miRTarBase - #MIRT726902 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol POU2AF1   
Synonyms BOB1, OBF-1, OBF1, OCAB
Description POU class 2 associating factor 1
Transcript NM_006235   
Expression
Putative miRNA Targets on POU2AF1
3'UTR of POU2AF1
(miRNA target sites are highlighted)
>POU2AF1|NM_006235|3'UTR
   1 GCGTGGCTCCCACCTGAGTCCTGTTCCCTGAAACTGGGATTTTAAAATGAGCCTGGAATTGAGCCCCAGGTTCATGCTTG
  81 TTTGGAGTAGTCATTTCATGACTACACTTTCTACGCACAGCTAGAATTGTAGACCTGTAAACCTTCCTTCCCTTCTTCCT
 161 TCCCCTCCCTCCCTCACTTCCTCCCTCTCCCCCATCCTTCCATTCTTCCCCTCCCTCCCTTCTTCCTTTCCAACCCCTTC
 241 CTTCCTTTTCCTCCCTCCCTTCCTTCCCTCCTTCCCTTCTCCCTTTCCAACCCCTTCCTTCCTTTTCCTCCCTCCCTTCC
 321 TTCCCTCCTTCCCTTCTCCCTTTCCTTCTTTACCTCCCTCCCTCCCTCGCTTCTTCTCTCTTTCTTACTTCTTTTTTCAA
 401 TTCTGTTCCATTTTGGGAGGTAATTATAGGGATTTTAGCAATAACATTTTATGTCAAATGTTGCCAAGTCTGTGGTCCAT
 481 GGGCTTTCATTTCTGTCACATTTCATTTCTTGGAAAAGGCCTCCTTCCTCCAGTGCCTGCTGAACCATCTTAGGGTCACT
 561 CACACCCTCTGTAATTTTAAGATGTATGTGGTGGCCGGCGGGAAGACCAGCCCCGACAGCACCTCCTGAGAAAGTCAGCC
 641 AAGGGCCTACCCTGATGCCAGAGTCCTTGAGCTGTCAGTTCCCACAGTTGCTCCTTTGTTTGCTCTTCTCAGCCTCGGCC
 721 AGATTTACAGTCCAGGCAGCAAAATCTCAAGGCCTGGGGCTCAGAGTAGTAAGGGGTGGGAAGTGGGTGGCAGGGAGAAA
 801 AGAACATCAGGGTGGGTGGGGACAGGCCAGTGACGAAGAGAGGGACAGAGGAGGGATGGGAACAGGCTGTGCATCTTAGT
 881 TGGAGAGAGGGGTGTGGGAGGAAGCTTGAGTTTGATGCAGGGAGGAGGAAGGCTGAGGAATGACTTGGCTCCAGATTACT
 961 TGGTTATTAAGAAGAACAATAAACTAAAGGAAAGCATTGCTTGAAGAGATGGTTTTGCTGCTCTCCTTGAGGATACGTGC
1041 AAGGGAAGTTGGGCTGTTGTAAACAGGGTGAAGGGTGTGTTTGGTCGGCCATTTCTGTCTCACCTCTAGGCCCTCTGCTG
1121 GTGCTGTGGAGGCCAAGACCCCATTAAGCCTAAAGGTGATGGGTCCTCGCCTAGGCTTAGTGCTACCATGTGGGTTTTGT
1201 TTCTTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCTTTCCTTCCTTCC
1281 TTCCTTCCTTCCTTCCTCTCTCTTTCTTTCTTTTTTTTGGTTTTTTTTGGGACGGAGTCTCACTCCATTGCCCAGGCTGG
1361 AGTACAATGGTGCGATCTTGGCTCACTGCACCTCTGTCTCCCAAGTTCAAGTGATTCTCCTGCCTGAGCCTCCCGAGTAG
1441 CTGGGATTACAGGTGCATGCCACCATGCCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTTGGCCAG
1521 GCTGGTCTCGAACTCCTGACCTTGTGATCCGCCCGCCTCAGCCTCTCAGAGTGCTGGGATCACAGGCGTGAGCCACCGCA
1601 CCCAGCCTTTTACCATGTGGGTTTCTTTAGTGTCTTAAAAGCGTCCATAAGCCACCATTCTGTGGAACCAAGGCCCCCTC
1681 CACGCAAACACCCTCCCTCCTGGGGACCTCTGGAGCCTCAGCCAGAAGTACCATTAGGTTTAATTTTAATTTGTTTTGCT
1761 GGAGAAACATCAGGTTTGTAGGAGACTGAGTTGTTAGCAGGTGTGCTTAGCTCTTGATAGTGAACGTGTACCTTGGGAAC
1841 TGGCTCACCCACCTGCTAATAGCACCATCGTCACTATTAAGCAGACATTTCAGTTGGTAGAATCCATGTAGAAGTCATGG
1921 ACTTTTCTGGGAAATGACTTTTCTGGGAAATGACAGTTTCTTTGACATATTTTCTTTGCCCACTTTAAATAAAAACTCTG
2001 GAGAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |:|: :|| | ||||||| 
Target 5' aagAGATGGTT-T-TGCTGCTc 3'
1004 - 1023 149.00 -10.60
2
miRNA  3' guGUU-UGGU--AAUAC-----ACGACGau 5'
            ||| | ||  |||||     ||:|||  
Target 5' agCAATAACATTTTATGTCAAATGTTGCca 3'
437 - 466 122.00 -8.70
3
miRNA  3' guGUUUGGUAAU-----ACACGA--CGAu 5'
            ::|::::|||     ||||||  ||| 
Target 5' acTGAGTTGTTAGCAGGTGTGCTTAGCTc 3'
1785 - 1813 120.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30116496 3 COSMIC
COSN30163688 13 COSMIC
COSN31505543 28 COSMIC
COSN26989947 35 COSMIC
COSN26989944 36 COSMIC
COSN30538971 38 COSMIC
COSN24303871 40 COSMIC
COSN30193192 53 COSMIC
COSN26554152 73 COSMIC
COSN30760012 97 COSMIC
COSN28740238 111 COSMIC
COSN30100594 111 COSMIC
COSN20077242 115 COSMIC
COSN28523955 202 COSMIC
COSN26254560 265 COSMIC
COSN26372029 272 COSMIC
COSN9030053 281 COSMIC
COSN30105016 350 COSMIC
COSN5894765 523 COSMIC
COSN25701011 550 COSMIC
COSN25721711 777 COSMIC
COSN20092426 893 COSMIC
COSN26051805 927 COSMIC
COSN32064073 1168 COSMIC
COSN15596788 1260 COSMIC
COSN23897426 1264 COSMIC
COSN28932578 1268 COSMIC
COSN26329884 1304 COSMIC
COSN22243391 1435 COSMIC
COSN6985232 1543 COSMIC
rs12417556 1541 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1224056135 2 dbSNP
rs754227419 3 dbSNP
rs764646023 6 dbSNP
rs1308722974 7 dbSNP
rs1205466083 9 dbSNP
rs1344695906 12 dbSNP
rs376007107 15 dbSNP
rs1398528614 16 dbSNP
rs896057457 17 dbSNP
rs767549504 23 dbSNP
rs1368908151 24 dbSNP
rs374236313 26 dbSNP
rs1458834285 27 dbSNP
rs35577660 29 dbSNP
rs1160555492 37 dbSNP
rs1403114341 42 dbSNP
rs1161459332 49 dbSNP
rs762712399 51 dbSNP
rs1207513016 56 dbSNP
rs1025718722 68 dbSNP
rs571649581 74 dbSNP
rs550344568 75 dbSNP
rs965367000 78 dbSNP
rs1018247874 79 dbSNP
rs1007066152 91 dbSNP
rs1229773255 92 dbSNP
rs1288414571 94 dbSNP
rs1355616289 100 dbSNP
rs1398692714 101 dbSNP
rs116351295 106 dbSNP
rs539159649 114 dbSNP
rs768085498 125 dbSNP
rs561477520 126 dbSNP
rs891968829 131 dbSNP
rs1056844980 139 dbSNP
rs1255504960 143 dbSNP
rs1181282590 144 dbSNP
rs1183054353 147 dbSNP
rs1048523834 152 dbSNP
rs1472116102 158 dbSNP
rs1165460547 159 dbSNP
rs1414998748 164 dbSNP
rs929743472 173 dbSNP
rs896871714 175 dbSNP
rs1486497146 176 dbSNP
rs1262964842 177 dbSNP
rs905499903 185 dbSNP
rs1339329080 190 dbSNP
rs1044074075 192 dbSNP
rs1285821381 193 dbSNP
rs1356792178 194 dbSNP
rs1316665975 196 dbSNP
rs1272191557 200 dbSNP
rs1484185390 202 dbSNP
rs1267177595 212 dbSNP
rs1233510474 213 dbSNP
rs569930907 215 dbSNP
rs1440718752 216 dbSNP
rs1190231151 222 dbSNP
rs550123689 224 dbSNP
rs1475367448 232 dbSNP
rs1167159159 236 dbSNP
rs1392384208 237 dbSNP
rs1431285444 245 dbSNP
rs941702273 255 dbSNP
rs1393724137 259 dbSNP
rs982549418 262 dbSNP
rs1335612717 265 dbSNP
rs55677441 272 dbSNP
rs1434249114 275 dbSNP
rs1295176409 278 dbSNP
rs12807432 281 dbSNP
rs1362604710 283 dbSNP
rs1229431584 287 dbSNP
rs943680413 288 dbSNP
rs1202309473 289 dbSNP
rs1256927380 290 dbSNP
rs1290537820 294 dbSNP
rs1187182687 297 dbSNP
rs1428436340 301 dbSNP
rs1387616854 307 dbSNP
rs1450414114 309 dbSNP
rs1165302501 314 dbSNP
rs1463211148 316 dbSNP
rs1188808831 318 dbSNP
rs1376780600 319 dbSNP
rs909124440 321 dbSNP
rs983806025 323 dbSNP
rs1402252255 326 dbSNP
rs1318396489 335 dbSNP
rs1456666512 335 dbSNP
rs1367103316 336 dbSNP
rs1435634883 338 dbSNP
rs1329617937 340 dbSNP
rs755900929 346 dbSNP
rs527997389 351 dbSNP
rs1164199513 352 dbSNP
rs560803919 354 dbSNP
rs1207402242 355 dbSNP
rs985411360 356 dbSNP
rs936562034 366 dbSNP
rs923099373 368 dbSNP
rs1264527935 369 dbSNP
rs188157878 369 dbSNP
rs1185282259 384 dbSNP
rs976839145 385 dbSNP
rs1464775608 391 dbSNP
rs1200495985 403 dbSNP
rs745792737 405 dbSNP
rs775139360 424 dbSNP
rs1156317527 426 dbSNP
rs1390824039 427 dbSNP
rs781332064 430 dbSNP
rs576455551 441 dbSNP
rs1388262706 442 dbSNP
rs967882048 445 dbSNP
rs184667768 447 dbSNP
rs1254037484 461 dbSNP
rs1215873728 468 dbSNP
rs117535785 479 dbSNP
rs1226721113 491 dbSNP
rs193082983 494 dbSNP
rs1010908587 504 dbSNP
rs891940319 509 dbSNP
rs1264082622 521 dbSNP
rs1034748677 525 dbSNP
rs1003073334 528 dbSNP
rs1269243456 530 dbSNP
rs1482518930 539 dbSNP
rs1001762211 563 dbSNP
rs888674840 567 dbSNP
rs1419632805 582 dbSNP
rs1027122569 584 dbSNP
rs1212747885 592 dbSNP
rs189188715 595 dbSNP
rs994260417 596 dbSNP
rs941667563 597 dbSNP
rs887447113 599 dbSNP
rs1370251190 600 dbSNP
rs1392614560 607 dbSNP
rs1309975489 610 dbSNP
rs896902112 613 dbSNP
rs183334145 614 dbSNP
rs943778493 615 dbSNP
rs79466577 617 dbSNP
rs1374852880 643 dbSNP
rs1246066732 656 dbSNP
rs889489814 657 dbSNP
rs1049407791 663 dbSNP
rs1482547516 664 dbSNP
rs929232425 675 dbSNP
rs1253374292 698 dbSNP
rs374236436 700 dbSNP
rs572134053 716 dbSNP
rs977928865 717 dbSNP
rs554065976 718 dbSNP
rs1164029083 719 dbSNP
rs1389281810 724 dbSNP
rs923099200 726 dbSNP
rs1195922513 727 dbSNP
rs1355196580 731 dbSNP
rs752826175 732 dbSNP
rs1301157293 737 dbSNP
rs943228635 738 dbSNP
rs917732816 746 dbSNP
rs1397094158 759 dbSNP
rs765501530 762 dbSNP
rs1340421536 763 dbSNP
rs1225743570 774 dbSNP
rs1276252868 775 dbSNP
rs755253882 776 dbSNP
rs992953156 783 dbSNP
rs960378741 784 dbSNP
rs1208886914 786 dbSNP
rs192227233 790 dbSNP
rs968652388 791 dbSNP
rs78415994 794 dbSNP
rs989051043 795 dbSNP
rs6589223 797 dbSNP
rs1035972000 798 dbSNP
rs1420568254 799 dbSNP
rs538346739 806 dbSNP
rs770664501 810 dbSNP
rs994825838 811 dbSNP
rs766739103 815 dbSNP
rs1304038365 819 dbSNP
rs1360925399 824 dbSNP
rs1470602229 825 dbSNP
rs1020188716 827 dbSNP
rs1320404686 830 dbSNP
rs140573641 834 dbSNP
rs1437806200 835 dbSNP
rs760995868 843 dbSNP
rs1362282123 851 dbSNP
rs1218246695 852 dbSNP
rs1300914891 859 dbSNP
rs1392197038 866 dbSNP
rs1313386150 871 dbSNP
rs1049437962 873 dbSNP
rs1204232227 889 dbSNP
rs1398827388 893 dbSNP
rs1267350213 896 dbSNP
rs1463480989 897 dbSNP
rs1296556377 900 dbSNP
rs1429136158 907 dbSNP
rs1022685225 913 dbSNP
rs1005977114 918 dbSNP
rs887425445 920 dbSNP
rs1376651660 925 dbSNP
rs1189644498 926 dbSNP
rs1000501184 937 dbSNP
rs1480767637 955 dbSNP
rs1158517705 956 dbSNP
rs1387165897 960 dbSNP
rs1459263694 965 dbSNP
rs903776671 968 dbSNP
rs1319438177 974 dbSNP
rs1349617948 976 dbSNP
rs549326787 977 dbSNP
rs1272654670 979 dbSNP
rs1346851994 994 dbSNP
rs1453041102 994 dbSNP
rs1287136619 995 dbSNP
rs575957947 996 dbSNP
rs1040331052 999 dbSNP
rs943172907 1000 dbSNP
rs910387990 1005 dbSNP
rs1219653164 1007 dbSNP
rs1419333032 1012 dbSNP
rs746758059 1023 dbSNP
rs945270796 1036 dbSNP
rs1490570560 1037 dbSNP
rs917779295 1043 dbSNP
rs1252164754 1044 dbSNP
rs1181611761 1046 dbSNP
rs947488292 1048 dbSNP
rs1473875872 1049 dbSNP
rs527920126 1064 dbSNP
rs914692757 1068 dbSNP
rs938792626 1069 dbSNP
rs927346896 1073 dbSNP
rs1159599779 1075 dbSNP
rs151169138 1078 dbSNP
rs1413537061 1082 dbSNP
rs1403885173 1083 dbSNP
rs1325934210 1086 dbSNP
rs1367107109 1091 dbSNP
rs989201738 1096 dbSNP
rs1306910755 1097 dbSNP
rs1348040887 1106 dbSNP
rs980073696 1107 dbSNP
rs1280000740 1112 dbSNP
rs1295950774 1114 dbSNP
rs1281034109 1119 dbSNP
rs1355555782 1127 dbSNP
rs1226457041 1129 dbSNP
rs1293641575 1132 dbSNP
rs956107342 1133 dbSNP
rs1212917717 1141 dbSNP
rs1249737317 1149 dbSNP
rs952754678 1152 dbSNP
rs928875196 1156 dbSNP
rs1342716491 1159 dbSNP
rs919920704 1160 dbSNP
rs973038780 1168 dbSNP
rs1239452907 1169 dbSNP
rs1337778526 1171 dbSNP
rs981696785 1173 dbSNP
rs552096430 1176 dbSNP
rs970171929 1179 dbSNP
rs1023156401 1187 dbSNP
rs1005944433 1192 dbSNP
rs866266252 1199 dbSNP
rs1328935572 1203 dbSNP
rs533434754 1203 dbSNP
rs7949774 1204 dbSNP
rs1315435016 1205 dbSNP
rs542966361 1208 dbSNP
rs1446511374 1215 dbSNP
rs1383192435 1216 dbSNP
rs867362914 1216 dbSNP
rs1272662667 1218 dbSNP
rs1000607638 1220 dbSNP
rs1159530674 1220 dbSNP
rs903547864 1221 dbSNP
rs1443379217 1225 dbSNP
rs575749416 1230 dbSNP
rs1042054870 1232 dbSNP
rs1009502437 1236 dbSNP
rs1190166651 1237 dbSNP
rs1182548103 1238 dbSNP
rs1387107436 1239 dbSNP
rs1455648254 1240 dbSNP
rs372231337 1240 dbSNP
rs1256375622 1243 dbSNP
rs1365223467 1244 dbSNP
rs370825947 1244 dbSNP
rs1199564399 1247 dbSNP
rs376428762 1248 dbSNP
rs926454254 1251 dbSNP
rs76426485 1252 dbSNP
rs1472011852 1254 dbSNP
rs1410302681 1255 dbSNP
rs1168029493 1256 dbSNP
rs1412706764 1256 dbSNP
rs866217614 1256 dbSNP
rs1257616157 1257 dbSNP
rs867536460 1258 dbSNP
rs867016668 1259 dbSNP
rs138762227 1260 dbSNP
rs1491517257 1260 dbSNP
rs1491098544 1261 dbSNP
rs1440662178 1263 dbSNP
rs1228378245 1264 dbSNP
rs58425211 1264 dbSNP
rs376505494 1266 dbSNP
rs1264382017 1267 dbSNP
rs1342890106 1267 dbSNP
rs1193388265 1268 dbSNP
rs1207283375 1268 dbSNP
rs1264262132 1268 dbSNP
rs1358694160 1268 dbSNP
rs1376585381 1268 dbSNP
rs1429958893 1268 dbSNP
rs1464833613 1268 dbSNP
rs1476717354 1268 dbSNP
rs7949746 1268 dbSNP
rs1255327836 1269 dbSNP
rs1205553378 1270 dbSNP
rs1352539082 1271 dbSNP
rs1491282660 1272 dbSNP
rs533490239 1272 dbSNP
rs868364828 1272 dbSNP
rs1491276410 1273 dbSNP
rs1228007493 1274 dbSNP
rs1225496504 1276 dbSNP
rs1227051220 1276 dbSNP
rs879190537 1276 dbSNP
rs1335634922 1277 dbSNP
rs1295229646 1278 dbSNP
rs1445848329 1279 dbSNP
rs145282012 1280 dbSNP
rs1486362804 1280 dbSNP
rs1491152846 1280 dbSNP
rs1491357522 1281 dbSNP
rs1319519102 1282 dbSNP
rs1384340665 1283 dbSNP
rs1201016790 1284 dbSNP
rs1386893308 1284 dbSNP
rs1429332249 1285 dbSNP
rs1158813967 1286 dbSNP
rs1472237824 1287 dbSNP
rs1365328172 1288 dbSNP
rs1456383103 1288 dbSNP
rs1418075265 1289 dbSNP
rs1166499307 1290 dbSNP
rs532262103 1291 dbSNP
rs1471511756 1292 dbSNP
rs1367863268 1293 dbSNP
rs1406963174 1295 dbSNP
rs1193808611 1296 dbSNP
rs1448582742 1297 dbSNP
rs1187817196 1298 dbSNP
rs1244589822 1298 dbSNP
rs1248020492 1298 dbSNP
rs1264024540 1298 dbSNP
rs1309695727 1298 dbSNP
rs1318042076 1298 dbSNP
rs1349892070 1298 dbSNP
rs1356875246 1298 dbSNP
rs1408546894 1298 dbSNP
rs973121429 1298 dbSNP
rs1245981624 1300 dbSNP
rs1163864297 1304 dbSNP
rs1207831337 1304 dbSNP
rs1419581952 1304 dbSNP
rs1383112779 1305 dbSNP
rs961665871 1306 dbSNP
rs1164384873 1307 dbSNP
rs1370029480 1319 dbSNP
rs993567299 1319 dbSNP
rs187016132 1320 dbSNP
rs901517176 1321 dbSNP
rs912774079 1327 dbSNP
rs1247723147 1329 dbSNP
rs1385367173 1329 dbSNP
rs117629020 1330 dbSNP
rs1007450551 1332 dbSNP
rs148482878 1333 dbSNP
rs778020947 1334 dbSNP
rs1442036952 1335 dbSNP
rs1480938289 1341 dbSNP
rs1043529298 1353 dbSNP
rs1394827092 1354 dbSNP
rs373530594 1360 dbSNP
rs538945332 1362 dbSNP
rs979197320 1373 dbSNP
rs563260616 1374 dbSNP
rs1426937711 1376 dbSNP
rs1476367390 1393 dbSNP
rs1355146418 1397 dbSNP
rs1465993259 1400 dbSNP
rs1335238326 1408 dbSNP
rs1388189563 1411 dbSNP
rs1453911463 1422 dbSNP
rs1020629617 1427 dbSNP
rs934621399 1429 dbSNP
rs1009613250 1430 dbSNP
rs1364064498 1434 dbSNP
rs1187749411 1435 dbSNP
rs1398726313 1454 dbSNP
rs1297132317 1455 dbSNP
rs1308647141 1456 dbSNP
rs556616777 1457 dbSNP
rs896405795 1459 dbSNP
rs1454524591 1466 dbSNP
rs1209337672 1468 dbSNP
rs11825875 1470 dbSNP
rs1002067959 1471 dbSNP
rs981665814 1473 dbSNP
rs1247149964 1484 dbSNP
rs905063977 1485 dbSNP
rs376028044 1490 dbSNP
rs1048863036 1491 dbSNP
rs182691807 1498 dbSNP
rs898559785 1499 dbSNP
rs1388807832 1501 dbSNP
rs1470574166 1510 dbSNP
rs549484667 1511 dbSNP
rs939978909 1529 dbSNP
rs912563947 1530 dbSNP
rs1340690490 1535 dbSNP
rs12417556 1541 dbSNP
rs1235529928 1549 dbSNP
rs932869430 1550 dbSNP
rs567092271 1551 dbSNP
rs1126884 1553 dbSNP
rs376831999 1554 dbSNP
rs1433873179 1555 dbSNP
rs1267282995 1558 dbSNP
rs1445001060 1561 dbSNP
rs1348874660 1566 dbSNP
rs773871828 1567 dbSNP
rs1328970433 1569 dbSNP
rs971843560 1570 dbSNP
rs768152431 1571 dbSNP
rs1197417972 1579 dbSNP
rs1271096007 1580 dbSNP
rs11213847 1581 dbSNP
rs1406242153 1585 dbSNP
rs540969032 1587 dbSNP
rs1021084025 1588 dbSNP
rs987904521 1592 dbSNP
rs1022209741 1593 dbSNP
rs571896302 1594 dbSNP
rs960685400 1596 dbSNP
rs1346793084 1597 dbSNP
rs775053279 1606 dbSNP
rs1405495313 1611 dbSNP
rs1278959075 1618 dbSNP
rs1348438913 1619 dbSNP
rs1002100859 1620 dbSNP
rs1321386088 1621 dbSNP
rs1220477459 1625 dbSNP
rs1294063139 1630 dbSNP
rs905095117 1642 dbSNP
rs769613656 1643 dbSNP
rs1181541693 1646 dbSNP
rs1231728406 1649 dbSNP
rs1189176412 1651 dbSNP
rs994597722 1653 dbSNP
rs1233619957 1655 dbSNP
rs745714530 1664 dbSNP
rs1178180713 1665 dbSNP
rs898585626 1669 dbSNP
rs1413472976 1672 dbSNP
rs190440023 1673 dbSNP
rs934778412 1678 dbSNP
rs1424813924 1679 dbSNP
rs907172912 1679 dbSNP
rs775391731 1681 dbSNP
rs538362100 1683 dbSNP
rs891141951 1684 dbSNP
rs1274636815 1685 dbSNP
rs1051079540 1690 dbSNP
rs1279951756 1696 dbSNP
rs932900286 1699 dbSNP
rs757276225 1700 dbSNP
rs1381702137 1715 dbSNP
rs1244066131 1717 dbSNP
rs1294302259 1725 dbSNP
rs1212211867 1734 dbSNP
rs921479598 1746 dbSNP
rs1204582240 1753 dbSNP
rs1350613262 1757 dbSNP
rs1270928342 1762 dbSNP
rs1276958122 1765 dbSNP
rs979598074 1766 dbSNP
rs531237435 1774 dbSNP
rs1237278330 1781 dbSNP
rs1443090237 1784 dbSNP
rs558747054 1789 dbSNP
rs1386758325 1803 dbSNP
rs916162542 1810 dbSNP
rs1279736977 1811 dbSNP
rs560721736 1811 dbSNP
rs1411194137 1825 dbSNP
rs985075276 1826 dbSNP
rs1411606201 1827 dbSNP
rs988324628 1831 dbSNP
rs1405253542 1840 dbSNP
rs1450252439 1846 dbSNP
rs1306809937 1856 dbSNP
rs919452105 1857 dbSNP
rs960469563 1860 dbSNP
rs1268514844 1862 dbSNP
rs185929147 1868 dbSNP
rs1341487663 1869 dbSNP
rs1215669473 1870 dbSNP
rs927638290 1873 dbSNP
rs1042752 1875 dbSNP
rs1415327314 1881 dbSNP
rs1360784722 1885 dbSNP
rs1244087919 1886 dbSNP
rs969286767 1891 dbSNP
rs1018675476 1896 dbSNP
rs1191957027 1899 dbSNP
rs12272263 1900 dbSNP
rs1370852333 1911 dbSNP
rs1476148890 1914 dbSNP
rs985759462 1921 dbSNP
rs1409043148 1934 dbSNP
rs953085647 1935 dbSNP
rs1468136106 1946 dbSNP
rs1471686401 1955 dbSNP
rs1251194722 1960 dbSNP
rs779169258 1962 dbSNP
rs1381874684 1966 dbSNP
rs994712198 1967 dbSNP
rs1328420181 1969 dbSNP
rs755056661 1977 dbSNP
rs1126886 1982 dbSNP
rs1010824019 1983 dbSNP
rs1014740115 1986 dbSNP
rs1225841531 1990 dbSNP
rs892269338 1990 dbSNP
rs1236203525 1997 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17306 Multiple myeloma -0.345 7.6e-3 -0.293 2.1e-2 49 Click to see details
GSE21032 Prostate cancer -0.254 1.0e-2 -0.216 2.5e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.513 1.0e-2 -0.592 3.0e-3 20 Click to see details
GSE21687 Ependynoma primary tumors 0.267 1.6e-2 0.184 7.3e-2 64 Click to see details
GSE19783 ER- ER- breast cancer -0.223 2.4e-2 -0.151 9.2e-2 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.393 2.6e-2 -0.320 5.9e-2 25 Click to see details
GSE19536 Breast cancer -0.148 7.1e-2 -0.093 1.8e-1 100 Click to see details
GSE32688 Pancreatic cancer 0.26 7.5e-2 0.026 4.4e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer 0.274 1.2e-1 0.259 1.4e-1 20 Click to see details
GSE38226 Liver fibrosis -0.261 1.3e-1 -0.237 1.5e-1 21 Click to see details
GSE14794 Lymphoblastoid cells -0.096 1.8e-1 -0.076 2.4e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.142 2.5e-1 0.253 1.1e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.212 2.5e-1 -0.161 3.1e-1 12 Click to see details
GSE28260 Renal cortex and medulla 0.2 2.6e-1 0.060 4.2e-1 13 Click to see details
GSE17498 Multiple myeloma 0.091 2.9e-1 -0.161 1.6e-1 40 Click to see details
GSE21849 B cell lymphoma 0.093 3.2e-1 0.045 4.1e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.123 3.2e-1 -0.185 2.5e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.072 3.7e-1 0.066 3.8e-1 24 Click to see details
GSE28544 Breast cancer 0.04 4.3e-1 -0.356 4.4e-2 24 Click to see details
GSE28544 Breast cancer 0.04 4.3e-1 -0.356 4.4e-2 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.382 0 0.331 0 68 Click to see details
STAD 0.483 0 0.475 0 32 Click to see details
KICH 0.374 0.03 0.329 0.05 25 Click to see details
BLCA 0.401 0.05 0.368 0.07 18 Click to see details
UCEC -0.382 0.05 -0.158 0.26 19 Click to see details
THCA 0.192 0.07 0.212 0.05 59 Click to see details
CESC -0.973 0.07 -1.000 0.5 3 Click to see details
PAAD 0.836 0.08 0.800 0.1 4 Click to see details
BRCA -0.106 0.17 -0.139 0.1 84 Click to see details
LIHC 0.125 0.2 0.167 0.13 49 Click to see details
ESCA -0.272 0.21 -0.364 0.14 11 Click to see details
LUAD -0.145 0.33 -0.091 0.39 12 Click to see details
KIRP 0.078 0.34 0.070 0.35 32 Click to see details
PCPG -0.489 0.34 -0.500 0.33 3 Click to see details
LUSC -0.057 0.37 0.018 0.46 38 Click to see details
PRAD -0.039 0.39 -0.027 0.43 50 Click to see details
HNSC -0.041 0.4 -0.035 0.41 42 Click to see details
CHOL -0.042 0.46 -0.083 0.42 9 Click to see details
COAD -0.045 0.46 -0.286 0.25 8 Click to see details
COAD -0.045 0.46 -0.286 0.25 8 Click to see details
COAD -0.045 0.46 -0.286 0.25 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*