 Click to see details
UCEC 0.034 0.45 -0.084 0.37 19 Click to see details
UCEC 0.034 0.45 -0.084 0.37 19 Click to see details
UCEC 0.034 0.45 -0.084 0.37 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein