miRTarBase - #MIRT726826 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAB11FIP2   
Synonyms Rab11-FIP2, nRip11
Description RAB11 family interacting protein 2
Transcript NM_014904   
Expression
Putative miRNA Targets on RAB11FIP2
3'UTR of RAB11FIP2
(miRNA target sites are highlighted)
>RAB11FIP2|NM_014904|3'UTR
   1 TAAAGCCAATTGTATTGTATTGATAATTGGACAAAGAGAGAGAAAGAAAGAAGGAAGGAAGGAAAAACTTGTTACTGAAA
  81 GAGACTACACTATCAGGTTTCATTACATATTCTCCTTTATTGTGAAGAGTAGTTTTACCTGTAAATATTAGCAGGGACTA
 161 TCAAGAGTGACCTTTGAAGCAAGCTAAATCATTTAAATGTTTAAATTGAAAATGGGCCAGATTCTCAATGAATAAGTGGT
 241 TCCTTAGGACTCACTCAGGTGCTGGTACTGACCCACTAATCTGCCATAGGCCCAGAAATATCTTCAGAAGTACGTGAGTT
 321 GTTCCTCAGGAATAGATTTTTCATAAAGCAGAATTGATCCTGTGGCTGGTTTCTCAGAAATCAGTTTGTAGAAATATTTA
 401 GCTTCAGGAATACTGCTCGTTATAAACACTACTAAAAAAACAGTTTATATTTTATATACACATATGTACATGAATATATA
 481 TATATTCATGTATCTTGTATATAAAATATAGGCATATACCTCATATATACATGTGTTTTTAGAACATTTAGAAACAATTG
 561 ATTGCCTCTAAAGTTAGGCTACCAATTTCTTGATTTGAAAATGTGTGTGCTCTATTGATGCAAGACAAGTCATCCTTCCT
 641 ACTGTCATGGTTTGTTATAGAGAAGCTGCTTCAAATCACTCTTGACTACATGGACCTTGGTTTCAAAGTGAGCTGCTATA
 721 TATTATTCTAGCATCAAAGTTTTTCTCTTTCCCCAAAAGTGATGATCTCAAGTCCTTTTTTAAAGAATGACAAATTTTAG
 801 GAGACTTCATTAACTTCATAACAGCATGAATTTATTTGAATTAATTAACATTTGAGTTTGTTTAAGGTATAAGCAGAAGA
 881 TAAGCTAATATAGCTTGTTTTGTTGAAATTCTGCATGCCTTTAAATCACTAGCAAAGCAAATATTATAAAGTTATATCTG
 961 AAAATAATTGTGGGAAGTATGTGATTGCCTGGTGTGTCTGATAACCCAAAGCAGCGGGCAGATTCCAGGAATGAAGAATT
1041 AGGCTTGGTTTCAGGTTACATAAATAATAGAGCAGATGGTTGCCTTTGGGTCTTGAACCAAAATAAGACTTACTAAAGGA
1121 AGAGTGAGTTTTTAGAAGAGAACTTTACGAGCGTGACATTATGCATTACTCCACATCCACCCTTTAAGAATTGATTTATT
1201 ACAAAATTATGTTCTATTTTAAAGTCCACTCCCCCAAAATACTGATTTCTTCCATGGATTATTTTTATATGATTTGTACA
1281 AATTTTTTCTGAAATTTAAATTGACAAGCAATGTTATAAAAATATTGCTAATCTTCTGCTTATTTTTCAGCCTTTAAAGT
1361 CTGAAATACTATAAAACACTGAGAGTATCTATGTCTTTCTGAATTTAAAATGAAAATTCATGTCCATATGGAGACTTACA
1441 TATTCCCCAATCTTTCCATGAATTGCATTTTTTTCTAATACTTATCTCTGTTAAGACTCCATTGAAAGTTAAACAAAAAG
1521 CCGATATAATAGTTTGGGTTTTTTTTTTTTGCTTATTTTAGTATTTTGAATCAGAGAATACTTGGCCAAGCTCGTATTTG
1601 TAAACTAAAACCCCTTGTTATTTGTATCTTCTGCATTTCAGTTTTACTGTAAGAACATACATTTTGAAATTATGAACATT
1681 TTTTTCATAAAAATTAAATGCTTTAAGAAATGGAGAAGGAAAAATAGCTTTTATCAATTTTTTTCTCCTCAAGATTCTGT
1761 AATAAACCTCAAAGTCTGGTGTAGAATGGTATTTTCCCGTTTGAGGTCTTGGTAGTTTTTTTTTTTTTTTTAAACATGGT
1841 GCCACTTTTAATTAACTAAATGTTACAAAATTCTCAGCATTTGTTTTTGTCTGGTAGTATTATTGAGTCTTTTCATACAC
1921 TTCTTAAAATGTGAAAATCTATGTTTTCAGTATTATGACAGTATCTGCAGATACTATAATAATATGCTTTGGCCAAATTT
2001 GCTGTTTATAGAGTGAACCAAGATGTCAGTTTTGTATTGGGGATATGTTTTACATAAATAGAACTCATTTAAAAGTATGG
2081 TTCAAGTACTGCTCTTCTTTTTATGGGGAAATTGATTTTTAAGGAGCGATTCTTTTCCTATATAAAAGCTATTGAGGCTT
2161 AGCTTTATTCATACATGAGTGATTTGGTTATAACTCAATCAAAATTTTTATCTTTAAATCTGAGACAAGTATTATATTTA
2241 AAACTAGATCTATTAATACATTCATCACTGCCTGAAAATTTGCTGTTCTAATGTTTGTGAATTTTCACTCATTACCTAGA
2321 GTAAACTTATTGCATATTTTCATAATCAGTCAAAATAATAAAACTAAAAACAAAAAGTAAAAATTAGTTCCCAAGTAAAT
2401 ATATCAGTGTTTCCTGTGTTTGGGCAGAAGTGCAAAGTAGTTTTAATTTCTCACGTTGTAGAAAAAGAGGCCAAAAAGGT
2481 CACCTTAGTTTATTTTTCCAAAACATAACTTTAGGTATTCTAATGTATTTTGTTAGTTGCTTAGAAATGGAAATAAAATA
2561 TATGTGCTTATTAAATAATGCACAGTACACTAGATTATAGAGTTTATTTTTGCTTTTATGCTTTAAAGAATGCATGCCCA
2641 AAACACTACTACCAACAAGAGGATTTTTTAAAATCACAGAATTGATATTTATCTCAAGACTATCTTAAGCTAATGTACTT
2721 CTGTTACATAATTAAACTATTTCTGCTATTATTTTTAAAGCAGTATTATTTTATAACCAATTCTAAAATTCAGCTTTAAA
2801 AATATTGAACATACCTTCCTACCACTTACGCTTCAAGTTTCATTTATTGAATACCAGGGTCATATCTTAGAATTGTATAT
2881 AAAACAACATGTAACCCATTCATGAAAAACGTTTTTAAGTATTGCTTTTTGCTGCTATGTTCTGCATTGAGCCTAGTTTT
2961 GCCATTGTCCCCTGAATGTAGTATTATCTATAGATTATACATAACTACATCTATTGCTTTTGGTGGTAAATCAAGATTTA
3041 GTTGTAATTTTCCAGCTGTGAAAATGTTGCCTTGTATTTAAAAGGGTTTCATGAATGGAAACCTAAGTAAAACTAAGCTC
3121 ATTAGTGACAGACTTGTTTTCTTCTTGTTATTCCTCCAGCAACTCCCTCACCACCACGCCTCCCTGCCTACCATCCCCGG
3201 AAGGGTGCTTATTCTTTAACAAAGAGAATCTAAAAAAAAAAACAAAAAACTGTTGTCTAATATATCTACAGTAAATGTTA
3281 CACTAGAGCTTTTATTTTCCTCTGTAGCTTTTCAGAAGAAGCAATTTACCTTGGATTTGTAAATCAAGCTGAAACTTTTT
3361 TGATGTTCATGTACTCATATGTCTTGTAGGTGGTAGGTGTCACTTGTGTGTATGTGTAAGTGAAGTATGATGCATGCTCA
3441 TTCACTTGGTCCCTTTGAAATAAGGGAAAGGATCACAGTGCTGCTGGGCCATGATGGTATGTAGAAGGGTCTGTCAGCAC
3521 ACATGGAAAGCCCCCATTTGCACAGATGTAGAACTTTAATAATCCAGATGCAATCATTGGAAGTATTTAATATGCAATTG
3601 GTAGCACCTTAGCTAATTAATCTGCATATGAAGCATTTTCTGATATATTTAATAAGAGGTATAGAAGCTCTTCAAGCATT
3681 AAAATAGAGTTGATGTTTCATTCCATTTGTTTTATCCATCAAAAAATGCACTCTCACAGTGGAGTTGAAGTCTAATACAT
3761 GATACATGTGGGCCTGTTAGTCTTCGAAGCTTCCAGATGGTTTGTGTTTTGAGGTACAAAAAAATGCTGCAGATCTAGAA
3841 ATGCATATATTTAGCGGGTATTTGAAAGATAGAAGCATTATTTATAACTGAAGAGTATAACACTTATCTTCTTAAGTAAA
3921 TGCTCTCATAACTTGTATACATTTTTGCAGGTACAAATTCAAAAGTATGTAAGCATTGTATAATGTGACAATTGTATAAT
4001 TTATGTAATCTGATGCATGAATCAGAATTTTTATATAATATATGATTATTGACTTATAGTTGATTAAAGTGTTTAAACTT
4081 AAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAU-ACACGACGAu 5'
             |||  || |  |||||||| 
Target 5' gggAAAGGATCACAGTGCTGCTg 3'
3464 - 3486 155.00 -15.10
2
miRNA  3' guguUUGGUAAU---ACACGACGAu 5'
              || :|||:   | ||||||| 
Target 5' ttttAAGTATTGCTTTTTGCTGCTa 3'
2913 - 2937 154.00 -11.40
3
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ::|||  || |||||:| 
Target 5' ctttGGCCA-AATTTGCTGTTt 3'
1987 - 2007 137.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28711428 2 COSMIC
COSN26557530 7 COSMIC
COSN30538451 37 COSMIC
COSN30147472 42 COSMIC
COSN30187334 87 COSMIC
COSN30525166 96 COSMIC
COSN31608125 395 COSMIC
COSN26098798 417 COSMIC
COSN27182323 474 COSMIC
COSN1113144 573 COSMIC
COSN15525633 747 COSMIC
COSN25170348 1018 COSMIC
COSN15775966 1401 COSMIC
COSN27410217 1538 COSMIC
COSN27589172 1539 COSMIC
COSN24459607 1551 COSMIC
COSN31960559 1594 COSMIC
COSN20107634 1815 COSMIC
COSN27254670 1816 COSMIC
COSN20426876 1848 COSMIC
COSN15444684 1874 COSMIC
COSN31608403 1923 COSMIC
COSN26361143 2116 COSMIC
COSN20092236 2229 COSMIC
COSN17182971 2406 COSMIC
COSN16812274 2521 COSMIC
COSN31536324 2648 COSMIC
COSN31548829 2690 COSMIC
COSN32064476 2791 COSMIC
COSN26637583 2855 COSMIC
COSN31566341 2935 COSMIC
COSN30173277 2974 COSMIC
COSN31533922 3000 COSMIC
COSN31590988 3011 COSMIC
COSN31603576 3030 COSMIC
COSN20972367 3051 COSMIC
COSN1473190 3054 COSMIC
COSN22785905 3084 COSMIC
COSN30174184 3144 COSMIC
COSN27506686 3231 COSMIC
COSN24607955 3337 COSMIC
COSN15661518 3513 COSMIC
COSN6943168 3568 COSMIC
COSN30544483 3654 COSMIC
COSN26507555 3734 COSMIC
COSN26632905 3785 COSMIC
COSN31515682 3991 COSMIC
COSN31611039 4009 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs984711362 5 dbSNP
rs775151951 6 dbSNP
rs1370189479 7 dbSNP
rs769785592 9 dbSNP
rs745793451 13 dbSNP
rs781332059 16 dbSNP
rs776524003 22 dbSNP
rs546472914 23 dbSNP
rs1040757111 27 dbSNP
rs757051160 31 dbSNP
rs7908553 34 dbSNP
rs1448370910 35 dbSNP
rs1285781196 36 dbSNP
rs746798761 38 dbSNP
rs1183493707 42 dbSNP
rs1405573820 44 dbSNP
rs777562130 44 dbSNP
rs779159784 44 dbSNP
rs753860050 45 dbSNP
rs567851154 49 dbSNP
rs766453493 50 dbSNP
rs542670754 53 dbSNP
rs1484113981 61 dbSNP
rs1253963312 65 dbSNP
rs1287242408 68 dbSNP
rs369304098 74 dbSNP
rs1356332380 76 dbSNP
rs1214667751 80 dbSNP
rs959072080 87 dbSNP
rs989663030 88 dbSNP
rs371280927 89 dbSNP
rs142307839 92 dbSNP
rs1258154666 98 dbSNP
rs1422025063 102 dbSNP
rs1003214922 106 dbSNP
rs1162884220 107 dbSNP
rs1290337549 113 dbSNP
rs534182745 122 dbSNP
rs1374274825 131 dbSNP
rs1421300603 136 dbSNP
rs902263630 141 dbSNP
rs1156381533 143 dbSNP
rs1359581325 148 dbSNP
rs1448110916 151 dbSNP
rs571711364 152 dbSNP
rs978656267 153 dbSNP
rs1395919355 165 dbSNP
rs1011170612 166 dbSNP
rs1310660058 167 dbSNP
rs1416786401 168 dbSNP
rs970874626 174 dbSNP
rs551857288 179 dbSNP
rs1313050339 186 dbSNP
rs1302626535 188 dbSNP
rs1212289910 203 dbSNP
rs753174396 205 dbSNP
rs1025462257 206 dbSNP
rs1347438641 228 dbSNP
rs538342763 232 dbSNP
rs111772380 236 dbSNP
rs932630661 237 dbSNP
rs1034284065 239 dbSNP
rs1441306084 242 dbSNP
rs901140266 251 dbSNP
rs1041066971 254 dbSNP
rs1455215268 269 dbSNP
rs888284133 282 dbSNP
rs940094063 284 dbSNP
rs548918582 301 dbSNP
rs1177835543 306 dbSNP
rs984290922 310 dbSNP
rs1253897969 313 dbSNP
rs866786300 314 dbSNP
rs1403172056 325 dbSNP
rs1444998348 333 dbSNP
rs1309041026 337 dbSNP
rs1368785154 343 dbSNP
rs931499045 346 dbSNP
rs1299478377 348 dbSNP
rs146996454 359 dbSNP
rs1477642674 363 dbSNP
rs1242526876 380 dbSNP
rs560165343 384 dbSNP
rs1328590980 386 dbSNP
rs1053967473 393 dbSNP
rs1459078169 396 dbSNP
rs1196497031 397 dbSNP
rs1247338482 401 dbSNP
rs1232055199 402 dbSNP
rs1478247263 404 dbSNP
rs936905610 410 dbSNP
rs190368089 416 dbSNP
rs1320141999 418 dbSNP
rs1312518442 419 dbSNP
rs960290822 423 dbSNP
rs1170830762 425 dbSNP
rs1383144939 428 dbSNP
rs924185324 433 dbSNP
rs1444940418 436 dbSNP
rs1439055042 439 dbSNP
rs1291992014 440 dbSNP
rs1219306882 441 dbSNP
rs978307653 441 dbSNP
rs1034608654 442 dbSNP
rs1367741156 447 dbSNP
rs1316180569 460 dbSNP
rs971289759 462 dbSNP
rs918019991 463 dbSNP
rs1451901881 464 dbSNP
rs1223579420 465 dbSNP
rs1434936607 466 dbSNP
rs780817267 470 dbSNP
rs1490095816 478 dbSNP
rs1387346180 482 dbSNP
rs550683502 486 dbSNP
rs758666889 486 dbSNP
rs990876727 486 dbSNP
rs763571719 487 dbSNP
rs966458691 488 dbSNP
rs546535426 496 dbSNP
rs1163574886 497 dbSNP
rs1407419935 498 dbSNP
rs185074706 499 dbSNP
rs1249594537 501 dbSNP
rs952700916 508 dbSNP
rs1186612555 509 dbSNP
rs1300310873 509 dbSNP
rs1269518313 510 dbSNP
rs1357039765 512 dbSNP
rs779067380 518 dbSNP
rs1464379097 525 dbSNP
rs1287419521 531 dbSNP
rs1358493055 532 dbSNP
rs893663727 533 dbSNP
rs1025966496 544 dbSNP
rs1028167606 545 dbSNP
rs994046950 552 dbSNP
rs1253784060 556 dbSNP
rs996726918 558 dbSNP
rs1211687445 560 dbSNP
rs901105920 577 dbSNP
rs41302717 578 dbSNP
rs543876149 579 dbSNP
rs1474084058 584 dbSNP
rs1180660458 585 dbSNP
rs1384952146 586 dbSNP
rs753799499 588 dbSNP
rs887178864 592 dbSNP
rs1400181238 603 dbSNP
rs766965944 614 dbSNP
rs1048997830 617 dbSNP
rs1006557155 619 dbSNP
rs889458836 620 dbSNP
rs41308655 629 dbSNP
rs374015670 637 dbSNP
rs1240681948 638 dbSNP
rs1287697560 642 dbSNP
rs1351114033 643 dbSNP
rs1204001377 647 dbSNP
rs1278670093 649 dbSNP
rs1055893726 650 dbSNP
rs1443666925 656 dbSNP
rs561857977 657 dbSNP
rs142424463 658 dbSNP
rs1440695780 670 dbSNP
rs949595313 671 dbSNP
rs918048727 678 dbSNP
rs990909350 681 dbSNP
rs981788984 686 dbSNP
rs938109480 691 dbSNP
rs574223151 718 dbSNP
rs1334598508 719 dbSNP
rs913642389 720 dbSNP
rs1447215114 722 dbSNP
rs1300599756 738 dbSNP
rs1333800762 749 dbSNP
rs1237821815 760 dbSNP
rs1275089791 777 dbSNP
rs984815438 787 dbSNP
rs1387902671 801 dbSNP
rs1263048401 805 dbSNP
rs950766076 821 dbSNP
rs1462129832 822 dbSNP
rs182588892 833 dbSNP
rs1166483377 839 dbSNP
rs957814945 840 dbSNP
rs965244316 849 dbSNP
rs1395633196 854 dbSNP
rs1379656258 857 dbSNP
rs1200858968 863 dbSNP
rs1019373263 864 dbSNP
rs534503076 867 dbSNP
rs996694044 874 dbSNP
rs1466037327 880 dbSNP
rs770126940 881 dbSNP
rs1333312463 885 dbSNP
rs1393996876 891 dbSNP
rs1390615798 902 dbSNP
rs1266686672 913 dbSNP
rs1332520912 914 dbSNP
rs1006671756 915 dbSNP
rs1282135553 939 dbSNP
rs1220937050 944 dbSNP
rs1250133363 946 dbSNP
rs1480508015 948 dbSNP
rs189283042 948 dbSNP
rs1196659278 952 dbSNP
rs1484156093 953 dbSNP
rs1019566094 954 dbSNP
rs1210868656 955 dbSNP
rs1269704972 961 dbSNP
rs1489931821 973 dbSNP
rs1272984590 977 dbSNP
rs889554621 979 dbSNP
rs1004216395 988 dbSNP
rs1172653772 992 dbSNP
rs1371334891 994 dbSNP
rs1348990079 998 dbSNP
rs1163676021 1000 dbSNP
rs558202982 1003 dbSNP
rs3740550 1005 dbSNP
rs1328863386 1013 dbSNP
rs761856921 1015 dbSNP
rs894582217 1016 dbSNP
rs949632243 1017 dbSNP
rs370289737 1018 dbSNP
rs1294042026 1030 dbSNP
rs1371991781 1064 dbSNP
rs762223035 1065 dbSNP
rs938882174 1070 dbSNP
rs117083662 1077 dbSNP
rs1357766848 1079 dbSNP
rs1221953995 1092 dbSNP
rs1287020440 1109 dbSNP
rs535286947 1113 dbSNP
rs566698397 1128 dbSNP
rs565076276 1131 dbSNP
rs1174258572 1137 dbSNP
rs543123695 1146 dbSNP
rs73408747 1148 dbSNP
rs913519050 1149 dbSNP
rs985253776 1152 dbSNP
rs929341391 1153 dbSNP
rs989179660 1161 dbSNP
rs533079979 1165 dbSNP
rs1422518636 1173 dbSNP
rs1162532311 1181 dbSNP
rs563705402 1188 dbSNP
rs921041517 1194 dbSNP
rs750475152 1202 dbSNP
rs1286648549 1209 dbSNP
rs550145639 1210 dbSNP
rs1360696026 1211 dbSNP
rs975223483 1216 dbSNP
rs765240590 1225 dbSNP
rs1315458207 1227 dbSNP
rs965243824 1228 dbSNP
rs1245791136 1232 dbSNP
rs1486206713 1235 dbSNP
rs1019470980 1242 dbSNP
rs1019521443 1256 dbSNP
rs1004504615 1268 dbSNP
rs1213694702 1269 dbSNP
rs951335489 1274 dbSNP
rs1260179621 1276 dbSNP
rs1281099506 1281 dbSNP
rs1027379437 1300 dbSNP
rs1244963776 1303 dbSNP
rs1442529489 1308 dbSNP
rs1344922016 1309 dbSNP
rs995533559 1311 dbSNP
rs894552441 1318 dbSNP
rs1055831066 1332 dbSNP
rs1228452417 1337 dbSNP
rs1002987848 1346 dbSNP
rs1351751823 1355 dbSNP
rs1156518868 1356 dbSNP
rs1344030916 1359 dbSNP
rs1466110184 1360 dbSNP
rs1305110597 1366 dbSNP
rs907345456 1368 dbSNP
rs1408775683 1371 dbSNP
rs116274562 1372 dbSNP
rs946267349 1378 dbSNP
rs893399483 1381 dbSNP
rs1053848584 1383 dbSNP
rs1310499781 1386 dbSNP
rs1412726868 1387 dbSNP
rs936343487 1391 dbSNP
rs150010886 1392 dbSNP
rs896544205 1412 dbSNP
rs1013247720 1416 dbSNP
rs921010479 1417 dbSNP
rs1055374148 1419 dbSNP
rs1002388010 1420 dbSNP
rs1475651786 1422 dbSNP
rs577161446 1429 dbSNP
rs1481499145 1437 dbSNP
rs887923990 1439 dbSNP
rs1442403238 1440 dbSNP
rs1049147977 1445 dbSNP
rs1433254488 1451 dbSNP
rs929348632 1452 dbSNP
rs943779323 1453 dbSNP
rs1263078626 1459 dbSNP
rs763773258 1460 dbSNP
rs919342252 1464 dbSNP
rs1040817187 1467 dbSNP
rs944695150 1475 dbSNP
rs1330615722 1476 dbSNP
rs1297807384 1482 dbSNP
rs541951643 1484 dbSNP
rs1388561457 1485 dbSNP
rs912492402 1485 dbSNP
rs912348107 1486 dbSNP
rs574113874 1497 dbSNP
rs560670035 1499 dbSNP
rs951346138 1501 dbSNP
rs1222757238 1514 dbSNP
rs373184315 1514 dbSNP
rs1309036662 1517 dbSNP
rs12218506 1522 dbSNP
rs74815478 1523 dbSNP
rs1034319507 1526 dbSNP
rs1002873286 1527 dbSNP
rs1201175018 1528 dbSNP
rs1339610013 1538 dbSNP
rs202239465 1539 dbSNP
rs1437117601 1540 dbSNP
rs1172002944 1544 dbSNP
rs1422342825 1546 dbSNP
rs78106914 1550 dbSNP
rs1347456726 1551 dbSNP
rs1373756849 1551 dbSNP
rs796535517 1551 dbSNP
rs1158517850 1552 dbSNP
rs1344885974 1554 dbSNP
rs902814762 1555 dbSNP
rs1416207524 1560 dbSNP
rs1161617834 1561 dbSNP
rs1364054924 1563 dbSNP
rs1472695443 1564 dbSNP
rs1391121707 1569 dbSNP
rs1322129906 1578 dbSNP
rs1020685426 1581 dbSNP
rs1289149649 1593 dbSNP
rs1191109481 1596 dbSNP
rs1020843427 1598 dbSNP
rs554252968 1600 dbSNP
rs1463912696 1601 dbSNP
rs1244303772 1611 dbSNP
rs1159384779 1612 dbSNP
rs1013288230 1626 dbSNP
rs1186469104 1630 dbSNP
rs1245742596 1640 dbSNP
rs960335085 1642 dbSNP
rs1426949701 1657 dbSNP
rs1010431096 1660 dbSNP
rs893358084 1665 dbSNP
rs1054752507 1666 dbSNP
rs1420362276 1670 dbSNP
rs936312400 1673 dbSNP
rs1320415343 1674 dbSNP
rs1343542309 1675 dbSNP
rs1428499314 1678 dbSNP
rs1291585726 1679 dbSNP
rs1226218894 1685 dbSNP
rs1033953084 1686 dbSNP
rs1355405830 1686 dbSNP
rs1298030639 1691 dbSNP
rs899467078 1694 dbSNP
rs1216920142 1698 dbSNP
rs1230568632 1699 dbSNP
rs1285687827 1699 dbSNP
rs537830299 1700 dbSNP
rs943748269 1701 dbSNP
rs912329478 1704 dbSNP
rs887953527 1706 dbSNP
rs1446809697 1708 dbSNP
rs1182185755 1714 dbSNP
rs576490051 1715 dbSNP
rs1440510661 1727 dbSNP
rs993679180 1728 dbSNP
rs1382813305 1730 dbSNP
rs184551599 1736 dbSNP
rs555570169 1737 dbSNP
rs1040429875 1745 dbSNP
rs919835471 1751 dbSNP
rs111557953 1752 dbSNP
rs1454345586 1756 dbSNP
rs566520776 1760 dbSNP
rs552765110 1767 dbSNP
rs539282721 1770 dbSNP
rs1239242890 1771 dbSNP
rs1034288097 1779 dbSNP
rs981419499 1781 dbSNP
rs1049638650 1784 dbSNP
rs1279927384 1787 dbSNP
rs971875134 1789 dbSNP
rs1202362045 1791 dbSNP
rs1390118402 1796 dbSNP
rs1458506840 1798 dbSNP
rs925219768 1799 dbSNP
rs1469681974 1802 dbSNP
rs11198227 1815 dbSNP
rs1020390808 1819 dbSNP
rs1431577441 1819 dbSNP
rs550510177 1820 dbSNP
rs913656525 1825 dbSNP
rs1404995597 1828 dbSNP
rs1010817159 1831 dbSNP
rs1440796074 1832 dbSNP
rs775492245 1832 dbSNP
rs878911397 1832 dbSNP
rs1247896853 1833 dbSNP
rs960366305 1835 dbSNP
rs1222162427 1844 dbSNP
rs1218991126 1848 dbSNP
rs1033312244 1850 dbSNP
rs375896427 1855 dbSNP
rs572406125 1856 dbSNP
rs191291902 1862 dbSNP
rs1490074957 1866 dbSNP
rs952438131 1867 dbSNP
rs1271066180 1873 dbSNP
rs1275169383 1883 dbSNP
rs1479500281 1889 dbSNP
rs1174176906 1890 dbSNP
rs1207014261 1891 dbSNP
rs1462283802 1896 dbSNP
rs1169471136 1903 dbSNP
rs375872170 1908 dbSNP
rs1027888788 1910 dbSNP
rs1033188294 1912 dbSNP
rs1303393816 1913 dbSNP
rs375066984 1919 dbSNP
rs996391688 1926 dbSNP
rs555072622 1931 dbSNP
rs1327582135 1941 dbSNP
rs746228001 1943 dbSNP
rs1039358205 1952 dbSNP
rs1007928907 1955 dbSNP
rs1369886317 1956 dbSNP
rs547928760 1968 dbSNP
rs528209546 1976 dbSNP
rs757663596 1980 dbSNP
rs1050423706 1985 dbSNP
rs1054641733 1986 dbSNP
rs1294304799 1990 dbSNP
rs890854646 1994 dbSNP
rs554087774 2008 dbSNP
rs903798944 2008 dbSNP
rs1429011516 2016 dbSNP
rs1378740081 2018 dbSNP
rs1195268018 2024 dbSNP
rs779116671 2037 dbSNP
rs1310027151 2041 dbSNP
rs1428227669 2043 dbSNP
rs1370298735 2052 dbSNP
rs1177453361 2054 dbSNP
rs945223570 2059 dbSNP
rs1416632476 2061 dbSNP
rs186544850 2061 dbSNP
rs540810390 2066 dbSNP
rs1422193601 2077 dbSNP
rs1188944857 2078 dbSNP
rs1301944192 2088 dbSNP
rs1390271951 2098 dbSNP
rs1479938340 2102 dbSNP
rs1038184186 2109 dbSNP
rs937228738 2111 dbSNP
rs1326203983 2114 dbSNP
rs1247245676 2118 dbSNP
rs533593978 2127 dbSNP
rs2928125 2128 dbSNP
rs1357606231 2135 dbSNP
rs544928467 2137 dbSNP
rs575508484 2140 dbSNP
rs1259658851 2148 dbSNP
rs1448633287 2165 dbSNP
rs1184027828 2166 dbSNP
rs1386677309 2168 dbSNP
rs1313880491 2181 dbSNP
rs1162549593 2183 dbSNP
rs981388789 2188 dbSNP
rs555755290 2190 dbSNP
rs566279408 2193 dbSNP
rs554033794 2195 dbSNP
rs1287617897 2198 dbSNP
rs1384933528 2199 dbSNP
rs913298404 2200 dbSNP
rs1453794590 2213 dbSNP
rs541926071 2217 dbSNP
rs1339061557 2226 dbSNP
rs988875870 2229 dbSNP
rs572985477 2232 dbSNP
rs749448925 2247 dbSNP
rs185022830 2248 dbSNP
rs889220586 2259 dbSNP
rs1237052978 2264 dbSNP
rs1258873380 2277 dbSNP
rs1033155779 2278 dbSNP
rs553080063 2283 dbSNP
rs996359984 2288 dbSNP
rs1029020132 2292 dbSNP
rs1244681732 2309 dbSNP
rs1459814437 2321 dbSNP
rs1408180303 2326 dbSNP
rs1350306396 2327 dbSNP
rs1303758569 2330 dbSNP
rs904501193 2332 dbSNP
rs1156362864 2334 dbSNP
rs1468087690 2340 dbSNP
rs539248896 2341 dbSNP
rs1410623427 2348 dbSNP
rs1044039820 2370 dbSNP
rs867184013 2371 dbSNP
rs570357113 2373 dbSNP
rs1056353104 2377 dbSNP
rs1298950398 2379 dbSNP
rs1375867884 2392 dbSNP
rs1389714556 2394 dbSNP
rs964945352 2395 dbSNP
rs1324384691 2396 dbSNP
rs1223969651 2401 dbSNP
rs1019234091 2402 dbSNP
rs779969049 2414 dbSNP
rs1264998135 2415 dbSNP
rs1321132340 2430 dbSNP
rs1008307506 2443 dbSNP
rs771107482 2443 dbSNP
rs1175143363 2454 dbSNP
rs1412005076 2455 dbSNP
rs571463269 2462 dbSNP
rs35960653 2467 dbSNP
rs34350858 2478 dbSNP
rs980491716 2479 dbSNP
rs1249641022 2485 dbSNP
rs556730069 2487 dbSNP
rs993906569 2488 dbSNP
rs1171613067 2492 dbSNP
rs1235669475 2506 dbSNP
rs1356677475 2510 dbSNP
rs1460603564 2520 dbSNP
rs972130290 2525 dbSNP
rs1346221241 2527 dbSNP
rs962360755 2532 dbSNP
rs537357278 2539 dbSNP
rs567933096 2540 dbSNP
rs1285090809 2560 dbSNP
rs912127223 2562 dbSNP
rs1218606495 2565 dbSNP
rs987626816 2570 dbSNP
rs1329957425 2575 dbSNP
rs898262051 2576 dbSNP
rs1273553634 2578 dbSNP
rs548181908 2580 dbSNP
rs528105422 2581 dbSNP
rs114093861 2600 dbSNP
rs1187641159 2603 dbSNP
rs1398168247 2603 dbSNP
rs1045657820 2614 dbSNP
rs747189310 2618 dbSNP
rs1377339758 2623 dbSNP
rs950015760 2633 dbSNP
rs1168180676 2652 dbSNP
rs1302804785 2653 dbSNP
rs537934846 2654 dbSNP
rs11198226 2658 dbSNP
rs1349392266 2659 dbSNP
rs1435603507 2659 dbSNP
rs1270704323 2664 dbSNP
rs1363811669 2676 dbSNP
rs1321971691 2679 dbSNP
rs533556570 2687 dbSNP
rs41284402 2688 dbSNP
rs192640218 2695 dbSNP
rs926055557 2698 dbSNP
rs974892397 2699 dbSNP
rs771817991 2702 dbSNP
rs1425368541 2708 dbSNP
rs964917576 2718 dbSNP
rs1486846222 2727 dbSNP
rs1411298684 2736 dbSNP
rs1244387340 2743 dbSNP
rs1486431396 2748 dbSNP
rs1188372363 2757 dbSNP
rs1386279346 2760 dbSNP
rs544531212 2762 dbSNP
rs1446617832 2764 dbSNP
rs1161918522 2768 dbSNP
rs1019201572 2770 dbSNP
rs1009118302 2773 dbSNP
rs1182964602 2778 dbSNP
rs951050395 2793 dbSNP
rs1318877234 2798 dbSNP
rs1346946360 2805 dbSNP
rs1020320622 2809 dbSNP
rs1319600788 2813 dbSNP
rs1383291039 2813 dbSNP
rs1465266895 2814 dbSNP
rs112764650 2829 dbSNP
rs1355016441 2829 dbSNP
rs1206887545 2830 dbSNP
rs571655144 2835 dbSNP
rs1208673828 2842 dbSNP
rs1244065359 2851 dbSNP
rs1056383687 2852 dbSNP
rs1003394387 2862 dbSNP
rs1237179951 2864 dbSNP
rs898229599 2877 dbSNP
rs904985840 2879 dbSNP
rs527727389 2881 dbSNP
rs1016679087 2885 dbSNP
rs748942868 2890 dbSNP
rs1405927478 2895 dbSNP
rs1455535176 2901 dbSNP
rs562280085 2910 dbSNP
rs60121303 2911 dbSNP
rs1454424908 2912 dbSNP
rs1320311369 2917 dbSNP
rs1339544784 2926 dbSNP
rs41284400 2937 dbSNP
rs1280737083 2944 dbSNP
rs1348100447 2946 dbSNP
rs188849769 2949 dbSNP
rs1229877954 2955 dbSNP
rs545903948 2956 dbSNP
rs1202227895 2957 dbSNP
rs940336176 2961 dbSNP
rs1438572389 2969 dbSNP
rs1319064941 2970 dbSNP
rs576585631 2972 dbSNP
rs1231194158 2982 dbSNP
rs758414659 2984 dbSNP
rs1380033142 2987 dbSNP
rs1429961040 2988 dbSNP
rs1383569828 2990 dbSNP
rs1293773947 2994 dbSNP
rs1459102891 3000 dbSNP
rs1170550892 3001 dbSNP
rs936024202 3005 dbSNP
rs1401259564 3007 dbSNP
rs1347943637 3011 dbSNP
rs1162690281 3013 dbSNP
rs926027421 3014 dbSNP
rs1348082568 3023 dbSNP
rs974861159 3024 dbSNP
rs943443957 3026 dbSNP
rs547664659 3031 dbSNP
rs912026384 3031 dbSNP
rs987660938 3038 dbSNP
rs1231749718 3044 dbSNP
rs988056649 3055 dbSNP
rs950982552 3060 dbSNP
rs140194504 3066 dbSNP
rs979331652 3069 dbSNP
rs1272820785 3076 dbSNP
rs536911943 3086 dbSNP
rs968872767 3088 dbSNP
rs1211904498 3097 dbSNP
rs1223369671 3098 dbSNP
rs574657802 3103 dbSNP
rs972424008 3111 dbSNP
rs1487627348 3112 dbSNP
rs1020771550 3118 dbSNP
rs962386243 3122 dbSNP
rs1016561156 3124 dbSNP
rs1344680513 3125 dbSNP
rs115174840 3130 dbSNP
rs1003425383 3131 dbSNP
rs1169272136 3134 dbSNP
rs1368370174 3147 dbSNP
rs1428506700 3150 dbSNP
rs1325397343 3151 dbSNP
rs905639879 3167 dbSNP
rs1303190513 3175 dbSNP
rs1366925090 3177 dbSNP
rs1024114577 3178 dbSNP
rs764673853 3188 dbSNP
rs1343241616 3189 dbSNP
rs534597805 3193 dbSNP
rs1230133358 3194 dbSNP
rs1302076618 3195 dbSNP
rs1295634911 3196 dbSNP
rs1430168862 3199 dbSNP
rs995059990 3200 dbSNP
rs1247014325 3206 dbSNP
rs1372132201 3218 dbSNP
rs1166661485 3220 dbSNP
rs1461397665 3224 dbSNP
rs1487548003 3224 dbSNP
rs1378351898 3226 dbSNP
rs1207984963 3228 dbSNP
rs1201080023 3229 dbSNP
rs1431455048 3230 dbSNP
rs1268456392 3231 dbSNP
rs891693645 3242 dbSNP
rs1036491610 3243 dbSNP
rs1053487534 3243 dbSNP
rs1275642257 3243 dbSNP
rs940380674 3243 dbSNP
rs911519648 3244 dbSNP
rs1051976106 3248 dbSNP
rs1386494046 3249 dbSNP
rs1455996341 3254 dbSNP
rs1293430771 3262 dbSNP
rs1386359031 3263 dbSNP
rs1384448947 3275 dbSNP
rs932270190 3278 dbSNP
rs1484255110 3284 dbSNP
rs922188138 3286 dbSNP
rs935980776 3291 dbSNP
rs1317514540 3292 dbSNP
rs1319987750 3299 dbSNP
rs530840935 3306 dbSNP
rs1346321613 3308 dbSNP
rs1351262358 3321 dbSNP
rs532472193 3322 dbSNP
rs1234797989 3324 dbSNP
rs1343016916 3343 dbSNP
rs989260811 3352 dbSNP
rs772737345 3354 dbSNP
rs1039058208 3360 dbSNP
rs565720267 3363 dbSNP
rs146121640 3365 dbSNP
rs1410001732 3367 dbSNP
rs1352146006 3368 dbSNP
rs1326567327 3370 dbSNP
rs538740005 3375 dbSNP
rs1163408759 3377 dbSNP
rs564898058 3381 dbSNP
rs571024510 3385 dbSNP
rs1390811451 3388 dbSNP
rs1035726131 3390 dbSNP
rs1402843777 3401 dbSNP
rs550055431 3406 dbSNP
rs969318018 3407 dbSNP
rs1388356862 3412 dbSNP
rs1470540065 3419 dbSNP
rs929501973 3419 dbSNP
rs1468331288 3420 dbSNP
rs919509358 3422 dbSNP
rs1377297165 3424 dbSNP
rs74638723 3431 dbSNP
rs1307736052 3434 dbSNP
rs1337628311 3436 dbSNP
rs963599544 3439 dbSNP
rs1473677834 3445 dbSNP
rs562403377 3451 dbSNP
rs1014679707 3476 dbSNP
rs546423212 3477 dbSNP
rs1482041253 3478 dbSNP
rs890196093 3491 dbSNP
rs1051416863 3500 dbSNP
rs183403598 3509 dbSNP
rs1180632389 3524 dbSNP
rs1258875622 3528 dbSNP
rs969768013 3530 dbSNP
rs41284398 3534 dbSNP
rs1178639056 3546 dbSNP
rs559326411 3549 dbSNP
rs1294268240 3554 dbSNP
rs561087256 3554 dbSNP
rs1465682643 3559 dbSNP
rs1298968591 3567 dbSNP
rs900784497 3569 dbSNP
rs545866964 3570 dbSNP
rs1014086536 3573 dbSNP
rs956103726 3597 dbSNP
rs1286362406 3617 dbSNP
rs112683266 3624 dbSNP
rs1224068296 3625 dbSNP
rs1228667697 3628 dbSNP
rs1310220385 3637 dbSNP
rs913355452 3642 dbSNP
rs988968700 3646 dbSNP
rs1202459928 3652 dbSNP
rs1250467845 3675 dbSNP
rs148562120 3678 dbSNP
rs1193441808 3684 dbSNP
rs1423421670 3689 dbSNP
rs1000076233 3695 dbSNP
rs904460917 3700 dbSNP
rs1433039533 3714 dbSNP
rs1238071579 3724 dbSNP
rs1340806656 3730 dbSNP
rs1039038365 3731 dbSNP
rs1336117360 3734 dbSNP
rs1392315933 3735 dbSNP
rs1450332187 3736 dbSNP
rs1007587494 3754 dbSNP
rs542210064 3759 dbSNP
rs1366284467 3761 dbSNP
rs1295288841 3765 dbSNP
rs1405407657 3765 dbSNP
rs868515467 3766 dbSNP
rs780123467 3769 dbSNP
rs543577948 3773 dbSNP
rs190488407 3775 dbSNP
rs1343808476 3776 dbSNP
rs1225754175 3781 dbSNP
rs970017847 3784 dbSNP
rs1490372305 3786 dbSNP
rs1023569700 3798 dbSNP
rs374423591 3805 dbSNP
rs554838650 3806 dbSNP
rs1158142578 3814 dbSNP
rs571669351 3816 dbSNP
rs534925899 3855 dbSNP
rs572022561 3856 dbSNP
rs187920174 3858 dbSNP
rs1037851850 3870 dbSNP
rs942259836 3881 dbSNP
rs1168201202 3884 dbSNP
rs1385935996 3886 dbSNP
rs926907469 3892 dbSNP
rs144470484 3903 dbSNP
rs866754225 3907 dbSNP
rs917000749 3909 dbSNP
rs995813863 3911 dbSNP
rs1320924176 3914 dbSNP
rs559722406 3916 dbSNP
rs900145154 3924 dbSNP
rs955819324 3928 dbSNP
rs1296504956 3932 dbSNP
rs1031900156 3937 dbSNP
rs1359526669 3942 dbSNP
rs1229573035 3949 dbSNP
rs1043320721 3967 dbSNP
rs947658898 3969 dbSNP
rs1217144875 3980 dbSNP
rs1250229276 3987 dbSNP
rs892042329 3991 dbSNP
rs755390580 4003 dbSNP
rs1000058048 4004 dbSNP
rs1204139415 4005 dbSNP
rs968603528 4006 dbSNP
rs1413204649 4008 dbSNP
rs1285702097 4023 dbSNP
rs938819308 4027 dbSNP
rs1243772345 4033 dbSNP
rs1159829426 4035 dbSNP
rs569710533 4037 dbSNP
rs549657608 4038 dbSNP
rs1044473737 4041 dbSNP
rs1437370649 4042 dbSNP
rs1449799329 4043 dbSNP
rs890417884 4045 dbSNP
rs919887850 4051 dbSNP
rs974094384 4052 dbSNP
rs1051774028 4053 dbSNP
rs1270651007 4056 dbSNP
rs993964286 4066 dbSNP
rs529711990 4071 dbSNP
rs1264168707 4074 dbSNP
rs897921610 4079 dbSNP
rs1406143939 4081 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.695 3.4e-4 0.770 3.6e-5 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.579 1.9e-3 0.554 3.0e-3 23 Click to see details
GSE27834 Pluripotent stem cells 0.549 1.4e-2 0.550 1.4e-2 16 Click to see details
GSE28544 Breast cancer -0.367 3.9e-2 -0.383 3.2e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.32 5.9e-2 0.283 8.5e-2 25 Click to see details
GSE19350 CNS germ cell tumors 0.464 6.4e-2 0.413 9.1e-2 12 Click to see details
GSE28260 Renal cortex and medulla -0.434 6.9e-2 -0.379 1.0e-1 13 Click to see details
GSE19536 Breast cancer 0.128 1.0e-1 0.169 4.6e-2 100 Click to see details
GSE21687 Ependynoma primary tumors -0.125 1.6e-1 -0.084 2.5e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.201 1.7e-1 0.331 5.3e-2 25 Click to see details
GSE21032 Prostate cancer 0.093 2.0e-1 0.083 2.3e-1 83 Click to see details
GSE14794 Lymphoblastoid cells -0.068 2.6e-1 -0.088 2.0e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.115 2.7e-1 -0.046 4.0e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer 0.136 2.8e-1 0.030 4.5e-1 20 Click to see details
GSE38226 Liver fibrosis -0.087 3.5e-1 0.006 4.9e-1 21 Click to see details
GSE17306 Multiple myeloma -0.043 3.8e-1 -0.064 3.3e-1 49 Click to see details
GSE17498 Multiple myeloma -0.044 3.9e-1 -0.004 4.9e-1 40 Click to see details
GSE21849 B cell lymphoma -0.032 4.3e-1 -0.105 2.9e-1 29 Click to see details
GSE19783 ER- ER- breast cancer -0.003 4.9e-1 0.106 1.8e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.004 4.9e-1 -0.105 3.1e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.004 4.9e-1 -0.105 3.1e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.551 0 -0.564 0 32 Click to see details
BLCA -0.545 0.01 -0.558 0.01 18 Click to see details
KICH -0.403 0.02 -0.350 0.04 25 Click to see details
CHOL -0.665 0.03 -0.483 0.09 9 Click to see details
KIRP -0.236 0.1 -0.263 0.07 32 Click to see details
THCA -0.163 0.11 -0.240 0.03 59 Click to see details
HNSC -0.16 0.16 -0.189 0.12 42 Click to see details
LUAD 0.27 0.2 0.112 0.36 12 Click to see details
KIRC -0.098 0.21 -0.071 0.28 68 Click to see details
CESC 0.738 0.24 0.500 0.33 3 Click to see details
ESCA -0.215 0.26 -0.382 0.12 11 Click to see details
BRCA -0.067 0.27 -0.083 0.23 84 Click to see details
COAD -0.228 0.29 -0.500 0.1 8 Click to see details
PRAD -0.074 0.3 -0.135 0.17 50 Click to see details
LUSC 0.053 0.38 0.000 0.5 38 Click to see details
PCPG -0.309 0.4 -0.500 0.33 3 Click to see details
LIHC 0.031 0.42 0.095 0.26 49 Click to see details
UCEC -0.036 0.44 -0.042 0.43 19 Click to see details
PAAD -0.062 0.47 -0.200 0.4 4 Click to see details
PAAD -0.062 0.47 -0.200 0.4 4 Click to see details
PAAD -0.062 0.47 -0.200 0.4 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29