miRTarBase - #MIRT727176 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MLXIP   
Synonyms MIR, MONDOA, bHLHe36
Description MLX interacting protein
Transcript NM_014938   
Expression
Putative miRNA Targets on MLXIP
3'UTR of MLXIP
(miRNA target sites are highlighted)
>MLXIP|NM_014938|3'UTR
   1 CTGCTTAGCTGGCATGTGGCCGCATGAGATGCCAGGAGACCCTTCCCTGCCCATGGAGAGTAGGCTGCGCCCCCCAGCCC
  81 TTCCTGACGCTCAGCCTCGGGGCCTCTCTCCAACTCTGCCGGCCCACCGTGGCATCGGGAGGCCATGCTCAGGTCTGAAG
 161 CAGGTTTGGGGCCTGCTGACAGCAATAGCCCGCCTTTGGGAACCCCTTGCTGTGAACTCTCTCACTCAGTGACCTCAGTC
 241 ACCAACCTCCTCTGCCCTCGGGGCAGCCCACACAAAAGGGAAGTGCTGGCCGTGCTGGTCCTGCCCTGCTGGTGGCCTGC
 321 CGGGCCTGGCGCCGGTGAGCGGAATCGATGGGATGAGGGTGACAGGGCCTGCTCCTGTCCTGAGGCCCAGCCTTGTCCCT
 401 CCTGCCACGTCCTGTCCACATGCATGCCTCTGCCTGATGCCCTGCTCCACTCTCTGGTCTGCCCGTGGGGCAGTTGGAAG
 481 GCGTCTTTCTTTCTCCCCTCAACTCTGACAGCACCCAGCCCTTGTGGATGGACTTGGGCTTCTATTCAGGCTTATGCATG
 561 GCAGGCTGCCAGGGGGAAGTGCCTTCTTCAGAGGTCCTCCAGGACACATGTGTGCAGAAACGGTGGATGTGGAACACACA
 641 GGACCAGAATGGAAGCGTGTGATGCACGGTGGCTGCTCTGGCTGAGAGGCCCTGCTGGGCATGTTTCATCTGTCCCCTTT
 721 TAGCTCCACCTGACATTGCAGGATCCATGGGGACTCAGCCCAGGGCCTTCTCGGATGTCACCTCACCGCTGTGGCCCTTC
 801 TGCCGTTCTTCTCCACTTGGCTCCAGCTGCAGCTGTTGACAGATCAAGCATGTCCTGTGGGAGCTTAGAACCCTGAAGTT
 881 CTAGTGTCTGAAAGATCAGACTCCACGTCCTGCTGTCAGCCTTGTCATCTTGTCTGATGTCTTTCAGCTGGGAGCCCCAA
 961 ACCAGGACAGTTCTCGGACCAAAGATGCCCCCACACTCAAAAGTCTGTCCCGTCTTGTGTTTGGAGAAGGAAACAATGTT
1041 GGCAGGCAGCACTCTGTGGTGGTCAGCCCTCAGAGCTGTTTCTAGGCATCTCTCAGATCAGACAGCAAAGAATCTACCCA
1121 GATCTGGGCTGGGTGGAGGTGTGGCTGGGCTGGGGGCCATTCTGAGCCTGCAGTGAGAGTTTGGCCCAGCCTCAGTCCTT
1201 GCTCTTCTCTGGCTACCTCTGCAGGGAGCTGCAGGGGCAAGCACTCTCTCCAGCACTCAGGAAGCCCGGCCGAGGGTACC
1281 TCCTCGTGGAAAGAATGCACTTTAAAGCTCTGCTGAGGAGTTCGGAGCCCAGGCTTTCAGGCGACCTCTGCCCTCCCTGC
1361 CTCTCCTCACCCTCCCTCTCTTCCTGCAGGGCCTGGGAAGGGCTTTGAGGGAGCCTGGGAGCCATGTGAAGAGGGGCACG
1441 CCTGGGCTGTCCCACAGTTTAGATCCAGTTGGAGGTTCTCCCTGGCTCCTGCAGGCCTGCGGGGATCTCTCCCCACTTCA
1521 GGCCTCCGGCCAGCTGCCTGCCCTCTTGTCTGTGCTTCAGCCCTGCACAAAAGCAGCTTGGTGACACCACTCAGCCACCC
1601 AGAGTACGTGTTTACAGGCTTTCCAGATCACCTTCCTGTGGGGTGAACGTAATGAGGCGGGGCTGGTCCTTGGAATTTCC
1681 CCTGGAAAATGGTAACAGACTCCATCCTTGACCCGGGGATGAGCATGAAGGCATTGTCCCAAAGGCAGAGGCCACCGTGG
1761 TAGGAATTCCACCAAGGCCAGAAGGGAAAAAGGAAGAACCCACCGTGTCTGGCTGTGCGGGCCCTGGGGAGGGTCGTGAG
1841 TGCAGCCCCTCTCTACTTCTGTGCCTTTGTAAAACGTGTAGATAACCGCAGTGGTTGGCTGAGCCAAGAACTCTCCTAAA
1921 TCAGTGGCTTTCTCCCCACCCCTTGCTGGGGAGTCATTTTTAAAAAAATCTGTGGGATATAAAATTGGCCTCCTGCTGCT
2001 TCAGCCTACCTCTCCCTCTGCTGACTTAATGTCGTGATTCTGTTTCTTCAGATATTTAAGGCTGTTAGGTTGTGTGAGCC
2081 TTGAAGTGTGTGTGTGTGTCCCAGCGACTGTCCACTGTCCAGGAGATGCATGTCTTTGTATTGGAGATATTTCTGTAACT
2161 CATTCTCTTGGTGCTCACGATTGCCATGGCCATAGGGCCACAGTGCCGTATCTGCTGCAGACATGATTGTTTCTTGTTCT
2241 AGAGGTTTTCTTGTTTTCGAATCTTGCCTGATGAATCCAGCCAGACCAAGGGGCCTAGATTTGACCTCTGTCCTGGGCTC
2321 CTGGGCCAGGTGCAGGAACATCTGAGGCCACTCTGCTGGCCACCTCCAGTGGGTGCTGACCACAGGATGGGCTTTGTTTA
2401 CACTCATTTTCACCCTGATTCTTGCCCCCACTTTCATAAAAGAAACTTCAAAATGCTGACGCTTTGGAGAGTAAGAAAAT
2481 CAATCTTGGCTGGGCACGGTGGCTCCTGCCTGTGATCCTAGCACTTTGGGAGGCTGAAGCTGAAGGATCACTTGAGCTCA
2561 GGAGTTGGAGACCAACCCTGGCAACATAACAAGACCCTGTCTCTACAAAAAAAAAAAAAAAAAAAAAAAATTTAGCCGTG
2641 TGTAGCAGTGAGTGCCTGTGGTCCCAGCTACTTGGGCCTGAGGCTGGAGGATTGCTTGAGCCTAGAAGTTGCAGTGAGCT
2721 ATGATCATGCCACACTGTACTCCAGCCTGGATGACAGAGTGAAACCCTGCCTCTAAATAAAAGAAAATAGAGGCAGACTG
2801 TGGTGGCTCACGCCTGTAATCCCAGCACTTTGGTAGGCCAAGGCGGGTGGATCACCTGCAGTCAGGAGTTCACAACCAGC
2881 CTGACCAACATGGTGAAACCCTGTCTATACTAAAAATACAAAACATTAGCCACGTGTGGTGGTACACGCCTGTAATCCCA
2961 GCTACTCGGGAGGCTGAGTCAGGAGAATCACTTGAACCTGGGAGGCGGAGGTTGCAGTGAGCTGAGATTGTACCACTGCA
3041 CTCCAGCCTGGGTGACAGAGCAAAACCCTATCTCAAAAAAAAAAAGAAGAAAAAAATAGAAAATCCAAAAAGAAAAACCA
3121 GAAGGCCTGCTGGCGTATAAATCCCTGGGCGGGTTTCTGATAAATTGCCCTGTGCTGTCAGCCCCTGCACTGCACTGCTG
3201 CCTTCCATGGTGGGTGGGAGACCCCAGAGCGGGGCAGGCGCCACTGAGGGCTTTTCTTGGAGTCGGCCAGCAGGCCACGC
3281 AGCATCCGGCACCCTGGGCGGGCTGGCTAGCTGCCTTCTTAGGACATCTCTACTTTGAAGGATTTTACCGCAGGAAGCAA
3361 TAGCAGCGCTGGCCATTGGTGCTGATGACAGCATTGGGTCTGGTTGAGGGGAAGGGGCTGGAAAGCAGCAGACCCCCCCA
3441 GTGCTGCGCATGGTCCCGGAGCTGTCAGCCAGGGGAGTGGGGTCAGCCGTCAGCCAGCCCTCCCATTTCCCGCCCATGGG
3521 CCCTGACCACACTCCCTTTTCTAGAAGTCAATCCTAAGGTTTCTCTGCTCTGGCTAAGAGGATGTAAATTTGGATTCTTA
3601 GAGGGCATGGCACCCCCAGTCCCTGCCCAGATAAAGTAGCACAGTGGCAGGCAGCACCTCTGTCTGTTGCTGACGTTGGG
3681 GGGCTTACACACCCACCTCATCTCCGTGCACAGCCATGACTGGCCCTGCCGGCAGCTGGGGTGCAGGTAAGGGTCTCTCT
3761 CATAGAGGGGAGCTGCAGCTGAGAACTGGCGAGGCCCCTTCCTCCAAGGCCCTAGCTGGCCCCCGGGTGAACCTGAGGTG
3841 GCAGGTTCAGGTTTTCAAGATGGTGAGGTCTCGCTGTCTGCTGGACAGTACGTTAGGCTCTCAGAACTCATGGGTGTGGA
3921 GCTGGGCCTGTCCCGGGCCAGTGGACCCCTGTGTGTGGGGGATTTGGGGTGCTGTGGGCCTGGTTATGCACTGGCAGATG
4001 GACCTTGCTTTGGTCCAGCTCTTTTCCTTACCCTGGCTCTGACGTGGGAAGGCTTGGAGGGCCCGTCTCATCACCCCCGT
4081 TCGCCCTCAGCTGTCCCTTTCCCTTGTCGCCTGGCCGCTGCCTCGCCCGCCTGAGGCCTCCTAGCAGGCAGCCTGGGTGT
4161 GAGTTGAGCCTCTCTCTTTTCCCTCTGGTGGGAAAGTGGCCTTTCCCTCAACACCTGCTCCCCGGCCCCAGAGGAACCCA
4241 CCTGTTTTGGAGCTCAGCTTGGCCCAGCGTTTCCTTGGGGAAGGGAAAGGAGGGCTGGACAGCACTGATCCGGGCAGGCA
4321 GCGTGTGCAGCAGTGGCCAGCCAGAGTGCCAAAGATGCACGGGGATGTGGTGTGTGGCTCCGGGCCCTCGACATCTCTGC
4401 TTTGGGGGATTTTTACCTTGTCTGCACACTTGTCAGGGGAGAGGGGACAGCAAGGTGGGAGGTTGAAGAGCTTTGAGGCT
4481 CAGCAGCATGTTTGTGGCATTCGGTGGACACCATGGCCTTGGGCGGCTGGACAGGTTTTTGTGATGTGAGGGACACGCAT
4561 GGGGCACATGGTAAGCTTGGCAAGGGCTCCAGGAACGCTGACGAAGGGTTTTAGGACCCCCACCCCCATGCCTGTACCAG
4641 GGCTGGCCTCCAGAGCGGGTGAGGACAGAGCAGCTGTGGGCTTTTCATTCTGAGGTCTTGGCCCCCCTGGCCACCGCAAG
4721 GGACTCTTTGCTTGTCAGGGCTTGCAAAAACCAACCTTCGAGAAAGAAAAGGGAACTCTTCACGTTGAATGTTGACTTTG
4801 TGTGTATGCGTGTGTGTGTGTGTGTGTGCACGCGCGCGTGTGCGTGTTGACTTCATGGAATTTTGTTTTGTGAAATTCCC
4881 CTCCAATCGTGTCAGAATTTACCTCCATGCCCCAGTCACACTGTTGGTTCTGCGCTCTGAACCTGGGTGTAGCTCATTTG
4961 AAGGACTCTCTTCTGCGTTTCCTAACAGTTATTTGGTGGTCTCAAGAGTTGAGGTTGTGGAGGGTTGGGAGAAACTGAAG
5041 TTCTATACATTTCCATAGAGTTTACATCCTGCAGTTAAAAGGCAGGGAGGGCTCAGCCCGGGCCCCACAGCTCCAGGCCA
5121 TCCCCTACGGGCTGCCCACAGTGCCCCCTTTTCTCTAGCCGAATCTTTTTCGAACAGCCCGGGAAAGGAAAACGGATTCA
5201 CTTGCTGATTTTGTTCACGGCGGAAGCACCATGTTCCGTTCCTTTTTCAGGTTCAGTTTGTTGTGTAAATGGCGGTTTTT
5281 TCTGGTGTGAGCTTTGGTGATGGTGGCAGGGCTCCTTTGAAGAGATGGTTCCACCTCGTGGTCTGAAGAACAAACCAGAG
5361 AAGAGTCTGGTTTGGCCAGAGGCCCCCTCCGGTCCACGTCACCCTGAGTACACCCCTCTGATTGCTCTGCTGTCAAGAAG
5441 CACGTTTCCACCAGCTGTATTCAACACTACAATGCATTTTTTAAACTATATTTGCATCCAAGACAATAAAGACACCTTAT
5521 TTTTTTTGAAAAGCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU---A-CACGACGAu 5'
            :|||  |||:   |  ||||||| 
Target 5' taTAAA--ATTGGCCTCCTGCTGCTt 3'
1978 - 2001 144.00 -10.30
2
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||: |||  |:| ||:|||| 
Target 5' ggCAGCACCTCTGTCTGTTGCTg 3'
3650 - 3672 144.00 -15.30
3
miRNA  3' guGUU-UGGUAAUACACGACGau 5'
            ||: :||: ||| ||||||  
Target 5' caCAGTGCCG-TATCTGCTGCag 3'
2199 - 2220 139.00 -15.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30540163 10 COSMIC
COSN28800057 23 COSMIC
COSN30520240 27 COSMIC
COSN30136670 33 COSMIC
COSN30450815 53 COSMIC
COSN30558303 76 COSMIC
COSN30108357 89 COSMIC
COSN31605746 99 COSMIC
COSN30533399 115 COSMIC
COSN1560353 130 COSMIC
COSN22080962 141 COSMIC
COSN6535073 176 COSMIC
COSN25915225 345 COSMIC
COSN30550911 366 COSMIC
COSN1143584 381 COSMIC
COSN32076482 383 COSMIC
COSN26727841 484 COSMIC
COSN15053108 610 COSMIC
COSN31565931 974 COSMIC
COSN31584111 1006 COSMIC
COSN26634079 1013 COSMIC
COSN22917420 1287 COSMIC
COSN17181759 1541 COSMIC
COSN22609022 1608 COSMIC
COSN5932962 1851 COSMIC
COSN28760100 2106 COSMIC
COSN30540728 2113 COSMIC
COSN28746514 2158 COSMIC
COSN28703322 2179 COSMIC
COSN30175348 2199 COSMIC
COSN1560354 2240 COSMIC
COSN31609020 2259 COSMIC
COSN24304361 2348 COSMIC
COSN17037851 2386 COSMIC
COSN30022144 2461 COSMIC
COSN22208556 2476 COSMIC
COSN6408214 2607 COSMIC
COSN25400376 2765 COSMIC
COSN27930970 3113 COSMIC
COSN20614205 3449 COSMIC
COSN30440696 3630 COSMIC
COSN1560355 3840 COSMIC
COSN21905262 4162 COSMIC
COSN16655897 4194 COSMIC
COSN7313758 4225 COSMIC
COSN16122105 4598 COSMIC
COSN27054865 4934 COSMIC
COSN15160256 5114 COSMIC
COSN24563269 5156 COSMIC
COSN4701082 5262 COSMIC
COSN1560356 5275 COSMIC
rs3809117 3927 GWAS
rs1043763 4551 GWAS
rs1043764 4557 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1393264699 1 dbSNP
rs1292838402 2 dbSNP
rs893750635 3 dbSNP
rs746436910 4 dbSNP
rs769959326 9 dbSNP
rs775646085 10 dbSNP
rs1241101254 13 dbSNP
rs1311770638 15 dbSNP
rs572785478 20 dbSNP
rs371829134 22 dbSNP
rs11057509 23 dbSNP
rs1253859876 26 dbSNP
rs767887375 28 dbSNP
rs1197318680 31 dbSNP
rs370040163 33 dbSNP
rs1203175768 37 dbSNP
rs750888515 38 dbSNP
rs1002877674 43 dbSNP
rs756617824 44 dbSNP
rs778226123 46 dbSNP
rs1001587158 48 dbSNP
rs1163524475 51 dbSNP
rs1311263841 57 dbSNP
rs1036150102 69 dbSNP
rs558433345 70 dbSNP
rs1293733645 73 dbSNP
rs895819550 74 dbSNP
rs1342884033 75 dbSNP
rs1318250527 78 dbSNP
rs1021820945 89 dbSNP
rs994614469 90 dbSNP
rs968895576 99 dbSNP
rs183348638 100 dbSNP
rs1025635438 102 dbSNP
rs1193095482 103 dbSNP
rs1448506646 116 dbSNP
rs1241535949 119 dbSNP
rs952968665 121 dbSNP
rs147205135 122 dbSNP
rs1018470914 126 dbSNP
rs562997375 127 dbSNP
rs1346824610 129 dbSNP
rs761117981 130 dbSNP
rs953178971 136 dbSNP
rs1387102701 137 dbSNP
rs530166584 138 dbSNP
rs922386676 151 dbSNP
rs956477195 155 dbSNP
rs1036196069 157 dbSNP
rs774044968 170 dbSNP
rs1434511781 172 dbSNP
rs1163496498 183 dbSNP
rs1360044062 186 dbSNP
rs988243035 189 dbSNP
rs1178522093 190 dbSNP
rs914891871 191 dbSNP
rs946655098 192 dbSNP
rs187476028 193 dbSNP
rs894535259 196 dbSNP
rs1265279458 199 dbSNP
rs560256647 205 dbSNP
rs1185655940 206 dbSNP
rs1485222303 210 dbSNP
rs1428151203 211 dbSNP
rs1316727701 214 dbSNP
rs1012981486 217 dbSNP
rs926467084 219 dbSNP
rs939142577 223 dbSNP
rs1271811990 224 dbSNP
rs1056297386 225 dbSNP
rs527711217 228 dbSNP
rs1291985405 234 dbSNP
rs1205676599 237 dbSNP
rs1031927310 241 dbSNP
rs115445208 243 dbSNP
rs997572242 251 dbSNP
rs556011571 260 dbSNP
rs761959130 261 dbSNP
rs1186838896 262 dbSNP
rs1245267471 264 dbSNP
rs1467279543 272 dbSNP
rs571168366 274 dbSNP
rs531929738 275 dbSNP
rs888423343 284 dbSNP
rs985863513 286 dbSNP
rs11836471 292 dbSNP
rs765461688 293 dbSNP
rs1231976234 299 dbSNP
rs761271565 303 dbSNP
rs1159671072 307 dbSNP
rs1368551598 309 dbSNP
rs1459315886 310 dbSNP
rs1005818555 315 dbSNP
rs1018501957 317 dbSNP
rs1168489021 321 dbSNP
rs752236544 322 dbSNP
rs750381143 323 dbSNP
rs919163938 324 dbSNP
rs998797251 326 dbSNP
rs1377332547 331 dbSNP
rs571975073 332 dbSNP
rs192723994 334 dbSNP
rs557471932 335 dbSNP
rs1217283862 340 dbSNP
rs535997929 341 dbSNP
rs9668459 342 dbSNP
rs934808592 343 dbSNP
rs1200988353 347 dbSNP
rs533553834 348 dbSNP
rs1379394114 350 dbSNP
rs1375537672 358 dbSNP
rs558421156 359 dbSNP
rs1180926728 364 dbSNP
rs1179009610 365 dbSNP
rs576775786 367 dbSNP
rs1458866138 369 dbSNP
rs1250723770 375 dbSNP
rs1256197594 390 dbSNP
rs1415884338 391 dbSNP
rs1475916942 391 dbSNP
rs1191395229 392 dbSNP
rs776175074 393 dbSNP
rs761278005 398 dbSNP
rs769786342 398 dbSNP
rs1316706074 400 dbSNP
rs1465943664 403 dbSNP
rs369823539 409 dbSNP
rs751261895 410 dbSNP
rs1465674729 420 dbSNP
rs1303666742 421 dbSNP
rs1381400048 426 dbSNP
rs1056728943 427 dbSNP
rs919077827 428 dbSNP
rs556121286 429 dbSNP
rs1244585892 435 dbSNP
rs1015956614 438 dbSNP
rs763054011 440 dbSNP
rs754835744 441 dbSNP
rs1295223862 447 dbSNP
rs963125514 449 dbSNP
rs768663871 450 dbSNP
rs142785313 451 dbSNP
rs762053679 453 dbSNP
rs1026081815 455 dbSNP
rs960159920 460 dbSNP
rs1197678493 464 dbSNP
rs541934121 465 dbSNP
rs376243705 466 dbSNP
rs1256278341 470 dbSNP
rs978792624 474 dbSNP
rs888454513 475 dbSNP
rs1273934486 477 dbSNP
rs1274515942 478 dbSNP
rs1190963066 482 dbSNP
rs1262372516 483 dbSNP
rs4758685 484 dbSNP
rs1188212172 488 dbSNP
rs1333034938 489 dbSNP
rs1422754441 494 dbSNP
rs1039721169 497 dbSNP
rs1177017961 498 dbSNP
rs1377573310 501 dbSNP
rs777171870 502 dbSNP
rs1417922484 512 dbSNP
rs934708435 519 dbSNP
rs900116428 520 dbSNP
rs145660194 522 dbSNP
rs998431509 524 dbSNP
rs1433451306 526 dbSNP
rs1273606176 527 dbSNP
rs1367321477 528 dbSNP
rs1171656907 531 dbSNP
rs1220221799 533 dbSNP
rs1030263059 546 dbSNP
rs1349674906 548 dbSNP
rs1214020248 552 dbSNP
rs766906793 555 dbSNP
rs1378997090 556 dbSNP
rs1441608220 558 dbSNP
rs150749822 559 dbSNP
rs1190443966 561 dbSNP
rs1477195679 571 dbSNP
rs1264556983 577 dbSNP
rs1196419017 578 dbSNP
rs1484897685 580 dbSNP
rs901306098 583 dbSNP
rs934155625 584 dbSNP
rs1334294616 586 dbSNP
rs890066294 588 dbSNP
rs1391526758 597 dbSNP
rs1306187825 604 dbSNP
rs1341171715 608 dbSNP
rs892607574 610 dbSNP
rs1009739709 613 dbSNP
rs564764854 622 dbSNP
rs1333338114 623 dbSNP
rs967768580 627 dbSNP
rs1283637911 636 dbSNP
rs980439526 638 dbSNP
rs1037354959 639 dbSNP
rs1033293873 640 dbSNP
rs1464678578 642 dbSNP
rs1320633983 656 dbSNP
rs532069695 657 dbSNP
rs184555938 658 dbSNP
rs1474551324 661 dbSNP
rs992064761 664 dbSNP
rs919096288 667 dbSNP
rs1026493210 668 dbSNP
rs929118875 669 dbSNP
rs982864447 676 dbSNP
rs759980831 677 dbSNP
rs910004341 691 dbSNP
rs1318705984 700 dbSNP
rs1014544146 709 dbSNP
rs1231529213 710 dbSNP
rs1354217979 715 dbSNP
rs765368038 718 dbSNP
rs1448514274 721 dbSNP
rs1342002206 727 dbSNP
rs1328879437 733 dbSNP
rs1445507838 739 dbSNP
rs1400556055 748 dbSNP
rs941416024 752 dbSNP
rs1039753511 753 dbSNP
rs1459393040 757 dbSNP
rs1413730561 767 dbSNP
rs1164300449 768 dbSNP
rs899810163 771 dbSNP
rs139078759 773 dbSNP
rs529512814 774 dbSNP
rs1173509147 777 dbSNP
rs978692763 782 dbSNP
rs1240232562 786 dbSNP
rs892630749 788 dbSNP
rs547937988 789 dbSNP
rs1228749036 800 dbSNP
rs1358219374 803 dbSNP
rs149886942 805 dbSNP
rs1377243484 806 dbSNP
rs533542118 806 dbSNP
rs1310933263 812 dbSNP
rs551784556 824 dbSNP
rs1348722527 830 dbSNP
rs570400428 836 dbSNP
rs1324794274 846 dbSNP
rs1303694911 852 dbSNP
rs1001889795 855 dbSNP
rs1033323021 858 dbSNP
rs934164833 865 dbSNP
rs1158466318 870 dbSNP
rs1050374763 872 dbSNP
rs1382426912 891 dbSNP
rs911458539 895 dbSNP
rs537716787 907 dbSNP
rs941593839 908 dbSNP
rs1221521800 915 dbSNP
rs1038604948 921 dbSNP
rs992491041 922 dbSNP
rs866319429 927 dbSNP
rs1026189857 936 dbSNP
rs1217053898 939 dbSNP
rs1047471833 947 dbSNP
rs950686800 957 dbSNP
rs756538969 976 dbSNP
rs1014076655 977 dbSNP
rs1023245234 988 dbSNP
rs556445763 999 dbSNP
rs1000079049 1008 dbSNP
rs189827525 1009 dbSNP
rs1270317021 1010 dbSNP
rs975467554 1011 dbSNP
rs922695445 1012 dbSNP
rs4758684 1013 dbSNP
rs985582139 1015 dbSNP
rs1287964180 1018 dbSNP
rs772403761 1018 dbSNP
rs554295698 1024 dbSNP
rs1428701835 1032 dbSNP
rs933968710 1034 dbSNP
rs1311287737 1037 dbSNP
rs1051532958 1038 dbSNP
rs941541515 1043 dbSNP
rs776089503 1045 dbSNP
rs1315489042 1052 dbSNP
rs1278128698 1055 dbSNP
rs116641609 1057 dbSNP
rs1301525988 1059 dbSNP
rs1426082948 1062 dbSNP
rs1359989221 1068 dbSNP
rs1164119725 1069 dbSNP
rs374357206 1099 dbSNP
rs878859213 1100 dbSNP
rs1043896328 1102 dbSNP
rs904006829 1111 dbSNP
rs1290375416 1115 dbSNP
rs1478143798 1125 dbSNP
rs1047880808 1126 dbSNP
rs1179945202 1127 dbSNP
rs895549053 1134 dbSNP
rs1237728651 1135 dbSNP
rs1211718859 1152 dbSNP
rs1456080927 1154 dbSNP
rs949808607 1156 dbSNP
rs1001922241 1157 dbSNP
rs1218704936 1160 dbSNP
rs1044158995 1162 dbSNP
rs79154130 1171 dbSNP
rs80296286 1172 dbSNP
rs79673736 1174 dbSNP
rs754314886 1175 dbSNP
rs905655150 1175 dbSNP
rs1000069578 1179 dbSNP
rs1032918895 1186 dbSNP
rs769110708 1188 dbSNP
rs1399827257 1195 dbSNP
rs1010217518 1198 dbSNP
rs1359408200 1199 dbSNP
rs1030051821 1203 dbSNP
rs1220044329 1210 dbSNP
rs1244145506 1219 dbSNP
rs546196554 1219 dbSNP
rs1486401494 1226 dbSNP
rs1185187682 1233 dbSNP
rs762192422 1235 dbSNP
rs985916384 1236 dbSNP
rs1013290825 1237 dbSNP
rs564505905 1245 dbSNP
rs1185569968 1251 dbSNP
rs1458684537 1265 dbSNP
rs1264209733 1266 dbSNP
rs1018318204 1268 dbSNP
rs143867381 1269 dbSNP
rs765560690 1272 dbSNP
rs1006121257 1273 dbSNP
rs1183716531 1274 dbSNP
rs1310194331 1276 dbSNP
rs1449135430 1277 dbSNP
rs1388590057 1283 dbSNP
rs1384108547 1286 dbSNP
rs930246081 1287 dbSNP
rs1016119509 1289 dbSNP
rs916865686 1290 dbSNP
rs191911632 1300 dbSNP
rs1165283315 1313 dbSNP
rs964508619 1315 dbSNP
rs1379335102 1318 dbSNP
rs139783050 1324 dbSNP
rs1320123565 1325 dbSNP
rs921398725 1337 dbSNP
rs1363344959 1343 dbSNP
rs559592901 1362 dbSNP
rs1487266086 1366 dbSNP
rs986848674 1378 dbSNP
rs1214932076 1380 dbSNP
rs1315771597 1386 dbSNP
rs935806434 1392 dbSNP
rs913874013 1394 dbSNP
rs1054312956 1401 dbSNP
rs1378559826 1406 dbSNP
rs1242515135 1412 dbSNP
rs529456653 1414 dbSNP
rs1227046051 1421 dbSNP
rs1300758107 1425 dbSNP
rs1387397141 1431 dbSNP
rs945649264 1440 dbSNP
rs548017391 1441 dbSNP
rs925460466 1442 dbSNP
rs763114550 1448 dbSNP
rs1159009226 1450 dbSNP
rs1455083098 1460 dbSNP
rs1375537293 1464 dbSNP
rs559796188 1466 dbSNP
rs1265816243 1470 dbSNP
rs527421304 1473 dbSNP
rs551872601 1474 dbSNP
rs1192050092 1476 dbSNP
rs896268397 1481 dbSNP
rs1013736836 1482 dbSNP
rs1047412476 1483 dbSNP
rs1343190265 1486 dbSNP
rs886079571 1487 dbSNP
rs1006932177 1494 dbSNP
rs1476370631 1495 dbSNP
rs1234085208 1500 dbSNP
rs144507437 1501 dbSNP
rs754708202 1502 dbSNP
rs537854063 1512 dbSNP
rs1398132143 1513 dbSNP
rs964622339 1515 dbSNP
rs1178873889 1518 dbSNP
rs36007482 1528 dbSNP
rs1025745894 1529 dbSNP
rs1156729337 1530 dbSNP
rs1408065595 1534 dbSNP
rs1399633448 1544 dbSNP
rs951584878 1553 dbSNP
rs1471050279 1561 dbSNP
rs1046506328 1563 dbSNP
rs1358579318 1564 dbSNP
rs1477820849 1566 dbSNP
rs992778782 1569 dbSNP
rs1195844902 1576 dbSNP
rs918213068 1578 dbSNP
rs1030567048 1580 dbSNP
rs1201191629 1582 dbSNP
rs752347184 1585 dbSNP
rs979792834 1588 dbSNP
rs927011466 1608 dbSNP
rs1317269293 1609 dbSNP
rs78820220 1610 dbSNP
rs1229375297 1611 dbSNP
rs1338410811 1619 dbSNP
rs61952927 1628 dbSNP
rs1396310015 1632 dbSNP
rs755701384 1633 dbSNP
rs966647732 1636 dbSNP
rs751797869 1637 dbSNP
rs1170109882 1639 dbSNP
rs1374749566 1645 dbSNP
rs945904871 1649 dbSNP
rs535286713 1650 dbSNP
rs1446714995 1654 dbSNP
rs925576344 1654 dbSNP
rs777420043 1659 dbSNP
rs891079236 1660 dbSNP
rs748700336 1663 dbSNP
rs1007292460 1669 dbSNP
rs140138087 1670 dbSNP
rs1283453712 1679 dbSNP
rs1246403034 1680 dbSNP
rs572554462 1700 dbSNP
rs1384608086 1701 dbSNP
rs539905906 1715 dbSNP
rs184470886 1716 dbSNP
rs1354550183 1720 dbSNP
rs1025685261 1744 dbSNP
rs1404162476 1746 dbSNP
rs576311814 1747 dbSNP
rs1390607928 1755 dbSNP
rs949179684 1757 dbSNP
rs142388270 1758 dbSNP
rs1025632557 1760 dbSNP
rs969690703 1774 dbSNP
rs886110785 1777 dbSNP
rs941716929 1781 dbSNP
rs1480245408 1782 dbSNP
rs1289038624 1786 dbSNP
rs562241990 1788 dbSNP
rs574304709 1790 dbSNP
rs900450162 1793 dbSNP
rs1283447882 1800 dbSNP
rs957033124 1804 dbSNP
rs989859550 1805 dbSNP
rs996477730 1806 dbSNP
rs1433647410 1808 dbSNP
rs1030183019 1816 dbSNP
rs780400142 1819 dbSNP
rs1008319319 1820 dbSNP
rs1158408002 1832 dbSNP
rs1020954036 1836 dbSNP
rs966762189 1837 dbSNP
rs942599142 1841 dbSNP
rs1412803789 1849 dbSNP
rs1330931715 1850 dbSNP
rs1246086638 1852 dbSNP
rs1355212396 1859 dbSNP
rs1047796 1861 dbSNP
rs1032290120 1876 dbSNP
rs1306725916 1887 dbSNP
rs1347776584 1888 dbSNP
rs1224567169 1889 dbSNP
rs1285856508 1893 dbSNP
rs959670108 1897 dbSNP
rs570963227 1915 dbSNP
rs1284497156 1921 dbSNP
rs918101816 1923 dbSNP
rs1257894857 1933 dbSNP
rs1047125550 1940 dbSNP
rs949546303 1942 dbSNP
rs533373392 1943 dbSNP
rs1202852848 1948 dbSNP
rs151281440 1949 dbSNP
rs1025116853 1962 dbSNP
rs941747109 1963 dbSNP
rs1332391055 1967 dbSNP
rs1002422117 1972 dbSNP
rs189181704 1973 dbSNP
rs1178670820 1974 dbSNP
rs57376797 1977 dbSNP
rs1477137243 1978 dbSNP
rs1421364280 1980 dbSNP
rs1192693899 1982 dbSNP
rs989849550 1986 dbSNP
rs1169888254 1991 dbSNP
rs912959632 1993 dbSNP
rs1420235731 1994 dbSNP
rs1263297806 1997 dbSNP
rs1429267991 2001 dbSNP
rs1316652411 2007 dbSNP
rs1167245223 2009 dbSNP
rs1278073472 2009 dbSNP
rs967179646 2011 dbSNP
rs1364443888 2014 dbSNP
rs1368057094 2015 dbSNP
rs986975598 2019 dbSNP
rs912371329 2034 dbSNP
rs1323256430 2035 dbSNP
rs1464084988 2043 dbSNP
rs1398063456 2044 dbSNP
rs1169571988 2046 dbSNP
rs1329731875 2047 dbSNP
rs140490853 2063 dbSNP
rs1270414233 2065 dbSNP
rs3741452 2071 dbSNP
rs146994101 2086 dbSNP
rs919875174 2086 dbSNP
rs1456042283 2087 dbSNP
rs1257983276 2097 dbSNP
rs778503367 2106 dbSNP
rs181819520 2107 dbSNP
rs1010522680 2112 dbSNP
rs770091341 2122 dbSNP
rs1228084546 2124 dbSNP
rs1383828839 2126 dbSNP
rs1317376190 2127 dbSNP
rs747802405 2127 dbSNP
rs1444655930 2128 dbSNP
rs150413784 2135 dbSNP
rs1298802394 2138 dbSNP
rs1462490857 2145 dbSNP
rs1287403737 2154 dbSNP
rs1047813 2158 dbSNP
rs576334874 2177 dbSNP
rs12321299 2179 dbSNP
rs1184980552 2180 dbSNP
rs1437293842 2181 dbSNP
rs1242974754 2184 dbSNP
rs1032319862 2193 dbSNP
rs905321535 2203 dbSNP
rs185770711 2208 dbSNP
rs145192741 2209 dbSNP
rs1387190135 2215 dbSNP
rs537029807 2218 dbSNP
rs538590030 2220 dbSNP
rs983649923 2229 dbSNP
rs1294228353 2248 dbSNP
rs908023978 2253 dbSNP
rs142317430 2259 dbSNP
rs1353249103 2260 dbSNP
rs1307844074 2261 dbSNP
rs1402874335 2267 dbSNP
rs541300513 2268 dbSNP
rs770436958 2269 dbSNP
rs1393193644 2275 dbSNP
rs973120346 2278 dbSNP
rs1375474714 2284 dbSNP
rs894090944 2285 dbSNP
rs1011231557 2300 dbSNP
rs921603962 2311 dbSNP
rs1362838463 2315 dbSNP
rs1417553066 2315 dbSNP
rs1432492413 2316 dbSNP
rs1159223373 2318 dbSNP
rs1019927783 2321 dbSNP
rs931600582 2329 dbSNP
rs1265888787 2332 dbSNP
rs1199250208 2333 dbSNP
rs1490651463 2334 dbSNP
rs986534856 2335 dbSNP
rs1019820970 2340 dbSNP
rs148319428 2343 dbSNP
rs553257934 2350 dbSNP
rs911831031 2353 dbSNP
rs1352560046 2354 dbSNP
rs1205548402 2358 dbSNP
rs945969373 2379 dbSNP
rs386767091 2390 dbSNP
rs11057623 2391 dbSNP
rs11057624 2392 dbSNP
rs983117478 2393 dbSNP
rs908505114 2400 dbSNP
rs188981257 2404 dbSNP
rs1424479653 2422 dbSNP
rs1187453959 2426 dbSNP
rs1383829532 2428 dbSNP
rs1367292382 2429 dbSNP
rs1454906352 2435 dbSNP
rs1375481593 2436 dbSNP
rs1046474067 2437 dbSNP
rs570011391 2438 dbSNP
rs1432052682 2451 dbSNP
rs1159472247 2454 dbSNP
rs146189363 2456 dbSNP
rs1262706738 2460 dbSNP
rs1455265871 2461 dbSNP
rs543033176 2462 dbSNP
rs1262662873 2467 dbSNP
rs565113281 2468 dbSNP
rs1204353643 2471 dbSNP
rs1406173439 2476 dbSNP
rs561689663 2479 dbSNP
rs1224973357 2495 dbSNP
rs528918457 2498 dbSNP
rs971410652 2499 dbSNP
rs753574181 2503 dbSNP
rs547664812 2504 dbSNP
rs1332092976 2506 dbSNP
rs1335553034 2510 dbSNP
rs375668214 2522 dbSNP
rs1408984947 2525 dbSNP
rs1169085670 2527 dbSNP
rs1239714742 2541 dbSNP
rs1374051507 2547 dbSNP
rs1195776102 2548 dbSNP
rs1005115301 2550 dbSNP
rs1422328075 2551 dbSNP
rs555833130 2554 dbSNP
rs1015113496 2557 dbSNP
rs902811805 2564 dbSNP
rs1008340522 2570 dbSNP
rs1019346144 2578 dbSNP
rs1338659230 2583 dbSNP
rs1251713063 2588 dbSNP
rs1265303558 2598 dbSNP
rs1229310168 2605 dbSNP
rs1411862887 2605 dbSNP
rs750661433 2605 dbSNP
rs758387574 2605 dbSNP
rs138595770 2606 dbSNP
rs1170057823 2607 dbSNP
rs1181134333 2607 dbSNP
rs1184375535 2607 dbSNP
rs1313872077 2607 dbSNP
rs1328672804 2607 dbSNP
rs1384291037 2607 dbSNP
rs1384847804 2607 dbSNP
rs1397801981 2607 dbSNP
rs1409969394 2607 dbSNP
rs1423373515 2607 dbSNP
rs1437216279 2607 dbSNP
rs1446650772 2607 dbSNP
rs1456669831 2607 dbSNP
rs201391883 2607 dbSNP
rs1483611328 2609 dbSNP
rs1199992205 2610 dbSNP
rs1254207705 2611 dbSNP
rs1440012404 2615 dbSNP
rs1197372700 2618 dbSNP
rs1356924866 2624 dbSNP
rs963505363 2625 dbSNP
rs1183555186 2627 dbSNP
rs973151231 2632 dbSNP
rs963785179 2634 dbSNP
rs1411608888 2635 dbSNP
rs1277309656 2638 dbSNP
rs533158478 2639 dbSNP
rs1178132221 2640 dbSNP
rs115632537 2643 dbSNP
rs1403503269 2646 dbSNP
rs1365404074 2660 dbSNP
rs1164596900 2665 dbSNP
rs1465078308 2667 dbSNP
rs1378673511 2672 dbSNP
rs1158089983 2679 dbSNP
rs987570843 2684 dbSNP
rs1233393840 2687 dbSNP
rs911541983 2695 dbSNP
rs1183831214 2701 dbSNP
rs1489835878 2705 dbSNP
rs1300522232 2725 dbSNP
rs1267999061 2726 dbSNP
rs1222917229 2728 dbSNP
rs756704917 2735 dbSNP
rs138896898 2736 dbSNP
rs1222741600 2744 dbSNP
rs1350690171 2750 dbSNP
rs1280770934 2751 dbSNP
rs925792836 2758 dbSNP
rs935878706 2770 dbSNP
rs1304182230 2779 dbSNP
rs1448605431 2780 dbSNP
rs1055547203 2784 dbSNP
rs1348389157 2784 dbSNP
rs970746693 2789 dbSNP
rs576978701 2796 dbSNP
rs895250945 2804 dbSNP
rs1406605694 2808 dbSNP
rs1401373509 2810 dbSNP
rs1285404452 2812 dbSNP
rs1012315034 2826 dbSNP
rs1312954189 2827 dbSNP
rs778549242 2829 dbSNP
rs201026649 2832 dbSNP
rs1428494890 2842 dbSNP
rs142817370 2845 dbSNP
rs1005144923 2846 dbSNP
rs796901099 2847 dbSNP
rs555603302 2848 dbSNP
rs143540894 2851 dbSNP
rs1206495572 2855 dbSNP
rs938055641 2856 dbSNP
rs995036461 2859 dbSNP
rs1284440770 2862 dbSNP
rs1225738060 2867 dbSNP
rs915380316 2873 dbSNP
rs534709309 2881 dbSNP
rs1202099485 2883 dbSNP
rs953271867 2891 dbSNP
rs1268530384 2905 dbSNP
rs1432183429 2908 dbSNP
rs987212852 2918 dbSNP
rs1042636138 2922 dbSNP
rs1019036267 2923 dbSNP
rs1173530569 2925 dbSNP
rs553245709 2926 dbSNP
rs1374223811 2929 dbSNP
rs966978467 2932 dbSNP
rs148017871 2935 dbSNP
rs1185679705 2939 dbSNP
rs755484309 2948 dbSNP
rs925908847 2949 dbSNP
rs1007873659 2951 dbSNP
rs1040662513 2959 dbSNP
rs545177255 2962 dbSNP
rs1303481529 2968 dbSNP
rs1306266771 2969 dbSNP
rs557568463 2974 dbSNP
rs748482066 2975 dbSNP
rs1364382187 2979 dbSNP
rs948149615 2982 dbSNP
rs1246122511 2995 dbSNP
rs1046441912 3001 dbSNP
rs180935019 3005 dbSNP
rs940711114 3007 dbSNP
rs1467556332 3008 dbSNP
rs1274517468 3012 dbSNP
rs1352664657 3015 dbSNP
rs1169510073 3017 dbSNP
rs141679690 3018 dbSNP
rs561632842 3022 dbSNP
rs1161219256 3024 dbSNP
rs995067399 3027 dbSNP
rs11831202 3036 dbSNP
rs1225391164 3039 dbSNP
rs1443619096 3040 dbSNP
rs1243292180 3051 dbSNP
rs573639759 3054 dbSNP
rs1479972991 3056 dbSNP
rs1232763907 3057 dbSNP
rs1029591867 3067 dbSNP
rs1488359843 3068 dbSNP
rs1189094542 3071 dbSNP
rs1245601850 3073 dbSNP
rs1015498861 3075 dbSNP
rs1317307072 3075 dbSNP
rs1360396219 3075 dbSNP
rs1371133508 3083 dbSNP
rs1480631728 3084 dbSNP
rs1297467522 3086 dbSNP
rs770324376 3093 dbSNP
rs1442679406 3096 dbSNP
rs1263479277 3099 dbSNP
rs186106980 3103 dbSNP
rs1009067309 3107 dbSNP
rs1387808278 3110 dbSNP
rs1426407905 3111 dbSNP
rs1385449361 3125 dbSNP
rs1416754280 3127 dbSNP
rs971075775 3127 dbSNP
rs1018737038 3133 dbSNP
rs1456255706 3134 dbSNP
rs1291982844 3135 dbSNP
rs967095347 3136 dbSNP
rs977087575 3139 dbSNP
rs1391165270 3144 dbSNP
rs1032622055 3151 dbSNP
rs1296901653 3152 dbSNP
rs959370857 3168 dbSNP
rs989527531 3182 dbSNP
rs1316353147 3184 dbSNP
rs777836739 3187 dbSNP
rs957303608 3190 dbSNP
rs991394650 3193 dbSNP
rs190083655 3200 dbSNP
rs1301116445 3205 dbSNP
rs1404057396 3206 dbSNP
rs912079473 3208 dbSNP
rs1321479813 3209 dbSNP
rs1418343277 3213 dbSNP
rs944922790 3223 dbSNP
rs750193884 3231 dbSNP
rs1344153453 3236 dbSNP
rs1159151967 3237 dbSNP
rs915738368 3240 dbSNP
rs949874953 3241 dbSNP
rs981679699 3243 dbSNP
rs928067672 3246 dbSNP
rs1480929607 3248 dbSNP
rs181275001 3258 dbSNP
rs551400773 3265 dbSNP
rs1261430935 3266 dbSNP
rs899140145 3272 dbSNP
rs1421806049 3277 dbSNP
rs930901699 3279 dbSNP
rs1015819881 3280 dbSNP
rs749583703 3283 dbSNP
rs185742543 3284 dbSNP
rs563467966 3287 dbSNP
rs1450364432 3288 dbSNP
rs373159215 3289 dbSNP
rs989508473 3290 dbSNP
rs541149549 3294 dbSNP
rs755992270 3300 dbSNP
rs190596356 3301 dbSNP
rs1290535175 3312 dbSNP
rs978212290 3313 dbSNP
rs1428194518 3314 dbSNP
rs549415156 3316 dbSNP
rs1330248718 3323 dbSNP
rs1190629227 3326 dbSNP
rs912012515 3337 dbSNP
rs998537661 3341 dbSNP
rs1032652808 3342 dbSNP
rs567458027 3349 dbSNP
rs1018641533 3350 dbSNP
rs957003035 3351 dbSNP
rs1227396762 3352 dbSNP
rs1013251663 3353 dbSNP
rs1257590860 3354 dbSNP
rs1224902145 3355 dbSNP
rs1265919953 3357 dbSNP
rs771951779 3359 dbSNP
rs1462255162 3368 dbSNP
rs183657516 3368 dbSNP
rs1295758875 3375 dbSNP
rs1436661790 3376 dbSNP
rs1380013583 3389 dbSNP
rs1454021536 3390 dbSNP
rs1404955566 3403 dbSNP
rs971713128 3421 dbSNP
rs1236423546 3424 dbSNP
rs150523024 3430 dbSNP
rs1178889170 3432 dbSNP
rs563469405 3433 dbSNP
rs981325783 3434 dbSNP
rs571594934 3435 dbSNP
rs974961668 3438 dbSNP
rs962136313 3439 dbSNP
rs922220926 3440 dbSNP
rs1416211854 3443 dbSNP
rs538913064 3448 dbSNP
rs189100105 3449 dbSNP
rs1446379213 3451 dbSNP
rs888137489 3452 dbSNP
rs930702789 3454 dbSNP
rs1313802872 3457 dbSNP
rs1050850851 3458 dbSNP
rs1342817321 3461 dbSNP
rs1327362720 3462 dbSNP
rs1391194794 3464 dbSNP
rs1351475239 3469 dbSNP
rs939736983 3470 dbSNP
rs1286039378 3475 dbSNP
rs1423022086 3477 dbSNP
rs910836175 3478 dbSNP
rs944937568 3482 dbSNP
rs1040538643 3483 dbSNP
rs903331936 3489 dbSNP
rs1036792629 3490 dbSNP
rs1179646597 3493 dbSNP
rs1437157557 3494 dbSNP
rs1219475432 3496 dbSNP
rs906323044 3501 dbSNP
rs1003417517 3505 dbSNP
rs7312210 3506 dbSNP
rs1290534935 3509 dbSNP
rs139816446 3512 dbSNP
rs1010845566 3513 dbSNP
rs1206527497 3516 dbSNP
rs11558336 3517 dbSNP
rs966741829 3519 dbSNP
rs1482592364 3523 dbSNP
rs1290617909 3528 dbSNP
rs1403444726 3529 dbSNP
rs573808490 3530 dbSNP
rs1023039300 3533 dbSNP
rs1382967890 3537 dbSNP
rs1407280623 3537 dbSNP
rs374171007 3545 dbSNP
rs1003177602 3551 dbSNP
rs1469607478 3555 dbSNP
rs1479101406 3580 dbSNP
rs1191999218 3582 dbSNP
rs1015447435 3594 dbSNP
rs1019067886 3601 dbSNP
rs1424546737 3602 dbSNP
rs961164055 3607 dbSNP
rs1412898849 3611 dbSNP
rs973901687 3614 dbSNP
rs920712661 3618 dbSNP
rs1330459253 3619 dbSNP
rs1171010968 3642 dbSNP
rs1371760376 3647 dbSNP
rs974910730 3650 dbSNP
rs10744177 3651 dbSNP
rs1345337106 3653 dbSNP
rs1275805651 3655 dbSNP
rs930874967 3658 dbSNP
rs1324887364 3659 dbSNP
rs1348804776 3659 dbSNP
rs780214634 3665 dbSNP
rs764810612 3666 dbSNP
rs1389296293 3667 dbSNP
rs1161214196 3675 dbSNP
rs909505945 3676 dbSNP
rs1428424041 3678 dbSNP
rs939708442 3683 dbSNP
rs1037187322 3685 dbSNP
rs1230036073 3687 dbSNP
rs1239960568 3696 dbSNP
rs1275224789 3703 dbSNP
rs906318018 3706 dbSNP
rs1323411305 3707 dbSNP
rs986175066 3708 dbSNP
rs1279841087 3709 dbSNP
rs1221244808 3712 dbSNP
rs532064141 3713 dbSNP
rs1269755567 3723 dbSNP
rs1291686650 3731 dbSNP
rs370883852 3732 dbSNP
rs1367514810 3741 dbSNP
rs1334785410 3752 dbSNP
rs138904309 3754 dbSNP
rs1450412825 3754 dbSNP
rs1246396500 3756 dbSNP
rs1054939984 3758 dbSNP
rs894991692 3762 dbSNP
rs1416960853 3764 dbSNP
rs1010791730 3770 dbSNP
rs1449691293 3776 dbSNP
rs115814196 3779 dbSNP
rs902509032 3788 dbSNP
rs192104464 3791 dbSNP
rs530720260 3792 dbSNP
rs548949571 3794 dbSNP
rs1406372280 3795 dbSNP
rs1229502670 3797 dbSNP
rs558595559 3805 dbSNP
rs1322443032 3806 dbSNP
rs528600245 3811 dbSNP
rs1245281040 3820 dbSNP
rs546707086 3821 dbSNP
rs996236439 3822 dbSNP
rs1352611342 3824 dbSNP
rs571281908 3825 dbSNP
rs1436869557 3826 dbSNP
rs1391579775 3828 dbSNP
rs952222459 3830 dbSNP
rs1044083145 3839 dbSNP
rs906831915 3846 dbSNP
rs1479942747 3850 dbSNP
rs1251599342 3856 dbSNP
rs1363847218 3866 dbSNP
rs538660262 3868 dbSNP
rs1226078565 3869 dbSNP
rs756534745 3873 dbSNP
rs1015479767 3874 dbSNP
rs897068347 3877 dbSNP
rs1356761799 3889 dbSNP
rs961328158 3890 dbSNP
rs141493111 3892 dbSNP
rs1027216819 3893 dbSNP
rs781561444 3915 dbSNP
rs3809117 3927 dbSNP
rs1287513354 3931 dbSNP
rs536832527 3936 dbSNP
rs1372025730 3941 dbSNP
rs757447958 3942 dbSNP
rs1017612594 3943 dbSNP
rs1248655557 3946 dbSNP
rs1464551405 3948 dbSNP
rs1187208172 3950 dbSNP
rs555234909 3957 dbSNP
rs573490905 3958 dbSNP
rs1417907731 3959 dbSNP
rs1054886865 3962 dbSNP
rs976053854 3966 dbSNP
rs1473311364 3969 dbSNP
rs77622409 3975 dbSNP
rs934900633 3978 dbSNP
rs1412104701 3981 dbSNP
rs553105732 3984 dbSNP
rs1190895408 3989 dbSNP
rs1458434876 3990 dbSNP
rs990301149 4003 dbSNP
rs914699522 4010 dbSNP
rs1320814801 4012 dbSNP
rs1387261537 4026 dbSNP
rs1044026446 4040 dbSNP
rs577668821 4044 dbSNP
rs370986323 4045 dbSNP
rs1228793585 4062 dbSNP
rs557215404 4063 dbSNP
rs1352166850 4064 dbSNP
rs906869857 4065 dbSNP
rs575481314 4066 dbSNP
rs1367843705 4073 dbSNP
rs1036687579 4074 dbSNP
rs1330961825 4077 dbSNP
rs575375815 4079 dbSNP
rs1160622887 4080 dbSNP
rs1029036833 4083 dbSNP
rs182844101 4084 dbSNP
rs1203509211 4096 dbSNP
rs1269686356 4097 dbSNP
rs995401795 4102 dbSNP
rs560716401 4104 dbSNP
rs1248709861 4109 dbSNP
rs1209354051 4110 dbSNP
rs112953210 4117 dbSNP
rs1443447156 4118 dbSNP
rs1254080806 4120 dbSNP
rs745910424 4125 dbSNP
rs889583787 4126 dbSNP
rs960361558 4128 dbSNP
rs990565607 4129 dbSNP
rs916367025 4130 dbSNP
rs186904961 4136 dbSNP
rs1018147289 4137 dbSNP
rs1410821211 4142 dbSNP
rs1455346418 4148 dbSNP
rs1437959907 4175 dbSNP
rs1043590368 4183 dbSNP
rs1173773519 4184 dbSNP
rs1466811073 4191 dbSNP
rs923789577 4195 dbSNP
rs966090512 4199 dbSNP
rs1449086262 4200 dbSNP
rs1390909573 4205 dbSNP
rs976082920 4208 dbSNP
rs1395321775 4217 dbSNP
rs1031614558 4219 dbSNP
rs1253951065 4220 dbSNP
rs1040703355 4221 dbSNP
rs956308797 4224 dbSNP
rs538698462 4225 dbSNP
rs990330931 4227 dbSNP
rs1050464451 4237 dbSNP
rs1340989090 4241 dbSNP
rs914751570 4258 dbSNP
rs948859593 4262 dbSNP
rs980290406 4263 dbSNP
rs1237188713 4268 dbSNP
rs928404247 4269 dbSNP
rs887893401 4270 dbSNP
rs938395332 4284 dbSNP
rs1345814436 4293 dbSNP
rs1334018119 4294 dbSNP
rs78930926 4295 dbSNP
rs1404887117 4299 dbSNP
rs1278873350 4310 dbSNP
rs73219865 4311 dbSNP
rs1183295033 4312 dbSNP
rs532529823 4313 dbSNP
rs897993175 4323 dbSNP
rs76754019 4324 dbSNP
rs1186805469 4330 dbSNP
rs1048749774 4331 dbSNP
rs1416877938 4334 dbSNP
rs61747012 4335 dbSNP
rs1377690095 4344 dbSNP
rs990513277 4347 dbSNP
rs1007171435 4353 dbSNP
rs1040869531 4360 dbSNP
rs747013071 4361 dbSNP
rs530295373 4362 dbSNP
rs967799876 4366 dbSNP
rs1342768856 4367 dbSNP
rs1372378429 4368 dbSNP
rs140169733 4370 dbSNP
rs567022100 4371 dbSNP
rs61747009 4373 dbSNP
rs979604251 4382 dbSNP
rs1310030249 4383 dbSNP
rs191727220 4390 dbSNP
rs149833950 4391 dbSNP
rs1163900524 4400 dbSNP
rs1389824094 4402 dbSNP
rs956003346 4405 dbSNP
rs1179790862 4406 dbSNP
rs1331731794 4410 dbSNP
rs368119157 4416 dbSNP
rs1472114939 4423 dbSNP
rs1011832454 4429 dbSNP
rs1301378746 4435 dbSNP
rs1449510039 4435 dbSNP
rs1022333024 4436 dbSNP
rs1206515974 4440 dbSNP
rs1359079761 4442 dbSNP
rs1266734312 4443 dbSNP
rs1274281409 4444 dbSNP
rs931972415 4450 dbSNP
rs1479899805 4454 dbSNP
rs1434660406 4455 dbSNP
rs970323679 4456 dbSNP
rs980702455 4458 dbSNP
rs1324290637 4460 dbSNP
rs1388553295 4462 dbSNP
rs887785635 4466 dbSNP
rs1267678679 4482 dbSNP
rs1156918822 4486 dbSNP
rs1432063650 4491 dbSNP
rs11558335 4494 dbSNP
rs928767305 4503 dbSNP
rs776425699 4504 dbSNP
rs972442986 4514 dbSNP
rs1245700585 4521 dbSNP
rs1036855980 4522 dbSNP
rs571299814 4523 dbSNP
rs761535453 4525 dbSNP
rs1003486018 4526 dbSNP
rs1330417370 4532 dbSNP
rs1352539664 4546 dbSNP
rs1043763 4551 dbSNP
rs772779164 4556 dbSNP
rs1043764 4557 dbSNP
rs145808942 4560 dbSNP
rs1438850490 4563 dbSNP
rs762531639 4566 dbSNP
rs1319968283 4567 dbSNP
rs1386443359 4569 dbSNP
rs1434357771 4572 dbSNP
rs1389212910 4577 dbSNP
rs1013193052 4583 dbSNP
rs1367444285 4587 dbSNP
rs1023277330 4588 dbSNP
rs1172847908 4593 dbSNP
rs148546272 4597 dbSNP
rs753251592 4598 dbSNP
rs979166821 4599 dbSNP
rs113408047 4603 dbSNP
rs1465751106 4604 dbSNP
rs1250406006 4605 dbSNP
rs112267002 4613 dbSNP
rs540078704 4620 dbSNP
rs537925479 4624 dbSNP
rs147683588 4628 dbSNP
rs923175530 4630 dbSNP
rs1221220505 4635 dbSNP
rs532532440 4638 dbSNP
rs1296981136 4647 dbSNP
rs1229146667 4648 dbSNP
rs544707548 4652 dbSNP
rs1365878656 4657 dbSNP
rs754186495 4658 dbSNP
rs1211457328 4668 dbSNP
rs1249276279 4672 dbSNP
rs868390654 4675 dbSNP
rs1358400237 4676 dbSNP
rs1334555413 4679 dbSNP
rs1436217981 4682 dbSNP
rs931879099 4685 dbSNP
rs184233000 4692 dbSNP
rs142351716 4694 dbSNP
rs550038057 4700 dbSNP
rs1421002102 4703 dbSNP
rs909172893 4705 dbSNP
rs1472755808 4709 dbSNP
rs779167839 4712 dbSNP
rs548858229 4713 dbSNP
rs1482199109 4714 dbSNP
rs1274138986 4716 dbSNP
rs1165155047 4717 dbSNP
rs1310621681 4721 dbSNP
rs1367690467 4724 dbSNP
rs1284577294 4727 dbSNP
rs1461055604 4727 dbSNP
rs1036439476 4728 dbSNP
rs1348269930 4738 dbSNP
rs1307080821 4741 dbSNP
rs758465712 4745 dbSNP
rs1324212515 4746 dbSNP
rs73417695 4748 dbSNP
rs1435963804 4752 dbSNP
rs1187960591 4754 dbSNP
rs1355844511 4760 dbSNP
rs554402315 4763 dbSNP
rs1405303955 4766 dbSNP
rs1415074401 4784 dbSNP
rs1360448124 4785 dbSNP
rs1190549017 4788 dbSNP
rs1398332883 4791 dbSNP
rs1313812272 4797 dbSNP
rs1321504129 4799 dbSNP
rs772201757 4800 dbSNP
rs1057297004 4803 dbSNP
rs1183210807 4805 dbSNP
rs1484154410 4807 dbSNP
rs1263815411 4808 dbSNP
rs112236727 4810 dbSNP
rs1220846936 4810 dbSNP
rs1235040640 4810 dbSNP
rs1287486566 4810 dbSNP
rs1410115657 4810 dbSNP
rs3066167 4810 dbSNP
rs398056020 4810 dbSNP
rs894660042 4810 dbSNP
rs747101147 4811 dbSNP
rs1435074719 4813 dbSNP
rs552829816 4814 dbSNP
rs915383932 4814 dbSNP
rs1167796519 4817 dbSNP
rs1456079953 4823 dbSNP
rs1411772954 4825 dbSNP
rs903517164 4826 dbSNP
rs1265489777 4827 dbSNP
rs1421117573 4827 dbSNP
rs1000974500 4828 dbSNP
rs1030739355 4829 dbSNP
rs796382961 4829 dbSNP
rs1351438382 4830 dbSNP
rs1318386162 4831 dbSNP
rs139532888 4831 dbSNP
rs190098561 4831 dbSNP
rs3066166 4831 dbSNP
rs796956664 4831 dbSNP
rs1239882226 4832 dbSNP
rs571307316 4833 dbSNP
rs538323265 4834 dbSNP
rs77609883 4835 dbSNP
rs181528854 4836 dbSNP
rs1030085383 4837 dbSNP
rs568715211 4838 dbSNP
rs953214894 4838 dbSNP
rs760428644 4839 dbSNP
rs1457998872 4844 dbSNP
rs986006365 4845 dbSNP
rs2017594 4850 dbSNP
rs1463494454 4855 dbSNP
rs554435384 4861 dbSNP
rs963397408 4862 dbSNP
rs781317475 4863 dbSNP
rs972496227 4871 dbSNP
rs572848916 4887 dbSNP
rs938719954 4889 dbSNP
rs146320222 4890 dbSNP
rs1305002319 4892 dbSNP
rs1165798338 4901 dbSNP
rs1225459073 4902 dbSNP
rs1290631482 4908 dbSNP
rs1299060959 4909 dbSNP
rs916042984 4910 dbSNP
rs1302624138 4924 dbSNP
rs111699307 4926 dbSNP
rs1466756831 4926 dbSNP
rs558432649 4927 dbSNP
rs1227413986 4931 dbSNP
rs1193860063 4932 dbSNP
rs1430231461 4934 dbSNP
rs1281440602 4935 dbSNP
rs1313506873 4939 dbSNP
rs948905899 4946 dbSNP
rs1281966435 4948 dbSNP
rs1043307601 4949 dbSNP
rs1255388013 4955 dbSNP
rs187417146 4963 dbSNP
rs1184036956 4966 dbSNP
rs1230333227 4972 dbSNP
rs544332828 4973 dbSNP
rs1252307163 4977 dbSNP
rs1396934665 4978 dbSNP
rs117280190 4980 dbSNP
rs1306457984 4988 dbSNP
rs1176844986 4989 dbSNP
rs370254771 5000 dbSNP
rs1371315819 5007 dbSNP
rs1405881200 5021 dbSNP
rs1416302923 5023 dbSNP
rs1177395684 5025 dbSNP
rs796326814 5035 dbSNP
rs892147355 5049 dbSNP
rs997180806 5050 dbSNP
rs1179657875 5052 dbSNP
rs1482517260 5057 dbSNP
rs1250631272 5058 dbSNP
rs1196965237 5059 dbSNP
rs1354903313 5075 dbSNP
rs1265321454 5084 dbSNP
rs1433425460 5092 dbSNP
rs772986814 5093 dbSNP
rs1337457778 5095 dbSNP
rs574730386 5100 dbSNP
rs1007375091 5101 dbSNP
rs1336514820 5106 dbSNP
rs1330980710 5107 dbSNP
rs1385109752 5111 dbSNP
rs1390084442 5112 dbSNP
rs1162635011 5117 dbSNP
rs1461893357 5121 dbSNP
rs1043771 5123 dbSNP
rs1156615277 5124 dbSNP
rs1441019252 5125 dbSNP
rs60827901 5127 dbSNP
rs752162200 5129 dbSNP
rs147858290 5130 dbSNP
rs372337047 5134 dbSNP
rs773941694 5136 dbSNP
rs992910791 5145 dbSNP
rs534951336 5148 dbSNP
rs1345587881 5153 dbSNP
rs1207231359 5161 dbSNP
rs192163605 5162 dbSNP
rs185398379 5169 dbSNP
rs926162287 5172 dbSNP
rs1204080633 5173 dbSNP
rs1231443023 5176 dbSNP
rs934882271 5181 dbSNP
rs372578216 5182 dbSNP
rs1479031847 5184 dbSNP
rs1441564422 5187 dbSNP
rs1318331784 5194 dbSNP
rs190590602 5194 dbSNP
rs74612986 5195 dbSNP
rs1408413078 5198 dbSNP
rs1159978425 5199 dbSNP
rs1476834590 5200 dbSNP
rs1376632205 5202 dbSNP
rs114697195 5214 dbSNP
rs1394571276 5215 dbSNP
rs866344975 5217 dbSNP
rs182317811 5219 dbSNP
rs1171112170 5220 dbSNP
rs184358652 5222 dbSNP
rs764626596 5223 dbSNP
rs1051446865 5234 dbSNP
rs12304283 5235 dbSNP
rs558815882 5238 dbSNP
rs1326404817 5239 dbSNP
rs1351215425 5247 dbSNP
rs1007326727 5252 dbSNP
rs1016481345 5257 dbSNP
rs1324574762 5264 dbSNP
rs1368157774 5266 dbSNP
rs576921713 5270 dbSNP
rs35654859 5271 dbSNP
rs899005776 5274 dbSNP
rs188275247 5275 dbSNP
rs1338481158 5276 dbSNP
rs993782679 5286 dbSNP
rs1387758413 5298 dbSNP
rs1026275174 5307 dbSNP
rs1476021351 5312 dbSNP
rs1244213436 5319 dbSNP
rs369931097 5320 dbSNP
rs1442092840 5326 dbSNP
rs1453482942 5332 dbSNP
rs1213261976 5335 dbSNP
rs575011926 5336 dbSNP
rs1340181304 5337 dbSNP
rs542225789 5338 dbSNP
rs992858606 5339 dbSNP
rs1252443786 5344 dbSNP
rs560482496 5355 dbSNP
rs1191029676 5357 dbSNP
rs138034740 5358 dbSNP
rs970109463 5365 dbSNP
rs546136083 5368 dbSNP
rs978884048 5372 dbSNP
rs1475390157 5383 dbSNP
rs564812530 5385 dbSNP
rs926082731 5386 dbSNP
rs754344561 5391 dbSNP
rs1416434148 5392 dbSNP
rs709284 5394 dbSNP
rs1161852244 5395 dbSNP
rs570939076 5397 dbSNP
rs550398453 5398 dbSNP
rs562422312 5399 dbSNP
rs1051351197 5404 dbSNP
rs1251188215 5405 dbSNP
rs1205224732 5424 dbSNP
rs1436708977 5431 dbSNP
rs765584690 5433 dbSNP
rs888794269 5435 dbSNP
rs943077325 5439 dbSNP
rs58019231 5444 dbSNP
rs1333938216 5445 dbSNP
rs1293667751 5455 dbSNP
rs1416262618 5463 dbSNP
rs1348171883 5480 dbSNP
rs1297138210 5482 dbSNP
rs1442237746 5483 dbSNP
rs898992093 5484 dbSNP
rs993379303 5486 dbSNP
rs55922912 5487 dbSNP
rs895760675 5502 dbSNP
rs200112744 5509 dbSNP
rs1471736230 5511 dbSNP
rs1234114519 5513 dbSNP
rs1341183722 5518 dbSNP
rs1014200193 5520 dbSNP
rs780274338 5522 dbSNP
rs1332722987 5528 dbSNP
rs1210621400 5529 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.672 5.9e-4 -0.811 7.2e-6 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.478 7.8e-3 -0.612 5.7e-4 25 Click to see details
GSE27834 Pluripotent stem cells -0.495 2.6e-2 -0.644 3.5e-3 16 Click to see details
GSE28544 Breast cancer -0.343 5.0e-2 -0.415 2.2e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.241 9.2e-2 -0.089 3.1e-1 32 Click to see details
GSE19536 Breast cancer -0.129 1.0e-1 -0.188 3.1e-2 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.215 1.8e-1 -0.245 1.5e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.168 2.1e-1 -0.254 1.1e-1 25 Click to see details
GSE17306 Multiple myeloma -0.112 2.2e-1 -0.133 1.8e-1 49 Click to see details
GSE21849 B cell lymphoma 0.132 2.5e-1 0.514 2.2e-3 29 Click to see details
GSE19783 ER- ER- breast cancer -0.076 2.5e-1 -0.116 1.5e-1 79 Click to see details
GSE21032 Prostate cancer -0.066 2.8e-1 -0.024 4.1e-1 83 Click to see details
GSE14794 Lymphoblastoid cells 0.062 2.8e-1 0.149 8.1e-2 90 Click to see details
GSE38226 Liver fibrosis -0.121 3.0e-1 -0.294 9.8e-2 21 Click to see details
GSE19350 CNS germ cell tumors 0.165 3.0e-1 -0.154 3.2e-1 12 Click to see details
GSE28260 Renal cortex and medulla -0.156 3.1e-1 -0.110 3.6e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.078 3.6e-1 -0.014 4.7e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.042 3.7e-1 -0.158 1.1e-1 64 Click to see details
GSE17498 Multiple myeloma -0.014 4.7e-1 0.128 2.2e-1 40 Click to see details
GSE17498 Multiple myeloma -0.014 4.7e-1 0.128 2.2e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.665 0 -0.739 0 32 Click to see details
BLCA -0.75 0 -0.589 0.01 18 Click to see details
HNSC -0.368 0.01 -0.357 0.01 42 Click to see details
COAD 0.593 0.06 0.690 0.03 8 Click to see details
BRCA 0.161 0.07 0.076 0.25 84 Click to see details
CHOL -0.515 0.08 -0.417 0.13 9 Click to see details
PAAD -0.715 0.14 -0.200 0.4 4 Click to see details
THCA -0.136 0.15 -0.109 0.21 59 Click to see details
LUAD 0.312 0.16 0.273 0.2 12 Click to see details
LIHC -0.13 0.19 -0.082 0.29 49 Click to see details
KICH 0.175 0.2 0.118 0.29 25 Click to see details
KIRC -0.096 0.22 -0.096 0.22 68 Click to see details
UCEC -0.08 0.37 -0.112 0.32 19 Click to see details
PRAD -0.024 0.43 -0.003 0.49 50 Click to see details
LUSC -0.017 0.46 -0.024 0.44 38 Click to see details
CESC 0.101 0.47 0.500 0.33 3 Click to see details
PCPG -0.085 0.47 -0.500 0.33 3 Click to see details
ESCA 0.021 0.48 -0.055 0.44 11 Click to see details
KIRP -0.006 0.49 -0.029 0.44 32 Click to see details
KIRP -0.006 0.49 -0.029 0.44 32 Click to see details
KIRP -0.006 0.49 -0.029 0.44 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1