miRTarBase - #MIRT727068 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NR2C2   
Synonyms TAK1, TR4
Description nuclear receptor subfamily 2 group C member 2
Transcript NM_003298   
Expression
Putative miRNA Targets on NR2C2
3'UTR of NR2C2
(miRNA target sites are highlighted)
>NR2C2|NM_003298|3'UTR
   1 CGCAAACCACACACCTGCCAAGGAGCAACAGAATCCTTCCAGGACCGTTCACATACAAAGAAAAGTAGTGGTATTTTGGT
  81 ATGTGCAAATATTTCCATATGTTAGCCATTTCCTGTCTGGTTTCTCCTTATCTGTTAATCCCAGACAATAGCAATTAAAA
 161 GACTAGTAGGATCCTTTCCTGACATAAGAAATGTTTTAATGCCTTTTGATGAAGCAGCAGATTTTGGAACAATCTTTTAA
 241 CTCAATTTGTATTTAGAAATTCTCAAAGGGCAAAAAACAAAAAAAAAGGTTTTATAATGTCAGAGACTAGTATTAAAGAA
 321 AACTGAAAGAACCTGAGAGAATAGTATGTGTGTATATATATATATAAAAAAGTCCTTGGAATTATAGATACTAATTACCA
 401 GGGTAATAATATTAGCACTTTCTAAGCACTTATCAATGTGTAACGTTAGCAACATCTTGCCTGTGGGCAGGGCAAATGGA
 481 AAACTGTGTATGTCTTTTGCCGAAATGCTAATGATTTCTGTGAAAACTCACTAGGGTACAGGAGACAATCATTTATGTTT
 561 AAGAAAAGAAGGCATCATTCCTAATTGTGTGCACATGTTGTGGAGTTGAGCTGAATTCTGTGAATGGAAACGTGGCTCAT
 641 TTGCATCATGCAGTAAGTGGGAGTGTGGTAGCACAGTCGGTGGTGACCCAGTTCAGAAGCTTCTAGCCATAGAGCAGACA
 721 CTTGTCAGGTTCCCTGACTACTTGGTCCTGGTCTCTGATGGGCATCTGCAGACTCCTCTAGAACCTGGGGTTCTCCTTTG
 801 ATGACTGGTTATCTGAATTGGATTGCAACTAGTCAGACATTAACTGCCAAATGAGATGTACAGTTCCTCCAGCAAGTGAA
 881 AACATCCCCAAGTCACATCCGCCGCTCGTGGCAGATGGAGCCTTGTGACCAAAAAGTGCAAGGTGGGCATTTTGAGCTCT
 961 TGACAGTACTTCCAATACAATTGGGGGTGCTTGTGTGTTTGTCCAGATGGAGGAGTGTGGCCTTGGAGTGTGAGCGTTAC
1041 CTTCCCAGGGCTTTCCACTCCAAATGCCCCCTTGAAAAGGGCTCGTGTTTCTGCAGCTCCATCATAACTGTGAGGCTGGA
1121 TTGGGGCTGGGCAGGAGCCTGCTGCCGCCTGGCGAGAGTGGTTAGGGCCTGGTAAAGCTGGATGGAAGGTTTCAGGACAA
1201 TTTCTTCCTGTTGACCTTAAATACCAGAGATTTTAAAAATGTGTATAGACTCAGCATCTCTGTTGGCAAGTCTGTTAATG
1281 TTACCAGCACACTGTGCACTTTGGTTCCCCCAGGTGTGTGCCAGCCGACCACCCCGGAGCATTTTAAATGCAGGCTGCTT
1361 GCTCCTTAAAAACAACCCTCAATTTCCAGGGTGATAGTCTTTCTCCTCATAAATTGTAGCAACCAGAGTTTACAGCAAGA
1441 ACAGTATGCGCTTAAAAGGAAGTTATGTCTAACTTCAAACACCCGTAAATTCCCACGGATGTGAATATATAGCAAGCTTT
1521 TCCTGTTTGAGAACAGTGGCATGTGGAAGACCCGGTCAATTGCTTTGTCTTTTGCTTTTTAAATAGTCCAGATTAAGAAA
1601 ATACACCCTGTTGGGTTAAATTTGCCTCTCTTGATTTGTTAATCAGATGATATCCAAAAAGATCCCTGGACACTCCCCTG
1681 ACTCACAGGTGCTCTGATCTGGCTCAGGCTGGCGCCACATGTGCTCCACAGGGGTGCAGTCTGGCCAGCTACAGACGCCC
1761 CTGTGGTGCCACATTGGACAGAATGGAAGCTGCTGCAGGCTCAAGGCAGAACAGGATGCTTGATCCTGAAGGGTTAGCAG
1841 CACTTTACGCAAGTCAGTGTTAGTAGGGTAAGTGGGAACAGTGTTTCCAACTTCTAAATTCTTGTTTGGATTTAATTATA
1921 TCATTTTATAATTCTTGCCTTGGCAGCAAATTTTGGAGAGTAGTGGGAGTGGCCATTATAAAATGATGGAAAGGATTTAA
2001 TTTTGCCAGCTTAAAGTAATTTTTACTTTTCTAACCCTGATGTGTTTTCAGTTTCAAAATTAAGACAAAAAACCAGCTGA
2081 GACAATGGAATTAGGGCAGGTTTGTTTCATTTCTGCTTGTGAAGGCTTTTAGTAGCAGGCATCCTGCAGCTCAGTGGTGC
2161 CTCTAACACAGATTGTTGCCTGCCTTCCGTCGTTTTGATCCTTGAGAGTGACCATGAGGGCCATGTTGCAGTTCCCTGGG
2241 AATACAAGCATAACAGCTTTCAGATCCCAGTTCTTGGTGTTGGTGAAAAGGTCTCCACCAGCCCCTCCTCTCATTCCCAG
2321 GTCATTCAGTGGCAGCCAGTAGGCTGCTTAGACTCAGGCTGGATAAGGAAGTGTTGGGCTGTGGTGAAACAACCTTGCAG
2401 AAAACGTGATTTTGCTTGGAAAGGTGCTGATTCTAACCTGGTCCTGCTCTTTAAGTCCCCTTGCTGGTGATGGCTGATTC
2481 CAGGGACTGTTTTGGGCTTTGAACACCTCTTGGTTGGTTTCTGAGATCCTCTTGGCCTTACTTTGAAGTGGCCTTTTCTT
2561 TAAGGATCATGTCCACGTAACCTGTATTCTTGCTGCTTTAACTCATTTCAAGCCTCTGACTGCAGGTCCATTTCATCTCC
2641 TGTCAGGTTGGTTAAGTAAAGTCAGCCCAAAGTCAAGAATTACTTAAAGAGATGCAAACCAAATATTTGGGCTCCAACTT
2721 TCACAGGGCTTATAGCCCTTATTAGCAGTTTGTGAAACTTTGGGTTTCATGAAGTGAGACCTGTCCTCTGGCTACTGAAC
2801 TCCATGGAGCCACGTTCATGCTCCCTCTTCTACTGGCCTGGCTGCTCCTCCCTCAATGAGGAGAGGCAGCTGGCTCAGAG
2881 AGGTGGGACAGACACATGCTGTCATCAGTTAAGTGAGCTCTTTTCCAGAAGTATCTCAGATAATGTTGGGTTAAGACAGA
2961 TAGATGTTGAAAATGGTGGAGATCATTACACATTAGCATAAAACAGGACAGGAAGAGATTTTTTGAAAGACCAAATTAGT
3041 TGAGCAAGTAATACTTTTCAAGTTACTCCTGGAAGGTGTTTTTAAGGAAGTGTGTTACCTACCATACTCTCCTAATTTGA
3121 CATTTCTGTGTCCTGAGGAGTTACATTTATTGTCTAACCCTTGCCATAAGGCTGTGGTTTGAGGTTCTTTTGCTGTTCTG
3201 GGCTTTATATTTAATTTCAGGTGTAGTCACTTCTAAGATGTGTAATTGCCCTCAAGAGGGACTGATTTTTAGCTTGTCAT
3281 TGTCAGTATTGAATGTGGACTCTTCTGAGGCAGTTAGGACACCAGCCATGGTGTTAACAGTGGATGCGTTAGGCTCCTTA
3361 ATCTCAAGGCAATATCCACGCTACACACATACTTATTAGCTGTCTTACTTGTTTGGGGGATAGTTACGGCAAGGAGCAAA
3441 AAATTCTAAGGACTCTAGCTGTTTCTAGTGCTTTTACTTTCATAGTCCTTTGAGGACATTTCCTGCAGAGCACTCTTGCT
3521 CACAGCCCGCCCTCTGCAGGGCTTCCAGCCCCTGGCCGCAATCAGCAGTTCATGCCACATGTGTACATCCATGTTCTGGG
3601 ACCTGATCTCATTGGAGTCCAGAAGCTTGTTGCCCACTTTCCAGTGTAAATGACTTTATGTGCAATGGGGTCATAGGTAA
3681 CATTTTAACTCTTTTCTTAGTCCAGGTCATAGGAAGTCTCATCATCTGACAGCCACTTTTCTCCCAGGGAAGGCGGTGCC
3761 CACTGGGCCCTGGGAATGCCTGAGCCAGCAGAGCAGATGCCCCACGTGCTTCCTTTATCCAGCTTCCATTCTCTCAGTTA
3841 TGAGGCTCTTTGAAAATGTCTTAACTTTGATGTAAATTTTTAAAGCCAACCCCTCATCAAGACAGGGTTGGTTTGGGTCT
3921 TTTGTACACAGGGTCTGGACCTTCTCATTGTGTGCCTCCCACCAGCGTGCACTTCGTATGTCCAGCCCTGGGTCCCTTCA
4001 GCAGCATTGTGCGTGTACAGGTTTCTAGGCTGTAAGACTGAATGAATGTACATGTGTTTATATCCTCTCCATATGTACAG
4081 TGTATATAGTGTGTGTATGTGTACATAGATGTATATTATGTATACAGACATGTATCCAAACTTTCCTTTAAAGAGAGTTT
4161 TTCATAAAGTTGCTAATGTAAACTGATATGGGTGTTCCAAGGTCCCTCGGCAGGGAAGATTTGCTGGTGATTTTCTTCAC
4241 TCCATTTTCCTTTGGGTGAGCCTGCCTGGGAAGGGCCATGAAGTCAGAATCTCCACTCTGCAAAAGGAAGAATTCCAGGC
4321 AGAAGAGGTTCTGACAGGGTGACATTTCCGTATATTCTCTAGGTTCGGACAAGAGCCAGGAAGCTGGAAGACAGTTTATC
4401 TTAATATCCAAAACTAAGTGGGAATTTTTAACCTTTTCATGCACCTATTCATGGCCCTACCTGGAAGGAACTTGGCAGTT
4481 GGGTTGAGCCATCAGCCTTCCCAGCTATTCAGCTCTGTTGAGTAGCCCAGAGACAGGCGTCACGGTCAGAGATTCAGAAC
4561 GGTCTGTGTCAGTGAGGCCTGACTCCCAAAGATGGTAGCAATTTCCCAGGCTTGCGCTGTGCTCAGTCAGCAAGATGTGG
4641 GGCACTGTCCTATGACTGAATAAATAGTAATTCCCATCTTTCTATCGCCAGTTAAAAATAAACAACCTACCAAGTATTAT
4721 TCTTTAAAACTAAGCATGGATGTTGATGGCTAACTTCTGCGGCATATAAGCTACAGATCTCAAGTTACTTCTCTAACTGT
4801 AAGCATGTAAATGACTTTAACTCCTTTCTATAAGTTATGATTTTAAATTTTCAGATAAGAATTGCATTTTAATATGGATA
4881 TGTGTGCCCTTAAAAGCTACAGATACCAAATTTTCCTCGTCCAGGTCTACTCGGACGAATTTTCCCCCTTAATCTGGCCT
4961 TAAACTGAGACTCGGCCCTTGAGAGCCAGGGCCTGGCCCAGCAGTAGTTGCTCATAGACCTGGGAAGCAGGGGCCTGCTG
5041 GAAGGAATCACTAGATTGCTGCAAAAACTCACATAATCCACAGTTTCCTCTTTTTCTTTTTAAAATAAGTTATCAAAATG
5121 TTTTAAAAACACTTTATGAGACCATAGTACTCAGTGCCTTTTGTGAGACAGTGGGTCATTTAGCCTTCAGCTTCCCTGTT
5201 TTTGATGTAGAGAAAGCTTCTATTTCACTGGCCTCATCCCACAAGATTGTGCGACCTTTCCCCGTCATAGCCTGTCGTGA
5281 CAATCACGCTATTGAAAGTGGCTTTCTAGTTAAAATGCAATTGGAAACTTGACAGTCTCTAAATGAATTAAAAGTTTCCT
5361 TTGGGGCTATTTAGCTTAACAGCAGTCTACAAATAATTAAAGTGTGAGCTTAAGAAAAGTATCTTTGCGGGGAGAAAAAT
5441 GTCAGATATTTTTAATGCCCAGCTATAAATAATTTTGGTGTCTTGATATTTATACATGCAAAATAGAAAAAAAATGTTCA
5521 ACATTTATTGATTGATAGACTGTTAAAATTTAATGTTTGGAATAACATTTGGAAGTAGTAGACTTTGCATTAAAAAATGG
5601 CTTTTCTTTAGGAAAGTATAATCAATTATTTTAATGACCATAGCATTCATGGACTCAAATGCTGCTGCCACACACAACTC
5681 AAGTGCTGGAATATTTTTCTACAGTCTCTCTGTTCTACGGATTATCTTGTAAACCAGTGTTCAACTAGTTTTATAACTGA
5761 AAAGCTGCACATTTTTCACAGTACAAGCCGTAGTTTTTACCTGTAGTTTGGACTTCTCTGTTAGAATGTAACTGCATTAC
5841 CAGCCCTTTTAAAGGCATCTATCTATCAAAGGAAAATTTGGGTGTTAGATTTTCTTGGGACCGTTTCTGTAACCTTTGCC
5921 CTTCACAATATAGAAAATATTGGTTTTGCCATTACATTTTAATGCCAGGTTTAAAACCTGTTGAAAGCTGCAGCTTTATA
6001 CAGCTTTCTTCTCCCTGTGAAATCACTTTGTTTATGTGATGGCATTTAAAAAATAGCATGTTCTTTTTAAACTGAATTTT
6081 ATATCTAATCAATGTCTTCAGTCTTGAAGAAGAATTTGCATTGTTGTGTTTGTATATAGAGTATTGCAGTGCATGAATTA
6161 GCTTTATGCATTTTATTAAATGCTGTTTCAATGTGGCATTATTGTTGTGGCTTAATACTACTACCTAAATGAGGTTTATA
6241 CTATTAAAAGTGAATTAAAGACTAACATGCAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGG---UAAUACACGACGAu 5'
              ||||   ||| | ||||||| 
Target 5' acgtAACCTGTATTCT-TGCTGCTt 3'
2575 - 2598 157.00 -12.90
2
miRNA  3' guGUUUGGUAA-UAC--------ACGACGAu 5'
            || | |||| |||        ||||||| 
Target 5' acCATAGCATTCATGGACTCAAATGCTGCTg 3'
5637 - 5667 154.00 -14.00
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||  ::||||  |||||:| 
Target 5' tgCATTTTATTAAATGCTGTTt 3'
6167 - 6188 144.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14040505 3 COSMIC
COSN30109654 32 COSMIC
COSN31537458 52 COSMIC
COSN28870287 81 COSMIC
COSN30128456 83 COSMIC
COSN30545421 121 COSMIC
COSN29822102 288 COSMIC
COSN14472700 353 COSMIC
COSN25911428 368 COSMIC
COSN26583649 427 COSMIC
COSN8488490 486 COSMIC
COSN26507248 582 COSMIC
COSN25552789 662 COSMIC
COSN21227459 813 COSMIC
COSN17486598 1381 COSMIC
COSN229099 1392 COSMIC
COSN229098 1692 COSMIC
COSN15662224 1823 COSMIC
COSN9136162 1864 COSMIC
COSN15109314 1923 COSMIC
COSN16812306 2232 COSMIC
COSN20098167 2545 COSMIC
COSN29424880 2553 COSMIC
COSN1921435 2723 COSMIC
COSN24500764 2879 COSMIC
COSN20098169 2966 COSMIC
COSN19328725 3335 COSMIC
COSN16376099 3365 COSMIC
COSN25671028 3748 COSMIC
COSN6736270 3802 COSMIC
COSN17181718 3904 COSMIC
COSN26635319 4012 COSMIC
COSN229101 4360 COSMIC
COSN6736273 4461 COSMIC
COSN229100 4584 COSMIC
COSN29527346 4980 COSMIC
COSN8363094 5032 COSMIC
COSN24300157 5191 COSMIC
COSN17037569 5254 COSMIC
COSN15306690 5264 COSMIC
COSN1921441 5325 COSMIC
COSN8488491 5371 COSMIC
COSN5038712 5546 COSMIC
COSN31483108 5561 COSMIC
COSN31582495 5697 COSMIC
COSN31590368 5841 COSMIC
COSN24299629 5970 COSMIC
COSN31609125 5979 COSMIC
COSN31609978 5998 COSMIC
COSN23459781 6113 COSMIC
COSN29461873 6124 COSMIC
COSN29356256 6165 COSMIC
COSN5523807 6175 COSMIC
COSN20853008 6225 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs533260662 2 dbSNP
rs139778021 3 dbSNP
rs200379124 13 dbSNP
rs920239946 14 dbSNP
rs751532636 15 dbSNP
rs1011387389 18 dbSNP
rs759363555 19 dbSNP
rs767397592 22 dbSNP
rs752426012 29 dbSNP
rs193049177 30 dbSNP
rs759405039 32 dbSNP
rs529324649 37 dbSNP
rs754056755 39 dbSNP
rs764168079 39 dbSNP
rs1021486615 40 dbSNP
rs757436948 41 dbSNP
rs1484300738 44 dbSNP
rs779093761 47 dbSNP
rs568041672 48 dbSNP
rs568594021 51 dbSNP
rs185225667 54 dbSNP
rs1388359334 62 dbSNP
rs1186473783 64 dbSNP
rs1429600608 66 dbSNP
rs1173497375 71 dbSNP
rs189683000 72 dbSNP
rs1035756093 78 dbSNP
rs959772422 80 dbSNP
rs1403935561 84 dbSNP
rs1280656202 90 dbSNP
rs562207621 90 dbSNP
rs1339490780 96 dbSNP
rs191787665 98 dbSNP
rs183766871 101 dbSNP
rs1341304208 102 dbSNP
rs1337553881 106 dbSNP
rs1057339071 108 dbSNP
rs773976804 122 dbSNP
rs1313751878 127 dbSNP
rs149009663 127 dbSNP
rs1013573355 129 dbSNP
rs1023242297 142 dbSNP
rs963468774 143 dbSNP
rs1362445112 150 dbSNP
rs143800576 162 dbSNP
rs922124573 164 dbSNP
rs1281314219 170 dbSNP
rs932230821 171 dbSNP
rs1052008855 184 dbSNP
rs1475106337 185 dbSNP
rs556251547 193 dbSNP
rs569534127 197 dbSNP
rs1031685125 203 dbSNP
rs1481836059 204 dbSNP
rs1231816723 207 dbSNP
rs1203747085 212 dbSNP
rs1439022092 213 dbSNP
rs935314182 221 dbSNP
rs1264522804 233 dbSNP
rs956124352 246 dbSNP
rs987239787 249 dbSNP
rs1294839637 252 dbSNP
rs1259404152 255 dbSNP
rs1371538848 257 dbSNP
rs1444904556 265 dbSNP
rs1214686989 268 dbSNP
rs761831425 268 dbSNP
rs1241855200 270 dbSNP
rs1475956897 271 dbSNP
rs1356321422 272 dbSNP
rs1443079280 272 dbSNP
rs1324501457 275 dbSNP
rs1018745710 279 dbSNP
rs1419047424 279 dbSNP
rs1461334877 279 dbSNP
rs755314681 279 dbSNP
rs964602190 279 dbSNP
rs1052878484 283 dbSNP
rs920561348 285 dbSNP
rs1427816276 290 dbSNP
rs1470896486 295 dbSNP
rs1480433105 296 dbSNP
rs930296702 303 dbSNP
rs138237462 306 dbSNP
rs1177224374 312 dbSNP
rs1274973953 315 dbSNP
rs1468811018 315 dbSNP
rs1427412465 316 dbSNP
rs1316093449 319 dbSNP
rs1306607936 324 dbSNP
rs983124194 325 dbSNP
rs1375641710 331 dbSNP
rs907601820 332 dbSNP
rs893868556 340 dbSNP
rs1056256310 343 dbSNP
rs1345508283 347 dbSNP
rs535401791 347 dbSNP
rs751266051 349 dbSNP
rs1452139051 353 dbSNP
rs537609502 353 dbSNP
rs752871301 353 dbSNP
rs777218316 353 dbSNP
rs648912 355 dbSNP
rs1301134702 361 dbSNP
rs1392734700 364 dbSNP
rs1042897893 365 dbSNP
rs1344790105 365 dbSNP
rs1186559014 366 dbSNP
rs3773486 366 dbSNP
rs1261040057 367 dbSNP
rs1485438239 367 dbSNP
rs373343777 368 dbSNP
rs1318889778 374 dbSNP
rs1278449690 380 dbSNP
rs1233734861 385 dbSNP
rs1371780992 387 dbSNP
rs1306313102 388 dbSNP
rs1035571851 392 dbSNP
rs904783602 398 dbSNP
rs540114750 399 dbSNP
rs1455672774 419 dbSNP
rs1004522672 426 dbSNP
rs1222804471 430 dbSNP
rs1172606152 434 dbSNP
rs141197085 436 dbSNP
rs779158053 437 dbSNP
rs891850555 438 dbSNP
rs1168258566 439 dbSNP
rs377735857 443 dbSNP
rs543539255 450 dbSNP
rs1188119800 453 dbSNP
rs1008922694 455 dbSNP
rs563771448 458 dbSNP
rs1210392444 460 dbSNP
rs574069963 464 dbSNP
rs1172550004 465 dbSNP
rs964897501 480 dbSNP
rs553422580 483 dbSNP
rs571683643 485 dbSNP
rs922103221 485 dbSNP
rs1296909011 489 dbSNP
rs1267278556 495 dbSNP
rs1384327666 499 dbSNP
rs542994520 503 dbSNP
rs1311923232 504 dbSNP
rs988054819 508 dbSNP
rs534155394 509 dbSNP
rs1461039405 510 dbSNP
rs912120265 511 dbSNP
rs772142363 514 dbSNP
rs756454371 521 dbSNP
rs1474121914 525 dbSNP
rs1416836404 531 dbSNP
rs1187516323 533 dbSNP
rs1158145301 538 dbSNP
rs1052429044 539 dbSNP
rs1194214363 540 dbSNP
rs915257322 544 dbSNP
rs1480338969 546 dbSNP
rs1252452277 547 dbSNP
rs1230206059 548 dbSNP
rs991907576 553 dbSNP
rs946775951 558 dbSNP
rs1292999168 563 dbSNP
rs559792213 570 dbSNP
rs1306679387 571 dbSNP
rs916369264 574 dbSNP
rs1326427691 578 dbSNP
rs1390365310 584 dbSNP
rs1396551147 588 dbSNP
rs1299839425 589 dbSNP
rs1421815716 590 dbSNP
rs181877949 592 dbSNP
rs1393465693 597 dbSNP
rs1417050008 600 dbSNP
rs1476059272 603 dbSNP
rs372806098 607 dbSNP
rs547760184 624 dbSNP
rs1418614243 626 dbSNP
rs1325475924 628 dbSNP
rs564104093 633 dbSNP
rs926172586 637 dbSNP
rs936267492 642 dbSNP
rs1355384357 645 dbSNP
rs1277450447 650 dbSNP
rs895708654 651 dbSNP
rs1335847256 655 dbSNP
rs1053327452 658 dbSNP
rs1005228964 666 dbSNP
rs1008891671 672 dbSNP
rs1393722512 672 dbSNP
rs1014575861 675 dbSNP
rs1040850571 676 dbSNP
rs145074138 679 dbSNP
rs994466536 680 dbSNP
rs1028667098 683 dbSNP
rs760886986 685 dbSNP
rs1452641556 686 dbSNP
rs1223814932 693 dbSNP
rs1252975575 708 dbSNP
rs953147405 715 dbSNP
rs549731727 716 dbSNP
rs1282525156 720 dbSNP
rs569686436 722 dbSNP
rs1019555285 731 dbSNP
rs1436645699 732 dbSNP
rs956964772 733 dbSNP
rs1204191559 746 dbSNP
rs1004785198 750 dbSNP
rs535208425 754 dbSNP
rs1014889535 762 dbSNP
rs1369575746 773 dbSNP
rs1181161044 779 dbSNP
rs1324478434 784 dbSNP
rs1438465201 784 dbSNP
rs1317287416 790 dbSNP
rs1233574198 792 dbSNP
rs548561815 805 dbSNP
rs1441747071 807 dbSNP
rs115300834 816 dbSNP
rs1384332288 819 dbSNP
rs1425084055 822 dbSNP
rs534965974 825 dbSNP
rs558066720 827 dbSNP
rs1394514612 829 dbSNP
rs138863027 839 dbSNP
rs141797055 841 dbSNP
rs1240862962 847 dbSNP
rs980774760 851 dbSNP
rs557273832 856 dbSNP
rs926663943 858 dbSNP
rs969186485 863 dbSNP
rs1264935897 880 dbSNP
rs771565186 881 dbSNP
rs980646521 887 dbSNP
rs574035964 892 dbSNP
rs1449960896 894 dbSNP
rs150773094 901 dbSNP
rs540643808 903 dbSNP
rs895665483 905 dbSNP
rs573302000 906 dbSNP
rs79518486 909 dbSNP
rs1342106074 912 dbSNP
rs1036651852 915 dbSNP
rs564371389 918 dbSNP
rs533080690 921 dbSNP
rs549908161 922 dbSNP
rs1313632939 924 dbSNP
rs1028635733 925 dbSNP
rs1418052943 926 dbSNP
rs1167816207 931 dbSNP
rs1459163369 934 dbSNP
rs996263071 936 dbSNP
rs1201947787 942 dbSNP
rs1242769050 954 dbSNP
rs1445534030 958 dbSNP
rs564722744 960 dbSNP
rs1211687543 966 dbSNP
rs1371173883 973 dbSNP
rs1435542087 973 dbSNP
rs1475024642 974 dbSNP
rs1215044882 975 dbSNP
rs558701444 976 dbSNP
rs1291148041 979 dbSNP
rs1009093254 980 dbSNP
rs1401780488 982 dbSNP
rs1019104494 985 dbSNP
rs1467786640 988 dbSNP
rs1284981663 996 dbSNP
rs756989033 1009 dbSNP
rs1450347520 1013 dbSNP
rs957131618 1016 dbSNP
rs1328804649 1026 dbSNP
rs1335580904 1030 dbSNP
rs1466552204 1031 dbSNP
rs752331856 1033 dbSNP
rs1013648606 1036 dbSNP
rs138011696 1037 dbSNP
rs763598129 1038 dbSNP
rs1468182236 1039 dbSNP
rs1325083327 1042 dbSNP
rs1231768359 1051 dbSNP
rs17040701 1056 dbSNP
rs1032543978 1057 dbSNP
rs757042503 1070 dbSNP
rs939435931 1073 dbSNP
rs28524664 1078 dbSNP
rs1335204836 1082 dbSNP
rs114026554 1086 dbSNP
rs940488011 1088 dbSNP
rs543164500 1094 dbSNP
rs1036168431 1097 dbSNP
rs976769705 1102 dbSNP
rs563496563 1104 dbSNP
rs1202436707 1105 dbSNP
rs1461283528 1109 dbSNP
rs755092982 1109 dbSNP
rs930586068 1110 dbSNP
rs1350790758 1111 dbSNP
rs1166499641 1112 dbSNP
rs751816619 1117 dbSNP
rs932014420 1125 dbSNP
rs1406613627 1133 dbSNP
rs571860185 1140 dbSNP
rs1177337381 1147 dbSNP
rs779078664 1148 dbSNP
rs537351635 1149 dbSNP
rs1192888660 1150 dbSNP
rs887868273 1151 dbSNP
rs1425694875 1152 dbSNP
rs1479449617 1153 dbSNP
rs888816965 1155 dbSNP
rs1224059987 1156 dbSNP
rs1008645904 1168 dbSNP
rs1283805564 1169 dbSNP
rs1019070687 1171 dbSNP
rs557519850 1172 dbSNP
rs892222784 1173 dbSNP
rs1368765102 1175 dbSNP
rs1010119554 1177 dbSNP
rs187588601 1182 dbSNP
rs1429045638 1187 dbSNP
rs968269578 1193 dbSNP
rs1344290212 1197 dbSNP
rs758655762 1199 dbSNP
rs1036213022 1200 dbSNP
rs896372350 1201 dbSNP
rs1299267071 1205 dbSNP
rs1342919191 1206 dbSNP
rs1222273637 1216 dbSNP
rs1282688921 1218 dbSNP
rs1013493721 1225 dbSNP
rs1485407181 1230 dbSNP
rs190475255 1235 dbSNP
rs1241782004 1238 dbSNP
rs1023999476 1241 dbSNP
rs1489324116 1243 dbSNP
rs1002482888 1244 dbSNP
rs1234206977 1247 dbSNP
rs553538503 1254 dbSNP
rs1304023350 1257 dbSNP
rs1213221232 1259 dbSNP
rs960953814 1275 dbSNP
rs1361652493 1279 dbSNP
rs1312878706 1283 dbSNP
rs1401403417 1286 dbSNP
rs904855880 1288 dbSNP
rs1311822615 1292 dbSNP
rs573390791 1295 dbSNP
rs1032018492 1298 dbSNP
rs545374561 1304 dbSNP
rs956458885 1311 dbSNP
rs1427734161 1312 dbSNP
rs532248778 1313 dbSNP
rs1194671252 1314 dbSNP
rs1489355018 1314 dbSNP
rs181664225 1321 dbSNP
rs149540179 1326 dbSNP
rs961504612 1327 dbSNP
rs971854643 1328 dbSNP
rs1198644011 1330 dbSNP
rs9831520 1331 dbSNP
rs1434413514 1335 dbSNP
rs563478067 1336 dbSNP
rs529090195 1337 dbSNP
rs1396149770 1352 dbSNP
rs985197895 1353 dbSNP
rs909270149 1354 dbSNP
rs1461370982 1360 dbSNP
rs1050342383 1364 dbSNP
rs1400767149 1368 dbSNP
rs1172640056 1371 dbSNP
rs940766534 1377 dbSNP
rs910471819 1378 dbSNP
rs1036479773 1382 dbSNP
rs944337337 1383 dbSNP
rs1156414235 1387 dbSNP
rs896304042 1388 dbSNP
rs771407927 1391 dbSNP
rs144110583 1392 dbSNP
rs1175990204 1394 dbSNP
rs745491080 1394 dbSNP
rs1159601987 1395 dbSNP
rs559416964 1400 dbSNP
rs528469143 1404 dbSNP
rs1272191783 1410 dbSNP
rs1303102248 1412 dbSNP
rs1245008807 1414 dbSNP
rs1000498217 1416 dbSNP
rs1009341035 1425 dbSNP
rs1368321760 1430 dbSNP
rs1043902764 1443 dbSNP
rs1305041679 1448 dbSNP
rs892186698 1448 dbSNP
rs904053020 1450 dbSNP
rs140322483 1451 dbSNP
rs1335377329 1452 dbSNP
rs551313403 1460 dbSNP
rs1162903652 1463 dbSNP
rs961003604 1467 dbSNP
rs1370408880 1470 dbSNP
rs1179815075 1483 dbSNP
rs1439136716 1484 dbSNP
rs1239366276 1485 dbSNP
rs1181010879 1486 dbSNP
rs1467435406 1487 dbSNP
rs1267044065 1489 dbSNP
rs1013982211 1497 dbSNP
rs1221581009 1498 dbSNP
rs1015621325 1501 dbSNP
rs1265969328 1504 dbSNP
rs1029207041 1505 dbSNP
rs1489463744 1505 dbSNP
rs1353751828 1506 dbSNP
rs953775279 1516 dbSNP
rs1438549633 1523 dbSNP
rs1369981671 1525 dbSNP
rs961747824 1532 dbSNP
rs1324039442 1535 dbSNP
rs1174963940 1536 dbSNP
rs984758465 1538 dbSNP
rs1222700502 1552 dbSNP
rs571192875 1553 dbSNP
rs1157018789 1554 dbSNP
rs920426625 1555 dbSNP
rs1439886237 1560 dbSNP
rs770377363 1568 dbSNP
rs1453047952 1574 dbSNP
rs1377554984 1580 dbSNP
rs879672267 1580 dbSNP
rs1200096142 1587 dbSNP
rs985934299 1591 dbSNP
rs909196575 1603 dbSNP
rs910432624 1605 dbSNP
rs1215376870 1606 dbSNP
rs962064606 1608 dbSNP
rs531234241 1611 dbSNP
rs972142319 1613 dbSNP
rs1423143139 1625 dbSNP
rs1164608193 1626 dbSNP
rs548621586 1626 dbSNP
rs918042167 1629 dbSNP
rs1296610549 1631 dbSNP
rs780460982 1634 dbSNP
rs1350971357 1636 dbSNP
rs551020405 1638 dbSNP
rs1459943002 1639 dbSNP
rs1399574353 1642 dbSNP
rs1296493736 1653 dbSNP
rs1361256104 1654 dbSNP
rs868216358 1655 dbSNP
rs1447735870 1658 dbSNP
rs1311759940 1662 dbSNP
rs926537943 1667 dbSNP
rs1040424515 1668 dbSNP
rs1479222092 1671 dbSNP
rs913594944 1672 dbSNP
rs936598929 1676 dbSNP
rs1477981280 1677 dbSNP
rs1264860339 1678 dbSNP
rs1208162603 1681 dbSNP
rs567845570 1682 dbSNP
rs1053659601 1687 dbSNP
rs144184591 1692 dbSNP
rs1323404527 1702 dbSNP
rs1202065080 1707 dbSNP
rs1202398732 1708 dbSNP
rs553625508 1714 dbSNP
rs762303991 1715 dbSNP
rs1457837775 1719 dbSNP
rs1341427344 1723 dbSNP
rs763873695 1725 dbSNP
rs1445964071 1730 dbSNP
rs1009221772 1734 dbSNP
rs1055318028 1736 dbSNP
rs62240396 1738 dbSNP
rs1443702083 1748 dbSNP
rs1394959108 1755 dbSNP
rs1013867642 1757 dbSNP
rs1466447525 1758 dbSNP
rs1415028229 1761 dbSNP
rs1167302088 1763 dbSNP
rs1426033451 1764 dbSNP
rs539176279 1766 dbSNP
rs1237499654 1767 dbSNP
rs1189543581 1770 dbSNP
rs1016003597 1774 dbSNP
rs953598232 1775 dbSNP
rs1399569359 1778 dbSNP
rs897194195 1788 dbSNP
rs558906759 1790 dbSNP
rs1006463382 1791 dbSNP
rs1319700078 1793 dbSNP
rs1226764663 1794 dbSNP
rs1260271398 1794 dbSNP
rs1466215297 1796 dbSNP
rs575576145 1810 dbSNP
rs1016567269 1812 dbSNP
rs186799028 1813 dbSNP
rs1284921701 1814 dbSNP
rs1450278889 1814 dbSNP
rs1404171788 1823 dbSNP
rs1375389457 1830 dbSNP
rs556939399 1847 dbSNP
rs1466495752 1849 dbSNP
rs972068708 1850 dbSNP
rs954141810 1854 dbSNP
rs191245990 1858 dbSNP
rs985902597 1859 dbSNP
rs1381108078 1866 dbSNP
rs917970648 1867 dbSNP
rs971239318 1869 dbSNP
rs980602120 1870 dbSNP
rs1294786318 1872 dbSNP
rs926436794 1875 dbSNP
rs1017460724 1877 dbSNP
rs1219928388 1884 dbSNP
rs573617874 1889 dbSNP
rs761649188 1893 dbSNP
rs966340024 1895 dbSNP
rs1220550301 1897 dbSNP
rs1460576647 1899 dbSNP
rs936556651 1910 dbSNP
rs1290828116 1915 dbSNP
rs1230138182 1918 dbSNP
rs1210425570 1919 dbSNP
rs542363295 1921 dbSNP
rs1351544054 1929 dbSNP
rs147389110 1932 dbSNP
rs1484451737 1943 dbSNP
rs373461734 1950 dbSNP
rs1185223714 1954 dbSNP
rs913827927 1959 dbSNP
rs945002829 1960 dbSNP
rs528166195 1961 dbSNP
rs944982754 1962 dbSNP
rs1417354811 1963 dbSNP
rs1379101829 1964 dbSNP
rs1159184526 1965 dbSNP
rs1427332199 1973 dbSNP
rs1441541622 1976 dbSNP
rs550834385 1981 dbSNP
rs1190455673 1982 dbSNP
rs1488665336 1994 dbSNP
rs1247541521 1998 dbSNP
rs564876962 2007 dbSNP
rs932377497 2008 dbSNP
rs1335125751 2010 dbSNP
rs1240962490 2011 dbSNP
rs1356543529 2017 dbSNP
rs925003448 2023 dbSNP
rs889283088 2024 dbSNP
rs1006430849 2027 dbSNP
rs778782233 2029 dbSNP
rs937769199 2036 dbSNP
rs527771878 2037 dbSNP
rs1359491882 2040 dbSNP
rs1298338150 2041 dbSNP
rs1420961061 2042 dbSNP
rs750182204 2051 dbSNP
rs1357395266 2053 dbSNP
rs1055689758 2062 dbSNP
rs1175217773 2066 dbSNP
rs1428388191 2067 dbSNP
rs1433576344 2074 dbSNP
rs746486112 2075 dbSNP
rs1201871210 2079 dbSNP
rs1016493331 2081 dbSNP
rs896686773 2082 dbSNP
rs1217504221 2083 dbSNP
rs1341038116 2084 dbSNP
rs949667428 2091 dbSNP
rs1401821129 2093 dbSNP
rs1280763757 2108 dbSNP
rs1037247216 2109 dbSNP
rs530458916 2111 dbSNP
rs993474930 2121 dbSNP
rs897420520 2125 dbSNP
rs1280304563 2133 dbSNP
rs1025410052 2135 dbSNP
rs1314835100 2138 dbSNP
rs1217169932 2140 dbSNP
rs747831122 2145 dbSNP
rs970782780 2153 dbSNP
rs571008042 2155 dbSNP
rs182707410 2156 dbSNP
rs1401337776 2158 dbSNP
rs567932455 2164 dbSNP
rs995438544 2170 dbSNP
rs756065758 2176 dbSNP
rs1302202068 2180 dbSNP
rs1026960762 2181 dbSNP
rs1168348168 2185 dbSNP
rs539671428 2188 dbSNP
rs368323871 2189 dbSNP
rs1173309168 2190 dbSNP
rs957833675 2193 dbSNP
rs1017845797 2195 dbSNP
rs1265517507 2215 dbSNP
rs1197187001 2216 dbSNP
rs1399234372 2217 dbSNP
rs965942567 2226 dbSNP
rs752823018 2236 dbSNP
rs913796755 2244 dbSNP
rs1220026183 2246 dbSNP
rs945307393 2249 dbSNP
rs976724635 2251 dbSNP
rs1396096691 2254 dbSNP
rs1381317000 2264 dbSNP
rs1329190367 2270 dbSNP
rs758401022 2277 dbSNP
rs34253498 2278 dbSNP
rs1400697564 2292 dbSNP
rs1445815049 2292 dbSNP
rs1157805070 2299 dbSNP
rs922241094 2300 dbSNP
rs1360965481 2301 dbSNP
rs1421388363 2313 dbSNP
rs976321131 2314 dbSNP
rs553599066 2317 dbSNP
rs56110601 2318 dbSNP
rs1049936929 2322 dbSNP
rs1424441203 2332 dbSNP
rs547205891 2333 dbSNP
rs1245543604 2340 dbSNP
rs1457607751 2341 dbSNP
rs888211619 2341 dbSNP
rs966638311 2344 dbSNP
rs1329938531 2348 dbSNP
rs1197918576 2350 dbSNP
rs1353896435 2370 dbSNP
rs1264475500 2371 dbSNP
rs567115607 2372 dbSNP
rs1244939421 2374 dbSNP
rs539099852 2382 dbSNP
rs1037893451 2383 dbSNP
rs558817105 2389 dbSNP
rs924970873 2395 dbSNP
rs1333186651 2398 dbSNP
rs139553479 2406 dbSNP
rs1388895687 2416 dbSNP
rs1293118848 2419 dbSNP
rs990625725 2425 dbSNP
rs917660859 2427 dbSNP
rs1222895119 2435 dbSNP
rs1387099742 2439 dbSNP
rs1157386974 2442 dbSNP
rs537820414 2443 dbSNP
rs1025249250 2454 dbSNP
rs1285701536 2458 dbSNP
rs1354890319 2460 dbSNP
rs1266276063 2464 dbSNP
rs554543842 2468 dbSNP
rs1490701143 2469 dbSNP
rs1283181146 2471 dbSNP
rs573561306 2484 dbSNP
rs1034140466 2490 dbSNP
rs918815378 2492 dbSNP
rs1281179913 2494 dbSNP
rs1199655805 2498 dbSNP
rs1248578497 2507 dbSNP
rs931588006 2514 dbSNP
rs1387495913 2515 dbSNP
rs1367675091 2517 dbSNP
rs1178282959 2518 dbSNP
rs989242354 2528 dbSNP
rs1020729881 2530 dbSNP
rs1361785238 2537 dbSNP
rs34001454 2542 dbSNP
rs398051613 2542 dbSNP
rs1477258076 2554 dbSNP
rs771192037 2554 dbSNP
rs1199138035 2555 dbSNP
rs1421291720 2556 dbSNP
rs977069883 2559 dbSNP
rs1161512208 2560 dbSNP
rs922581577 2560 dbSNP
rs1048368410 2568 dbSNP
rs773112751 2576 dbSNP
rs932277581 2577 dbSNP
rs760220260 2578 dbSNP
rs1286286376 2582 dbSNP
rs1405929676 2584 dbSNP
rs185052702 2587 dbSNP
rs552748616 2593 dbSNP
rs1007382418 2595 dbSNP
rs781713007 2596 dbSNP
rs901260384 2597 dbSNP
rs1276509457 2598 dbSNP
rs1347676974 2598 dbSNP
rs1399515493 2609 dbSNP
rs1341161638 2614 dbSNP
rs1320869288 2621 dbSNP
rs572731637 2623 dbSNP
rs1402115760 2627 dbSNP
rs1020825381 2631 dbSNP
rs1309553635 2633 dbSNP
rs966606127 2635 dbSNP
rs1173588324 2641 dbSNP
rs1471142100 2642 dbSNP
rs1378027662 2645 dbSNP
rs919407721 2648 dbSNP
rs929530981 2649 dbSNP
rs1184768998 2657 dbSNP
rs545074299 2659 dbSNP
rs189813068 2665 dbSNP
rs564795031 2667 dbSNP
rs958988243 2669 dbSNP
rs1315794542 2673 dbSNP
rs575320807 2676 dbSNP
rs1218185730 2681 dbSNP
rs1292055669 2681 dbSNP
rs1436166092 2684 dbSNP
rs990899979 2690 dbSNP
rs1272071334 2696 dbSNP
rs770340370 2708 dbSNP
rs970901110 2713 dbSNP
rs1055144151 2715 dbSNP
rs775857040 2718 dbSNP
rs182265943 2722 dbSNP
rs1398485320 2725 dbSNP
rs1367718205 2734 dbSNP
rs1473060213 2736 dbSNP
rs1421185552 2742 dbSNP
rs1160999630 2749 dbSNP
rs572572604 2758 dbSNP
rs1164959004 2759 dbSNP
rs748887555 2761 dbSNP
rs1185297077 2762 dbSNP
rs1456290684 2772 dbSNP
rs1237270817 2775 dbSNP
rs931556860 2782 dbSNP
rs1438668717 2783 dbSNP
rs530412583 2786 dbSNP
rs911475425 2790 dbSNP
rs547343923 2792 dbSNP
rs1041463683 2795 dbSNP
rs1355669040 2798 dbSNP
rs560652223 2803 dbSNP
rs1248722062 2806 dbSNP
rs1331523728 2807 dbSNP
rs534278202 2810 dbSNP
rs1443355009 2814 dbSNP
rs1042239518 2815 dbSNP
rs774036311 2816 dbSNP
rs1321132223 2820 dbSNP
rs761487585 2821 dbSNP
rs532560812 2822 dbSNP
rs188910096 2824 dbSNP
rs1332574572 2832 dbSNP
rs1437825287 2834 dbSNP
rs1432211803 2842 dbSNP
rs1379601126 2843 dbSNP
rs909536696 2847 dbSNP
rs962394481 2850 dbSNP
rs972475474 2855 dbSNP
rs1246094341 2858 dbSNP
rs774894064 2858 dbSNP
rs144082511 2863 dbSNP
rs929425217 2868 dbSNP
rs377542501 2877 dbSNP
rs1316664534 2891 dbSNP
rs1000703991 2894 dbSNP
rs1218074473 2897 dbSNP
rs1046577016 2900 dbSNP
rs1258849798 2901 dbSNP
rs1032227490 2908 dbSNP
rs1459232257 2919 dbSNP
rs1198976876 2927 dbSNP
rs1224721224 2928 dbSNP
rs959566649 2929 dbSNP
rs1375923019 2941 dbSNP
rs928176907 2945 dbSNP
rs938262354 2947 dbSNP
rs1365805683 2951 dbSNP
rs113041582 2954 dbSNP
rs199646450 2958 dbSNP
rs34551427 2958 dbSNP
rs376918451 2958 dbSNP
rs398051614 2958 dbSNP
rs573047192 2958 dbSNP
rs576977437 2958 dbSNP
rs1011891302 2959 dbSNP
rs764733114 2965 dbSNP
rs893803979 2977 dbSNP
rs1025083805 2981 dbSNP
rs970490223 2982 dbSNP
rs972489988 2985 dbSNP
rs1190405120 2990 dbSNP
rs1010893546 2993 dbSNP
rs193105675 2999 dbSNP
rs1201730231 3000 dbSNP
rs1487325011 3013 dbSNP
rs538343858 3014 dbSNP
rs142538416 3016 dbSNP
rs568165148 3017 dbSNP
rs1217062567 3018 dbSNP
rs1319113635 3020 dbSNP
rs773002374 3025 dbSNP
rs1170751175 3026 dbSNP
rs1277037924 3029 dbSNP
rs1425203122 3030 dbSNP
rs1345807573 3032 dbSNP
rs952841030 3035 dbSNP
rs1284774212 3037 dbSNP
rs1397614224 3050 dbSNP
rs1467867447 3051 dbSNP
rs1171653198 3059 dbSNP
rs1401859348 3061 dbSNP
rs902610422 3062 dbSNP
rs1175150393 3063 dbSNP
rs151304634 3076 dbSNP
rs934406335 3076 dbSNP
rs1178795677 3080 dbSNP
rs73129437 3081 dbSNP
rs573109841 3099 dbSNP
rs538427904 3103 dbSNP
rs766402123 3105 dbSNP
rs976767483 3108 dbSNP
rs1016901119 3115 dbSNP
rs1320117690 3117 dbSNP
rs1209908374 3123 dbSNP
rs1324669982 3124 dbSNP
rs1264629509 3129 dbSNP
rs1216336416 3133 dbSNP
rs1316916641 3137 dbSNP
rs1295744905 3143 dbSNP
rs922629805 3145 dbSNP
rs1231268493 3146 dbSNP
rs1302149577 3156 dbSNP
rs753705012 3157 dbSNP
rs1407957271 3159 dbSNP
rs150069104 3164 dbSNP
rs575240173 3167 dbSNP
rs946152010 3175 dbSNP
rs758554766 3182 dbSNP
rs1171283649 3185 dbSNP
rs1430354207 3189 dbSNP
rs1260827761 3201 dbSNP
rs971182865 3202 dbSNP
rs1183453807 3203 dbSNP
rs1462046396 3205 dbSNP
rs1194342780 3208 dbSNP
rs1318468105 3217 dbSNP
rs981626312 3220 dbSNP
rs1264647223 3222 dbSNP
rs1197122975 3229 dbSNP
rs1479173013 3234 dbSNP
rs1457080271 3241 dbSNP
rs928133933 3247 dbSNP
rs1197624413 3249 dbSNP
rs1311943699 3254 dbSNP
rs938216226 3254 dbSNP
rs1041784561 3259 dbSNP
rs991021489 3261 dbSNP
rs1445750922 3280 dbSNP
rs764048055 3281 dbSNP
rs936461341 3290 dbSNP
rs1298924214 3291 dbSNP
rs1463612813 3294 dbSNP
rs1053637611 3301 dbSNP
rs1348129178 3312 dbSNP
rs895043721 3314 dbSNP
rs1445824841 3316 dbSNP
rs915498835 3322 dbSNP
rs1012605766 3323 dbSNP
rs879366604 3329 dbSNP
rs946681830 3330 dbSNP
rs1042389811 3332 dbSNP
rs1250822542 3346 dbSNP
rs1024635076 3347 dbSNP
rs906230007 3348 dbSNP
rs1290489780 3349 dbSNP
rs1342380074 3349 dbSNP
rs902568949 3353 dbSNP
rs934077950 3354 dbSNP
rs1306953667 3357 dbSNP
rs993794496 3369 dbSNP
rs1336080019 3376 dbSNP
rs1307980067 3377 dbSNP
rs1025312724 3379 dbSNP
rs1005415842 3380 dbSNP
rs183470621 3381 dbSNP
rs560844544 3386 dbSNP
rs889625256 3387 dbSNP
rs751649271 3389 dbSNP
rs964322643 3390 dbSNP
rs556814701 3391 dbSNP
rs993804427 3393 dbSNP
rs574517841 3397 dbSNP
rs368770035 3401 dbSNP
rs1487497179 3404 dbSNP
rs762066986 3408 dbSNP
rs945997021 3409 dbSNP
rs1204422679 3412 dbSNP
rs977433997 3418 dbSNP
rs926004583 3423 dbSNP
rs757568142 3424 dbSNP
rs1262327242 3427 dbSNP
rs576947605 3428 dbSNP
rs1434501417 3429 dbSNP
rs1347408486 3435 dbSNP
rs1296891243 3437 dbSNP
rs1053604304 3440 dbSNP
rs1382226321 3455 dbSNP
rs1386299683 3456 dbSNP
rs981210983 3458 dbSNP
rs1034545727 3460 dbSNP
rs895005503 3466 dbSNP
rs959531958 3472 dbSNP
rs560737538 3476 dbSNP
rs1481141276 3494 dbSNP
rs1260326317 3498 dbSNP
rs1191825424 3507 dbSNP
rs1447557783 3517 dbSNP
rs1263720688 3522 dbSNP
rs1198549163 3523 dbSNP
rs781499216 3527 dbSNP
rs1322504590 3528 dbSNP
rs947994791 3529 dbSNP
rs1046703720 3530 dbSNP
rs915472494 3538 dbSNP
rs946984493 3540 dbSNP
rs545702298 3542 dbSNP
rs1226756021 3549 dbSNP
rs1327571357 3550 dbSNP
rs1159704986 3556 dbSNP
rs923947721 3557 dbSNP
rs993764808 3558 dbSNP
rs112971878 3559 dbSNP
rs1391586687 3562 dbSNP
rs532841118 3569 dbSNP
rs1307368210 3572 dbSNP
rs552451728 3573 dbSNP
rs1374746093 3576 dbSNP
rs1185252885 3579 dbSNP
rs1240586269 3580 dbSNP
rs889876939 3583 dbSNP
rs942486329 3591 dbSNP
rs559654536 3593 dbSNP
rs756423010 3599 dbSNP
rs1462864242 3601 dbSNP
rs1220779661 3602 dbSNP
rs1265463324 3608 dbSNP
rs1340103409 3609 dbSNP
rs898359320 3609 dbSNP
rs1272448244 3611 dbSNP
rs1244336037 3613 dbSNP
rs1382693596 3626 dbSNP
rs994066329 3627 dbSNP
rs1005294542 3634 dbSNP
rs1026020163 3645 dbSNP
rs373443421 3648 dbSNP
rs906858655 3648 dbSNP
rs780662570 3651 dbSNP
rs1237185098 3655 dbSNP
rs563140882 3655 dbSNP
rs1457983677 3658 dbSNP
rs749729709 3661 dbSNP
rs976955467 3666 dbSNP
rs1231420367 3670 dbSNP
rs1179629010 3673 dbSNP
rs1204028263 3677 dbSNP
rs1002958755 3678 dbSNP
rs1410675375 3683 dbSNP
rs531711674 3687 dbSNP
rs1034061329 3692 dbSNP
rs1220317738 3699 dbSNP
rs146631224 3717 dbSNP
rs990921688 3721 dbSNP
rs1248649659 3724 dbSNP
rs1022407806 3726 dbSNP
rs1371556078 3726 dbSNP
rs1442571003 3727 dbSNP
rs1369074225 3752 dbSNP
rs967642171 3755 dbSNP
rs1329458868 3756 dbSNP
rs1423423706 3757 dbSNP
rs1366147145 3759 dbSNP
rs1165341779 3765 dbSNP
rs978312053 3766 dbSNP
rs1406895664 3770 dbSNP
rs1177568612 3779 dbSNP
rs1470670268 3783 dbSNP
rs1399806792 3799 dbSNP
rs924223250 3804 dbSNP
rs778421432 3807 dbSNP
rs1197398263 3814 dbSNP
rs1333069368 3815 dbSNP
rs1490191992 3819 dbSNP
rs747596065 3821 dbSNP
rs957433681 3822 dbSNP
rs1225281684 3824 dbSNP
rs373940019 3830 dbSNP
rs750926566 3836 dbSNP
rs771712828 3844 dbSNP
rs772844215 3851 dbSNP
rs915999819 3855 dbSNP
rs1224664254 3856 dbSNP
rs955368871 3857 dbSNP
rs1056914716 3863 dbSNP
rs1403824215 3864 dbSNP
rs947843712 3870 dbSNP
rs760572636 3875 dbSNP
rs1046239678 3880 dbSNP
rs1323503149 3881 dbSNP
rs1304888551 3890 dbSNP
rs927845845 3890 dbSNP
rs929925128 3891 dbSNP
rs1046707982 3899 dbSNP
rs1344522755 3905 dbSNP
rs141262001 3907 dbSNP
rs756646817 3908 dbSNP
rs1402187779 3910 dbSNP
rs533899887 3912 dbSNP
rs1318133342 3920 dbSNP
rs1174469919 3925 dbSNP
rs1480152855 3928 dbSNP
rs1200177452 3932 dbSNP
rs547409840 3957 dbSNP
rs1201666546 3958 dbSNP
rs1234912760 3963 dbSNP
rs1038487345 3966 dbSNP
rs1181720747 3967 dbSNP
rs770609264 3968 dbSNP
rs1222452775 3971 dbSNP
rs1323807634 3976 dbSNP
rs144987615 3977 dbSNP
rs1168582630 3980 dbSNP
rs1046939597 3987 dbSNP
rs1289323495 3989 dbSNP
rs138788341 3992 dbSNP
rs1403545010 3994 dbSNP
rs1423043983 3995 dbSNP
rs1466291944 4000 dbSNP
rs1430216735 4004 dbSNP
rs759422691 4008 dbSNP
rs1016771866 4010 dbSNP
rs899594557 4013 dbSNP
rs1426772000 4014 dbSNP
rs1419451918 4019 dbSNP
rs1187556560 4037 dbSNP
rs1451728285 4038 dbSNP
rs1241760666 4039 dbSNP
rs1002520906 4041 dbSNP
rs1461532185 4047 dbSNP
rs1264571363 4050 dbSNP
rs1172822347 4052 dbSNP
rs1186692231 4052 dbSNP
rs1306350798 4054 dbSNP
rs998738455 4059 dbSNP
rs1216325942 4063 dbSNP
rs1055883255 4065 dbSNP
rs1357141683 4068 dbSNP
rs1453058212 4069 dbSNP
rs1029854855 4071 dbSNP
rs967609347 4072 dbSNP
rs894176389 4076 dbSNP
rs1353943762 4083 dbSNP
rs1171221983 4089 dbSNP
rs1451942262 4089 dbSNP
rs1383908180 4090 dbSNP
rs1183411974 4092 dbSNP
rs879199925 4094 dbSNP
rs1303276209 4096 dbSNP
rs1381231619 4098 dbSNP
rs1480102378 4119 dbSNP
rs1251442273 4120 dbSNP
rs1398117676 4121 dbSNP
rs1276977903 4122 dbSNP
rs999140577 4132 dbSNP
rs1318029157 4137 dbSNP
rs1246469225 4141 dbSNP
rs1033009544 4142 dbSNP
rs1220031569 4145 dbSNP
rs1021369640 4151 dbSNP
rs968179272 4152 dbSNP
rs1431675530 4154 dbSNP
rs1311319161 4156 dbSNP
rs765171577 4167 dbSNP
rs1425690437 4173 dbSNP
rs1370626185 4178 dbSNP
rs1256993086 4183 dbSNP
rs1486916682 4188 dbSNP
rs1250754043 4189 dbSNP
rs188559726 4190 dbSNP
rs955826706 4200 dbSNP
rs541524967 4201 dbSNP
rs1223049418 4203 dbSNP
rs987098318 4205 dbSNP
rs1188422366 4208 dbSNP
rs531680272 4209 dbSNP
rs191747037 4210 dbSNP
rs982332936 4214 dbSNP
rs964078630 4223 dbSNP
rs1302620672 4239 dbSNP
rs1377079623 4245 dbSNP
rs1417733592 4249 dbSNP
rs148956903 4253 dbSNP
rs753801640 4255 dbSNP
rs574605490 4265 dbSNP
rs79813225 4267 dbSNP
rs1479174006 4271 dbSNP
rs928542886 4274 dbSNP
rs1199495981 4280 dbSNP
rs542201395 4281 dbSNP
rs1055741206 4288 dbSNP
rs894143601 4291 dbSNP
rs760604157 4292 dbSNP
rs1219477443 4296 dbSNP
rs756545143 4302 dbSNP
rs1269008968 4307 dbSNP
rs1230534690 4308 dbSNP
rs1011230640 4334 dbSNP
rs940996451 4350 dbSNP
rs1039390019 4351 dbSNP
rs1302354966 4352 dbSNP
rs1316794491 4357 dbSNP
rs1382024148 4360 dbSNP
rs1350518124 4366 dbSNP
rs1423571390 4366 dbSNP
rs899562989 4367 dbSNP
rs902944122 4368 dbSNP
rs997976613 4369 dbSNP
rs1176579420 4372 dbSNP
rs1478704439 4379 dbSNP
rs1218016380 4380 dbSNP
rs1245102254 4395 dbSNP
rs780316356 4400 dbSNP
rs903389629 4403 dbSNP
rs1192021126 4406 dbSNP
rs1031572674 4408 dbSNP
rs1249719846 4409 dbSNP
rs1460181848 4415 dbSNP
rs1396601470 4416 dbSNP
rs1201128946 4420 dbSNP
rs1347144791 4421 dbSNP
rs1437600361 4425 dbSNP
rs754186408 4428 dbSNP
rs955590825 4429 dbSNP
rs1033227778 4430 dbSNP
rs1366541777 4431 dbSNP
rs957618929 4431 dbSNP
rs1013307071 4432 dbSNP
rs140148560 4434 dbSNP
rs1320969173 4439 dbSNP
rs1450873817 4441 dbSNP
rs184293967 4443 dbSNP
rs1336929460 4446 dbSNP
rs1008893640 4450 dbSNP
rs186706035 4451 dbSNP
rs971881852 4458 dbSNP
rs562268950 4478 dbSNP
rs1391913965 4480 dbSNP
rs1181555354 4487 dbSNP
rs974070512 4488 dbSNP
rs1188427673 4492 dbSNP
rs981591051 4504 dbSNP
rs148039137 4508 dbSNP
rs1374279124 4513 dbSNP
rs951186479 4517 dbSNP
rs982592347 4522 dbSNP
rs1244268687 4526 dbSNP
rs982918460 4530 dbSNP
rs1382424958 4533 dbSNP
rs909779801 4539 dbSNP
rs1226012112 4540 dbSNP
rs1287758458 4541 dbSNP
rs1451123844 4544 dbSNP
rs113435941 4545 dbSNP
rs1372353881 4548 dbSNP
rs755457302 4550 dbSNP
rs961195581 4552 dbSNP
rs1423772961 4557 dbSNP
rs562921600 4561 dbSNP
rs1164768249 4562 dbSNP
rs1456656431 4569 dbSNP
rs1473926911 4570 dbSNP
rs933731952 4571 dbSNP
rs1181224174 4576 dbSNP
rs1380715285 4578 dbSNP
rs1483397514 4594 dbSNP
rs1254617505 4601 dbSNP
rs747720488 4602 dbSNP
rs562062919 4614 dbSNP
rs141722753 4616 dbSNP
rs542036821 4617 dbSNP
rs150175833 4624 dbSNP
rs1278541238 4629 dbSNP
rs191319055 4632 dbSNP
rs36097393 4649 dbSNP
rs893359393 4651 dbSNP
rs1351726550 4652 dbSNP
rs934386079 4655 dbSNP
rs1013195358 4657 dbSNP
rs1350376778 4661 dbSNP
rs1325327994 4666 dbSNP
rs1398701689 4667 dbSNP
rs750172036 4668 dbSNP
rs1331054012 4673 dbSNP
rs1051561163 4674 dbSNP
rs891281264 4675 dbSNP
rs1414350941 4679 dbSNP
rs1008402052 4680 dbSNP
rs547346455 4683 dbSNP
rs1490340422 4685 dbSNP
rs1023386028 4687 dbSNP
rs1282948255 4688 dbSNP
rs116706309 4689 dbSNP
rs1228700377 4690 dbSNP
rs1003295182 4691 dbSNP
rs1280868831 4700 dbSNP
rs1026329694 4701 dbSNP
rs1026976472 4706 dbSNP
rs950821624 4707 dbSNP
rs982561275 4708 dbSNP
rs1016752930 4711 dbSNP
rs1344319856 4716 dbSNP
rs962940703 4718 dbSNP
rs138917247 4721 dbSNP
rs1458007301 4725 dbSNP
rs1391062605 4742 dbSNP
rs983271924 4743 dbSNP
rs746609325 4745 dbSNP
rs1432615687 4749 dbSNP
rs1440131650 4758 dbSNP
rs564443243 4761 dbSNP
rs369025674 4762 dbSNP
rs1474710563 4766 dbSNP
rs960109250 4789 dbSNP
rs933637651 4798 dbSNP
rs1185224218 4800 dbSNP
rs1209727829 4803 dbSNP
rs1466007389 4807 dbSNP
rs991286270 4813 dbSNP
rs1202512526 4816 dbSNP
rs915806263 4819 dbSNP
rs947291980 4821 dbSNP
rs978671853 4822 dbSNP
rs1361153706 4830 dbSNP
rs1298110219 4831 dbSNP
rs1436953266 4831 dbSNP
rs924277494 4832 dbSNP
rs1473111773 4835 dbSNP
rs934377015 4844 dbSNP
rs1465610600 4847 dbSNP
rs1051913728 4856 dbSNP
rs890212510 4857 dbSNP
rs1464738536 4869 dbSNP
rs1408765809 4870 dbSNP
rs1390069252 4874 dbSNP
rs776311425 4876 dbSNP
rs1397578094 4881 dbSNP
rs1451668768 4886 dbSNP
rs1393498953 4891 dbSNP
rs1240904507 4892 dbSNP
rs1180855452 4897 dbSNP
rs1483372835 4898 dbSNP
rs924331681 4908 dbSNP
rs1332675819 4911 dbSNP
rs11549890 4916 dbSNP
rs142723175 4917 dbSNP
rs112415820 4920 dbSNP
rs184415322 4930 dbSNP
rs190478703 4934 dbSNP
rs182147908 4937 dbSNP
rs533911780 4938 dbSNP
rs1380134215 4939 dbSNP
rs1002806172 4944 dbSNP
rs1440049972 4945 dbSNP
rs185282089 4946 dbSNP
rs1036145131 4949 dbSNP
rs758223674 4952 dbSNP
rs1383835685 4958 dbSNP
rs1485936808 4958 dbSNP
rs1164509173 4966 dbSNP
rs769918807 4974 dbSNP
rs112246616 4975 dbSNP
rs375100325 4976 dbSNP
rs775557122 4980 dbSNP
rs968560385 4996 dbSNP
rs189107315 5006 dbSNP
rs997091993 5008 dbSNP
rs1290813073 5014 dbSNP
rs1489838388 5014 dbSNP
rs1028212612 5016 dbSNP
rs181151827 5036 dbSNP
rs1464276237 5046 dbSNP
rs368290421 5057 dbSNP
rs924559234 5069 dbSNP
rs955856778 5070 dbSNP
rs767676996 5073 dbSNP
rs778808641 5074 dbSNP
rs746691995 5079 dbSNP
rs1364234749 5080 dbSNP
rs987170318 5082 dbSNP
rs911600620 5089 dbSNP
rs1369845817 5090 dbSNP
rs986443988 5098 dbSNP
rs1401969503 5106 dbSNP
rs1472053672 5106 dbSNP
rs147353034 5114 dbSNP
rs750478643 5116 dbSNP
rs1315358963 5118 dbSNP
rs1359260180 5119 dbSNP
rs1412152671 5120 dbSNP
rs1399459325 5122 dbSNP
rs1183675673 5123 dbSNP
rs1224068786 5126 dbSNP
rs1489853248 5133 dbSNP
rs1210243891 5135 dbSNP
rs1266526214 5135 dbSNP
rs1296443546 5136 dbSNP
rs1038827819 5139 dbSNP
rs1267468525 5144 dbSNP
rs185343173 5148 dbSNP
rs1328747499 5149 dbSNP
rs1289107152 5153 dbSNP
rs931506433 5154 dbSNP
rs1344207441 5156 dbSNP
rs1273980484 5158 dbSNP
rs766569444 5164 dbSNP
rs1348346718 5178 dbSNP
rs1048646122 5180 dbSNP
rs1287482597 5185 dbSNP
rs1456416479 5197 dbSNP
rs887370164 5198 dbSNP
rs955764888 5203 dbSNP
rs989860901 5209 dbSNP
rs1160772653 5216 dbSNP
rs561955648 5220 dbSNP
rs914316898 5222 dbSNP
rs1479147066 5223 dbSNP
rs1212857399 5227 dbSNP
rs1199411340 5230 dbSNP
rs1004599202 5243 dbSNP
rs1434820788 5243 dbSNP
rs1057147129 5246 dbSNP
rs1464636128 5250 dbSNP
rs1283793293 5253 dbSNP
rs1210679785 5254 dbSNP
rs1342892327 5257 dbSNP
rs1255477718 5261 dbSNP
rs56215493 5264 dbSNP
rs754154379 5265 dbSNP
rs1295924499 5268 dbSNP
rs928885896 5274 dbSNP
rs755362200 5277 dbSNP
rs1047713717 5278 dbSNP
rs1467785420 5283 dbSNP
rs777506855 5288 dbSNP
rs1172648582 5289 dbSNP
rs968489101 5291 dbSNP
rs1371241363 5293 dbSNP
rs1187737203 5295 dbSNP
rs1449780726 5307 dbSNP
rs999985853 5310 dbSNP
rs1197738773 5313 dbSNP
rs1440908533 5315 dbSNP
rs886482929 5318 dbSNP
rs765788262 5319 dbSNP
rs1037755932 5321 dbSNP
rs987821102 5322 dbSNP
rs1347779928 5324 dbSNP
rs1273058366 5329 dbSNP
rs911545184 5329 dbSNP
rs753177241 5332 dbSNP
rs546887938 5333 dbSNP
rs1445441114 5335 dbSNP
rs1339474871 5339 dbSNP
rs1334294236 5359 dbSNP
rs777294697 5365 dbSNP
rs541541506 5375 dbSNP
rs566776598 5381 dbSNP
rs1289480165 5390 dbSNP
rs1430319510 5391 dbSNP
rs1387267401 5394 dbSNP
rs1391859110 5394 dbSNP
rs996669116 5400 dbSNP
rs1368065259 5404 dbSNP
rs920352860 5407 dbSNP
rs931429801 5411 dbSNP
rs1372092425 5412 dbSNP
rs1236205522 5421 dbSNP
rs1048575267 5429 dbSNP
rs1028595882 5430 dbSNP
rs746479416 5431 dbSNP
rs1483663710 5433 dbSNP
rs1008180912 5437 dbSNP
rs1031337460 5439 dbSNP
rs1352859428 5444 dbSNP
rs955659151 5446 dbSNP
rs1057514255 5447 dbSNP
rs535742539 5448 dbSNP
rs1284358821 5452 dbSNP
rs190155062 5466 dbSNP
rs1261910445 5470 dbSNP
rs1348152210 5476 dbSNP
rs1306871673 5478 dbSNP
rs895812664 5479 dbSNP
rs1372307524 5490 dbSNP
rs1321367966 5491 dbSNP
rs1208794348 5500 dbSNP
rs533323460 5503 dbSNP
rs1044420273 5505 dbSNP
rs1181506782 5507 dbSNP
rs1473230887 5507 dbSNP
rs768359396 5507 dbSNP
rs904631635 5507 dbSNP
rs1254527791 5508 dbSNP
rs1219835115 5512 dbSNP
rs999954732 5514 dbSNP
rs1291024662 5515 dbSNP
rs1211338919 5516 dbSNP
rs1195854070 5517 dbSNP
rs1031488347 5518 dbSNP
rs1378882179 5520 dbSNP
rs34458561 5521 dbSNP
rs1287218833 5527 dbSNP
rs891645719 5527 dbSNP
rs1272933415 5530 dbSNP
rs1352291324 5530 dbSNP
rs1350309481 5534 dbSNP
rs1418958765 5534 dbSNP
rs780817655 5541 dbSNP
rs1463246285 5544 dbSNP
rs1008814470 5548 dbSNP
rs1456454752 5551 dbSNP
rs549308161 5554 dbSNP
rs964342040 5560 dbSNP
rs1443435978 5563 dbSNP
rs1414860786 5577 dbSNP
rs1190041975 5578 dbSNP
rs1247699856 5580 dbSNP
rs1477987296 5580 dbSNP
rs1201435755 5582 dbSNP
rs776213938 5592 dbSNP
rs1328999013 5599 dbSNP
rs1208816360 5600 dbSNP
rs1330533143 5601 dbSNP
rs1275878437 5613 dbSNP
rs1218641215 5621 dbSNP
rs371257586 5628 dbSNP
rs1368175434 5630 dbSNP
rs1391830477 5641 dbSNP
rs1432568657 5642 dbSNP
rs1309052179 5650 dbSNP
rs1319915018 5653 dbSNP
rs970235887 5660 dbSNP
rs1027383369 5662 dbSNP
rs951788909 5663 dbSNP
rs980282198 5675 dbSNP
rs1414450739 5681 dbSNP
rs928830954 5687 dbSNP
rs1447974324 5689 dbSNP
rs938935854 5690 dbSNP
rs940216604 5692 dbSNP
rs567703146 5694 dbSNP
rs1235282561 5705 dbSNP
rs908141853 5709 dbSNP
rs942006444 5715 dbSNP
rs180696818 5719 dbSNP
rs1236671907 5720 dbSNP
rs548393239 5721 dbSNP
rs568306398 5724 dbSNP
rs745708505 5727 dbSNP
rs996692052 5729 dbSNP
rs185962062 5730 dbSNP
rs936080704 5738 dbSNP
rs745369775 5743 dbSNP
rs891002700 5752 dbSNP
rs1008073172 5753 dbSNP
rs1360256857 5754 dbSNP
rs1315287343 5755 dbSNP
rs1428367321 5762 dbSNP
rs1422633634 5769 dbSNP
rs35143785 5772 dbSNP
rs982546740 5772 dbSNP
rs891620775 5784 dbSNP
rs926643130 5785 dbSNP
rs547507611 5786 dbSNP
rs570471498 5790 dbSNP
rs1180803109 5791 dbSNP
rs1168798182 5803 dbSNP
rs1483250341 5805 dbSNP
rs769692572 5817 dbSNP
rs79202900 5818 dbSNP
rs1275151917 5819 dbSNP
rs775610190 5820 dbSNP
rs1011225823 5821 dbSNP
rs1230281920 5825 dbSNP
rs1399925818 5825 dbSNP
rs1462291885 5829 dbSNP
rs1299716533 5833 dbSNP
rs1376841639 5835 dbSNP
rs1021738126 5840 dbSNP
rs1380052682 5841 dbSNP
rs539393985 5847 dbSNP
rs1293312974 5851 dbSNP
rs1356834339 5855 dbSNP
rs1408580152 5857 dbSNP
rs995813793 5857 dbSNP
rs1257030496 5858 dbSNP
rs1027310894 5861 dbSNP
rs749271920 5862 dbSNP
rs1163558210 5865 dbSNP
rs983212674 5865 dbSNP
rs1253493074 5868 dbSNP
rs1424028523 5870 dbSNP
rs775768528 5879 dbSNP
rs1035448991 5882 dbSNP
rs775018747 5883 dbSNP
rs1487350894 5888 dbSNP
rs1187897744 5892 dbSNP
rs960163393 5896 dbSNP
rs528895409 5899 dbSNP
rs547059719 5900 dbSNP
rs1419046615 5903 dbSNP
rs983596446 5904 dbSNP
rs1350442490 5909 dbSNP
rs993423703 5911 dbSNP
rs908109185 5914 dbSNP
rs1365999000 5918 dbSNP
rs555890366 5919 dbSNP
rs111789770 5928 dbSNP
rs1357233575 5932 dbSNP
rs973415542 5941 dbSNP
rs1396162844 5943 dbSNP
rs1313416491 5945 dbSNP
rs980343260 5950 dbSNP
rs925951602 5952 dbSNP
rs1377275363 5956 dbSNP
rs1397579425 5958 dbSNP
rs936035742 5958 dbSNP
rs1431363731 5963 dbSNP
rs575788239 5965 dbSNP
rs1053177900 5967 dbSNP
rs1191533371 5970 dbSNP
rs772569104 5974 dbSNP
rs1275234607 5976 dbSNP
rs1471362777 5978 dbSNP
rs761024411 5983 dbSNP
rs1261369557 5989 dbSNP
rs576289118 5991 dbSNP
rs1310937078 5996 dbSNP
rs1301047026 6002 dbSNP
rs913311561 6003 dbSNP
rs1178076696 6006 dbSNP
rs944534184 6011 dbSNP
rs1318054077 6014 dbSNP
rs754000525 6019 dbSNP
rs1040245002 6022 dbSNP
rs932081199 6025 dbSNP
rs1215994654 6027 dbSNP
rs900366731 6035 dbSNP