miRTarBase - #MIRT726789 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAP2C   
Synonyms -
Description RAP2C, member of RAS oncogene family
Transcript NM_021183   
Expression
Putative miRNA Targets on RAP2C
3'UTR of RAP2C
(miRNA target sites are highlighted)
>RAP2C|NM_021183|3'UTR
   1 AGAAGATAACCTCAATCATGGCCATACCGAGCAGATAAAACTCAGAGGAAATTTGCACAGATGCTGCTTTGGAGAACTTT
  81 ACAACCTGGGTTGCAGAACTGAGCCTTGGTAAACCTGTCTCTATTACAGCATGTTGCCATACATCTATTTAAGTGCATAA
 161 GGTCTTTGGCCTTCAAGATCCATCGACCTTAAACAGGAATGCTTAGCACGTTTACCATACGTTTAAAATCCATTCTTTAT
 241 CAATCAGTCCTTTTATAGCTTTCTAAGTTCTTATTGATGGCTAATATACAAGGGTTAATTTTTAATATTTTAATTGATTT
 321 CTTTAATCAGTTTCTCGACTTGTATTTATTAAATACTCAAACTCAGTATTACCTACTCAATGCCTTTTAAAAGAAAGTTA
 401 TAATGGAGAAAAAATTGAGCCTTAAACAAATGGTTACTTCTGTATATTACCTCGTACCAGTGCTTCATCCTATTTGTAAA
 481 ATCTTTCTCCTTTAAAATTATTGGTTAATACTTTGAGACTTTGTTTACGTGTGGCAGTGTTGTAAAAAGAAACTAAAGAT
 561 CACATTTTACCTGTATGGATGGAATATCCCTTTTCTTCAAGTGCAGTTTGTGATGTGTTTTGTTTTTTTTTTTTTTTTTT
 641 TGTAATTAACATGTTCTGAAGGTTACAATTGATATTTGAAATTGACTGTAGAGCATTTAGTTGAAGAGTTAAGCATTCAG
 721 TTCCATTAGGTTTTCACATGTGTTAATCTCATTTACAGCATTGAATTGCGGCAGTAACATTTTCCTTTCTGTGAAGTTCT
 801 AAATTTAGTTATGACCTATTTAGCAATGCCTTTGAAAAGGGATATTGTATCCATGGTAAATTAATTGTATACCTAAACAG
 881 AGATAGCTCATCTTTGCCTATCAGGCTTGTAATTGACATCTAGTAGACTTCTGCACATGTAAAATTGAATTCAAATAAAA
 961 TCATACACACTTTCTAGTTCTTAATATTTGTCTTTCTGAATAATAGTTTAAAGCAATATTTGTTAAAGTTTTCTTGCACT
1041 ATCACAATTGCTTTTTAGTTATTTCTCAAGAAGCATGTTCGTATTAGAGACAAAATCTGTGTAACAGGAGGGAGAATAGC
1121 GCCAAGTCTCTGGGCTATTTTTTATTTTTGCAAATGTGCTTTCTAATAGCCATTGCCTTCCATGTTGTTTACCTAATCAG
1201 CATATTTTTGTCTGAATACTTGAACATTTTAACAGTAACGCAGGTGTAGAATCAGAAAGGAAACTTATGCAGAGTAATAT
1281 TTTGGTTCAGTTTTAACATCGTGACAATGAGGGCTTTTTCTAGCAATGATTTTTAAATTGTGTAAGTTTGACAGTATTTT
1361 ATTGTTGGGTTTTTATTTGATTTTAGTTGTGTGCTTTTCATTTGCAGAAGTTAGTAACTGCAGCTCACCTACTGCACCAA
1441 AGTTCTCGATTTTAGGAGCCCAGCTTTAGTCATTTGAACATGCTTCTAAATAAAATAAAACAAAACCAAAACTATACTTT
1521 TGATCTATAATAAGAGCTCAATAACTTTGTCAAGGAAAGCTCTAATATATGCAGTGATGGTTTATGAAAGGGTGTGGCAA
1601 TTTTAAATTTATATTGTGTGTGATGTTCAAATAAAGTGGTATCTACATTCATGTGATTTATGGGTCAGCATGACCATTAA
1681 TTACTGAGTAGAAATTGACTAAACTTTGATTTCCTTTTTTTAAATCGTGTTGCATTTGATTCCTGAGCAAATTCCCTCAA
1761 AGTGAACTCTTGTTCTTAAATTTTGAATTTTATGGTGAGATTGTAAAGATAGAGGCAATTGAAACATTGTTCCTTATTTA
1841 TGAACTGCTTGAAGTGAATACTTAATTTAAGTTTGCACTTTAATACCAAACTTAAAACCAAACACTCATTTAAAAGTAGG
1921 TTAAGTGATCATGGATCATTGTTATTAGCTTTGTGGCTTTGTGAAATTCTAAAGGAATCAAATAATTCATCATGATTTAA
2001 ATTTTCTAGAGATTTTGATTTTTTTATAATGTTTCTTTCCTGTAGATTGTGTTCTTGTTTCTCTCTCTCTCTCTCTCTCT
2081 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAAAATTACAGTGTTCATTGTCATTGACCTCAGCAGCAAATTTGAC
2161 TTGAATTCACTTAGGATCGCAGGAATCAGGGGAAAGTGATTTTAAAGGTGGTTTCTCCAGCACATTTTAAGAAAAGGGAC
2241 CAAAAGTTATTTTAGCTTCCTCAATAGATTGCATGTTGCTTATTAGGATAATAAATTAATATTAAATGCAATATATGTCT
2321 TGTCTTTATTATGGCATCTATTTAGGAGTTGTTCAAATCACTGCAGTAGGGCTCTGCAAATAAAATAATGTAACCTATTA
2401 TCATGGATCTAATGTACTGTAACTTTATCAGTGAAAGGTAAAATCTCAAATAACAAGTACAAACATTGAACAATTACCTA
2481 TAAAGATTTGTAAAAGTAAAATTTTTCCAATAGATTTCATTCTTGTCATTTTGTAAGACGACCCTGCAGTCCACCTGTTT
2561 GTAACTTTTTTAATAAAATAGACATCTGTATTACTGAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUG---GUAAUACACGACGAu 5'
             |||:   ||  |  ||||||| 
Target 5' aggAAATTTGCA-CAGATGCTGCTt 3'
46 - 69 142.00 -13.10
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||   |||:  ||:|||| 
Target 5' ctCAATAGATTGCATGTTGCTt 3'
2260 - 2281 140.00 -9.00
3
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||:::| ||  ||| ||| 
Target 5' cagAAGTTAGTAACTGCAGCTc 3'
1405 - 1426 127.00 -7.50
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777789148 3 dbSNP
rs41304510 7 dbSNP
rs372738218 15 dbSNP
rs748348146 19 dbSNP
rs376689662 27 dbSNP
rs199820331 28 dbSNP
rs754095049 29 dbSNP
rs1236437876 42 dbSNP
rs1348455851 44 dbSNP
rs1274142999 46 dbSNP
rs777894369 61 dbSNP
rs941709088 91 dbSNP
rs758676138 114 dbSNP
rs1250854799 117 dbSNP
rs907602042 124 dbSNP
rs752812249 141 dbSNP
rs983149903 158 dbSNP
rs952270991 164 dbSNP
rs922115285 170 dbSNP
rs191146862 171 dbSNP
rs1339004936 175 dbSNP
rs777124217 182 dbSNP
rs923103455 183 dbSNP
rs1352289862 193 dbSNP
rs552004394 196 dbSNP
rs1018993508 201 dbSNP
rs1463101665 205 dbSNP
rs869152906 205 dbSNP
rs750419250 212 dbSNP
rs964622806 223 dbSNP
rs1453943133 224 dbSNP
rs1284977125 246 dbSNP
rs1345859923 253 dbSNP
rs1408902109 259 dbSNP
rs1217971717 266 dbSNP
rs1489886682 273 dbSNP
rs1309162695 274 dbSNP
rs374712233 286 dbSNP
rs1157099373 302 dbSNP
rs1251961184 315 dbSNP
rs1490249106 322 dbSNP
rs746535636 334 dbSNP
rs1032974361 335 dbSNP
rs1490603358 336 dbSNP
rs1186259894 342 dbSNP
rs1000761896 345 dbSNP
rs187848677 351 dbSNP
rs978764246 353 dbSNP
rs968721637 360 dbSNP
rs1471697564 363 dbSNP
rs1236635535 364 dbSNP
rs1422389224 375 dbSNP
rs1216410466 397 dbSNP
rs1304543086 405 dbSNP
rs1365780792 413 dbSNP
rs1429831586 419 dbSNP
rs1184173356 427 dbSNP
rs1286886597 428 dbSNP
rs1364076451 429 dbSNP
rs1020327952 445 dbSNP
rs116679146 451 dbSNP
rs761354665 456 dbSNP
rs1244095005 477 dbSNP
rs772145229 478 dbSNP
rs1207617621 481 dbSNP
rs183166263 492 dbSNP
rs1215589507 503 dbSNP
rs1240659793 504 dbSNP
rs751114184 554 dbSNP
rs1035855702 574 dbSNP
rs1002117733 578 dbSNP
rs1442283221 594 dbSNP
rs79879112 595 dbSNP
rs906090176 600 dbSNP
rs940412616 607 dbSNP
rs763466101 616 dbSNP
rs143853322 630 dbSNP
rs774942686 673 dbSNP
rs1380445337 677 dbSNP
rs140192546 682 dbSNP
rs1317229900 683 dbSNP
rs1360517372 684 dbSNP
rs190655330 685 dbSNP
rs966205732 699 dbSNP
rs1320561647 705 dbSNP
rs1319067151 739 dbSNP
rs1403780184 746 dbSNP
rs1216919002 762 dbSNP
rs1384814601 765 dbSNP
rs1164026461 776 dbSNP
rs1446210464 777 dbSNP
rs1184972293 778 dbSNP
rs1388318323 779 dbSNP
rs1243151131 781 dbSNP
rs912041858 785 dbSNP
rs886087225 786 dbSNP
rs1185789152 787 dbSNP
rs1047423142 793 dbSNP
rs1401113369 795 dbSNP
rs1175413338 796 dbSNP
rs1191375595 796 dbSNP
rs1403884764 796 dbSNP
rs1475463054 802 dbSNP
rs1243293711 804 dbSNP
rs1441798921 817 dbSNP
rs1278045659 837 dbSNP
rs777322770 838 dbSNP
rs923031489 854 dbSNP
rs186950766 863 dbSNP
rs150657864 867 dbSNP
rs777929855 906 dbSNP
rs780896001 910 dbSNP
rs1038824938 935 dbSNP
rs368065437 941 dbSNP
rs1206058782 942 dbSNP
rs771987030 969 dbSNP
rs866269130 979 dbSNP
rs943217695 983 dbSNP
rs754797411 1013 dbSNP
rs1361958292 1033 dbSNP
rs1470298706 1054 dbSNP
rs1000124538 1056 dbSNP
rs1296066386 1061 dbSNP
rs1198504081 1068 dbSNP
rs979747706 1078 dbSNP
rs1481392175 1090 dbSNP
rs968388077 1093 dbSNP
rs1177023870 1099 dbSNP
rs751162928 1104 dbSNP
rs966643197 1116 dbSNP
rs1326920876 1119 dbSNP
rs748406857 1121 dbSNP
rs1023513823 1129 dbSNP
rs988846029 1130 dbSNP
rs960077430 1131 dbSNP
rs1012501153 1146 dbSNP
rs1343971918 1148 dbSNP
rs1272044938 1153 dbSNP
rs778998631 1154 dbSNP
rs1339278093 1170 dbSNP
rs1001681440 1172 dbSNP
rs970617340 1177 dbSNP
rs1438048865 1194 dbSNP
rs1221198584 1207 dbSNP
rs1266550106 1210 dbSNP
rs1490792138 1221 dbSNP
rs1056307471 1222 dbSNP
rs1365248290 1224 dbSNP
rs762707724 1240 dbSNP
rs1303975014 1242 dbSNP
rs1426319534 1256 dbSNP
rs1368405679 1260 dbSNP
rs1166236776 1276 dbSNP
rs866779770 1277 dbSNP
rs1004657509 1290 dbSNP
rs1421670020 1298 dbSNP
rs1430668999 1304 dbSNP
rs1302736568 1327 dbSNP
rs1429010193 1332 dbSNP
rs1421532273 1336 dbSNP
rs1363910270 1339 dbSNP
rs755953352 1352 dbSNP
rs1016455576 1361 dbSNP
rs1324599372 1362 dbSNP
rs1326421354 1365 dbSNP
rs750188517 1368 dbSNP
rs1189009486 1401 dbSNP
rs1342205313 1409 dbSNP
rs141964122 1416 dbSNP
rs886723596 1424 dbSNP
rs183239941 1437 dbSNP
rs1201067052 1468 dbSNP
rs930300418 1477 dbSNP
rs922188507 1481 dbSNP
rs1260697108 1499 dbSNP
rs1445226461 1504 dbSNP
rs1195181116 1505 dbSNP
rs1243948260 1510 dbSNP
rs867381662 1513 dbSNP
rs1450210355 1521 dbSNP
rs1272885500 1532 dbSNP
rs1039323626 1547 dbSNP
rs944952288 1548 dbSNP
rs1426780277 1550 dbSNP
rs5977657 1558 dbSNP
rs1275701044 1562 dbSNP
rs988926482 1564 dbSNP
rs1217607685 1573 dbSNP
rs934760123 1583 dbSNP
rs1284176489 1598 dbSNP
rs926015505 1607 dbSNP
rs777283915 1610 dbSNP
rs1366534728 1628 dbSNP
rs769105621 1637 dbSNP
rs970050094 1643 dbSNP
rs763668103 1659 dbSNP
rs943164966 1666 dbSNP
rs761147614 1679 dbSNP
rs762369522 1696 dbSNP
rs1244995338 1698 dbSNP
rs1259950205 1703 dbSNP
rs1348225267 1704 dbSNP
rs925092856 1715 dbSNP
rs1043619657 1723 dbSNP
rs775976888 1740 dbSNP
rs1183134812 1763 dbSNP
rs191456787 1764 dbSNP
rs945267777 1766 dbSNP
rs960888405 1791 dbSNP
rs186206423 1818 dbSNP
rs1004688420 1828 dbSNP
rs1462292226 1850 dbSNP
rs1356277178 1854 dbSNP
rs760015158 1860 dbSNP
rs886205616 1867 dbSNP
rs1027366234 1876 dbSNP
rs1334138719 1883 dbSNP
rs777164943 1897 dbSNP
rs111513378 1901 dbSNP
rs960041471 1901 dbSNP
rs994989592 1904 dbSNP
rs1396282521 1908 dbSNP
rs771370982 1918 dbSNP
rs866399115 1929 dbSNP
rs867578403 1930 dbSNP
rs111932725 1933 dbSNP
rs35354816 1933 dbSNP
rs375711409 1933 dbSNP
rs201944822 1935 dbSNP
rs67630091 1935 dbSNP
rs868080061 1935 dbSNP
rs1288743709 1943 dbSNP
rs1322731023 1962 dbSNP
rs1178183462 1984 dbSNP
rs1039093819 1986 dbSNP
rs980576178 2010 dbSNP
rs1484252777 2016 dbSNP
rs1201088931 2017 dbSNP
rs1250153617 2071 dbSNP
rs1417557755 2082 dbSNP
rs1184792945 2092 dbSNP
rs1316813692 2098 dbSNP
rs1471431119 2105 dbSNP
rs1249359868 2108 dbSNP
rs1480410395 2110 dbSNP
rs1177044417 2111 dbSNP
rs1432041661 2112 dbSNP
rs1466146882 2116 dbSNP
rs1297091556 2122 dbSNP
rs1308421095 2123 dbSNP
rs1392699554 2123 dbSNP
rs1407235301 2123 dbSNP
rs1481159789 2125 dbSNP
rs377519307 2153 dbSNP
rs1221643045 2170 dbSNP
rs1285171136 2172 dbSNP
rs772261322 2201 dbSNP
rs1202264793 2202 dbSNP
rs1234145016 2203 dbSNP
rs1250768922 2216 dbSNP
rs1479788555 2232 dbSNP
rs1207500565 2238 dbSNP
rs1253030935 2247 dbSNP
rs1322943744 2251 dbSNP
rs1263788456 2252 dbSNP
rs890679500 2259 dbSNP
rs1427934374 2261 dbSNP
rs1434251902 2280 dbSNP
rs1327403700 2327 dbSNP
rs1306556881 2346 dbSNP
rs748154670 2348 dbSNP
rs746156483 2353 dbSNP
rs779237027 2364 dbSNP
rs926047983 2369 dbSNP
rs778798178 2371 dbSNP
rs950928366 2378 dbSNP
rs1364533727 2411 dbSNP
rs1451779971 2420 dbSNP
rs1026540867 2422 dbSNP
rs1304730186 2427 dbSNP
rs1368224256 2475 dbSNP
rs1381521303 2499 dbSNP
rs1294973022 2503 dbSNP
rs1305799459 2512 dbSNP
rs771045333 2514 dbSNP
rs748035767 2527 dbSNP
rs1406695797 2531 dbSNP
rs60466594 2554 dbSNP
rs1220803990 2555 dbSNP
rs948812669 2557 dbSNP
rs915936105 2564 dbSNP
rs1489098688 2569 dbSNP
rs1186391868 2579 dbSNP
rs1455179080 2593 dbSNP
rs1362926623 2607 dbSNP
rs749464919 2630 dbSNP
rs993223791 2630 dbSNP
rs1038723325 2643 dbSNP
rs1178889684 2644 dbSNP
rs960667968 2658 dbSNP
rs780981693 2682 dbSNP
rs1350203112 2686 dbSNP
rs1410560907 2688 dbSNP
rs1287087597 2696 dbSNP
rs1367243646 2699 dbSNP
rs781139424 2719 dbSNP
rs1437441315 2722 dbSNP
rs1034911004 2725 dbSNP
rs1382314071 2726 dbSNP
rs983284310 2728 dbSNP
rs180940006 2729 dbSNP
rs892358990 2731 dbSNP
rs1027489708 2742 dbSNP
rs939306565 2743 dbSNP
rs1461295844 2754 dbSNP
rs994621716 2759 dbSNP
rs980158110 2771 dbSNP
rs751585053 2780 dbSNP
rs751334371 2786 dbSNP
rs1183199294 2799 dbSNP
rs1414032887 2814 dbSNP
rs1418335999 2826 dbSNP
rs1156650976 2830 dbSNP
rs1390828317 2856 dbSNP
rs1008957560 2871 dbSNP
rs890710419 2876 dbSNP
rs984899020 2879 dbSNP
rs1053266671 2882 dbSNP
rs950900429 2885 dbSNP
rs934905754 2906 dbSNP
rs777562665 2918 dbSNP
rs1286213079 2930 dbSNP
rs779956337 2937 dbSNP
rs1223647281 2939 dbSNP
rs1484896092 2946 dbSNP
rs1260375124 2966 dbSNP
rs948859343 2977 dbSNP
rs757981670 2983 dbSNP
rs1261999700 3006 dbSNP
rs1459621980 3014 dbSNP
rs1211594715 3022 dbSNP
rs1237754953 3033 dbSNP
rs1057148753 3034 dbSNP
rs1312695660 3057 dbSNP
rs938624194 3060 dbSNP
rs753483126 3062 dbSNP
rs1472888034 3065 dbSNP
rs1175569584 3067 dbSNP
rs976289140 3071 dbSNP
rs1412886038 3073 dbSNP
rs1336229876 3085 dbSNP
rs927872491 3094 dbSNP
rs1359971836 3096 dbSNP
rs1338623589 3106 dbSNP
rs1441673516 3107 dbSNP
rs983408572 3132 dbSNP
rs757971820 3133 dbSNP
rs1229365116 3134 dbSNP
rs1283266857 3138 dbSNP
rs950597645 3139 dbSNP
rs1220517745 3140 dbSNP
rs1017680495 3155 dbSNP
rs752113437 3163 dbSNP
rs1289113475 3168 dbSNP
rs1436873617 3177 dbSNP
rs920457495 3183 dbSNP
rs750093376 3186 dbSNP
rs1253747096 3197 dbSNP
rs973617380 3200 dbSNP
rs1483282943 3202 dbSNP
rs188193391 3211 dbSNP
rs1266754786 3216 dbSNP
rs903561806 3219 dbSNP
rs1478932055 3220 dbSNP
rs1017732735 3221 dbSNP
rs1425901446 3225 dbSNP
rs77691679 3230 dbSNP
rs1409642476 3241 dbSNP
rs186535882 3258 dbSNP
rs1386415226 3264 dbSNP
rs181905126 3270 dbSNP
rs144756845 3276 dbSNP
rs1426837207 3277 dbSNP
rs1261078216 3279 dbSNP
rs999085526 3287 dbSNP
rs904771038 3292 dbSNP
rs190181172 3294 dbSNP
rs892285336 3301 dbSNP
rs1338126397 3310 dbSNP
rs1225503719 3319 dbSNP
rs1043243217 3328 dbSNP
rs1276393338 3354 dbSNP
rs773828089 3355 dbSNP
rs1289255004 3357 dbSNP
rs894559695 3358 dbSNP
rs1057453747 3360 dbSNP
rs185308694 3361 dbSNP
rs908570067 3370 dbSNP
rs1186746020 3388 dbSNP
rs1359807702 3410 dbSNP
rs1317098107 3411 dbSNP
rs948765244 3421 dbSNP
rs1163352010 3432 dbSNP
rs1388959700 3493 dbSNP
rs1225093594 3501 dbSNP
rs1325382285 3502 dbSNP
rs1324828392 3504 dbSNP
rs762340125 3511 dbSNP
rs1432331719 3518 dbSNP
rs909270714 3520 dbSNP
rs1047084152 3523 dbSNP
rs754353254 3542 dbSNP
rs929223791 3567 dbSNP
rs764661074 3573 dbSNP
rs919425487 3582 dbSNP
rs1358251751 3610 dbSNP
rs1365121368 3611 dbSNP
rs1302070226 3614 dbSNP
rs1424436369 3626 dbSNP
rs1283551102 3628 dbSNP
rs1463489494 3636 dbSNP
rs1366529245 3638 dbSNP
rs920484833 3652 dbSNP
rs1249913126 3654 dbSNP
rs973263572 3667 dbSNP
rs964869355 3672 dbSNP
rs976314006 3675 dbSNP
rs966662472 3676 dbSNP
rs1474006421 3685 dbSNP
rs761309265 3686 dbSNP
rs1456048726 3687 dbSNP
rs1194063146 3700 dbSNP
rs967726278 3711 dbSNP
rs1430374357 3721 dbSNP
rs1267049113 3737 dbSNP
rs1021993258 3747 dbSNP
rs1009316491 3750 dbSNP
rs1341884773 3760 dbSNP
rs892254396 3772 dbSNP
rs987665364 3777 dbSNP
rs1278672373 3781 dbSNP
rs775717803 3785 dbSNP
rs1327010817 3796 dbSNP
rs954443060 3797 dbSNP
rs1230097801 3801 dbSNP
rs1270124014 3807 dbSNP
rs1490459458 3816 dbSNP
rs1465429806 3817 dbSNP
rs1199918475 3828 dbSNP
rs1254403264 3828 dbSNP
rs1444338680 3832 dbSNP
rs1188680865 3836 dbSNP
rs1411630380 3868 dbSNP
rs1293625309 3879 dbSNP
rs1471915344 3891 dbSNP
rs1162050800 3896 dbSNP
rs1413316326 3898 dbSNP
rs1468891961 3910 dbSNP
rs1034814770 3956 dbSNP
rs767931553 3969 dbSNP
rs1338723600 3977 dbSNP
rs1251804850 3980 dbSNP
rs998447726 4008 dbSNP
rs1327959991 4028 dbSNP
rs905082861 4034 dbSNP
rs1411389942 4041 dbSNP
rs1045000103 4051 dbSNP
rs1322713019 4054 dbSNP
rs774435341 4059 dbSNP
rs1343028461 4064 dbSNP
rs1347412912 4074 dbSNP
rs887762460 4077 dbSNP
rs1049091652 4084 dbSNP
rs1405134303 4094 dbSNP
rs1482307591 4097 dbSNP
rs1022253001 4099 dbSNP
rs929388213 4101 dbSNP
rs1253255406 4111 dbSNP
rs1013092454 4115 dbSNP
rs1173364184 4123 dbSNP
rs894667890 4125 dbSNP
rs1378816603 4136 dbSNP
rs1326002463 4138 dbSNP
rs1466258563 4150 dbSNP
rs1167000589 4156 dbSNP
rs1057283193 4159 dbSNP
rs1411492933 4162 dbSNP
rs1040904669 4171 dbSNP
rs192827178 4177 dbSNP
rs1002988734 4181 dbSNP
rs944911986 4191 dbSNP
rs749513885 4195 dbSNP
rs753085751 4195 dbSNP
rs142986825 4196 dbSNP
rs770766592 4200 dbSNP
rs1427235932 4201 dbSNP
rs931262928 4205 dbSNP
rs1207753082 4213 dbSNP
rs12013224 4215 dbSNP
rs777810494 4230 dbSNP
rs1189941857 4238 dbSNP
rs1270054409 4252 dbSNP
rs146417169 4262 dbSNP
rs1187369561 4267 dbSNP
rs1388008200 4282 dbSNP
rs1431183241 4284 dbSNP
rs1169000656 4285 dbSNP
rs1271293548 4295 dbSNP
rs910400314 4296 dbSNP
rs1295273826 4300 dbSNP
rs748072039 4308 dbSNP
rs1387491912 4313 dbSNP
rs1437012803 4314 dbSNP
rs1296889080 4320 dbSNP
rs968328355 4323 dbSNP
rs1230827304 4326 dbSNP
rs987251247 4332 dbSNP
rs774658127 4335 dbSNP
rs933083799 4339 dbSNP
rs924339772 4344 dbSNP
rs977057903 4352 dbSNP
rs968753050 4366 dbSNP
rs142239511 4373 dbSNP
rs1219789919 4375 dbSNP
rs754473462 4387 dbSNP
rs992188018 4389 dbSNP
rs958975659 4390 dbSNP
rs1207560948 4411 dbSNP
rs1036283682 4417 dbSNP
rs753612720 4420 dbSNP
rs1320839989 4427 dbSNP
rs1003021247 4429 dbSNP
rs1188853528 4438 dbSNP
rs1262006446 4448 dbSNP
rs1223565663 4462 dbSNP
rs1421896625 4470 dbSNP
rs1166645646 4482 dbSNP
rs1350407701 4486 dbSNP
rs537426854 4498 dbSNP
rs887194183 4506 dbSNP
rs1034792525 4537 dbSNP
rs1003757443 4547 dbSNP
rs1025700465 4549 dbSNP
rs1325312476 4551 dbSNP
rs995583545 4553 dbSNP
rs1264049422 4556 dbSNP
rs770960399 4561 dbSNP
rs898529877 4562 dbSNP
rs1039689029 4567 dbSNP
rs766116459 4575 dbSNP
rs1023914428 4579 dbSNP
rs189907390 4586 dbSNP
rs773329980 4597 dbSNP
rs1265728583 4611 dbSNP
rs750783379 4623 dbSNP
rs1236607236 4632 dbSNP
rs1330176834 4632 dbSNP
rs1482033032 4641 dbSNP
rs767872288 4642 dbSNP
rs1414194733 4645 dbSNP
rs1472243555 4651 dbSNP
rs924369212 4659 dbSNP
rs1404503163 4670 dbSNP
rs977174077 4673 dbSNP
rs762238728 4680 dbSNP
rs947153126 4681 dbSNP
rs1446016382 4686 dbSNP
rs1470338171 4699 dbSNP
rs1356457044 4702 dbSNP
rs993462295 4710 dbSNP
rs1287070957 4717 dbSNP
rs914253251 4726 dbSNP
rs897890806 4739 dbSNP
rs1431806778 4757 dbSNP
rs575222380 4757 dbSNP
rs1310101010 4760 dbSNP
rs991143025 4763 dbSNP
rs558545518 4765 dbSNP
rs959234065 4769 dbSNP
rs768568352 4771 dbSNP
rs1482632487 4779 dbSNP
rs1214929759 4795 dbSNP
rs747015116 4797 dbSNP
rs1472837925 4806 dbSNP
rs1035907687 4809 dbSNP
rs1424484801 4811 dbSNP
rs910718128 4812 dbSNP
rs1364118838 4824 dbSNP
rs1051065433 4829 dbSNP
rs1376279077 4836 dbSNP
rs1429590578 4854 dbSNP
rs946918291 4871 dbSNP
rs1352881527 4874 dbSNP
rs1443503537 4880 dbSNP
rs1273766636 4894 dbSNP
rs373237029 4902 dbSNP
rs1364931633 4926 dbSNP
rs915496706 4931 dbSNP
rs981615318 4935 dbSNP
rs1280667456 4944 dbSNP
rs987780716 4951 dbSNP
rs1202764422 4956 dbSNP
rs774771862 4960 dbSNP
rs183879818 4962 dbSNP
rs138107081 4972 dbSNP
rs927646578 4975 dbSNP
rs1244878961 4976 dbSNP
rs1477115248 4978 dbSNP
rs1242436929 4980 dbSNP
rs981867531 4982 dbSNP
rs1025816628 4983 dbSNP
rs1449032424 4984 dbSNP
rs150344527 4987 dbSNP
rs1281711242 4990 dbSNP
rs1372759810 4992 dbSNP
rs1410854146 4995 dbSNP
rs1023461751 5002 dbSNP
rs779645978 5004 dbSNP
rs1222805625 5006 dbSNP
rs1350450899 5016 dbSNP
rs775733551 5019 dbSNP
rs766517 5020 dbSNP
rs1299581481 5021 dbSNP
rs1242743621 5022 dbSNP
rs371210445 5035 dbSNP
rs1018703721 5036 dbSNP
rs191397337 5042 dbSNP
rs1025534882 5046 dbSNP
rs1453480252 5049 dbSNP
rs1253652083 5052 dbSNP
rs1360908483 5056 dbSNP
rs1316538185 5073 dbSNP
rs746066271 5074 dbSNP
rs1400382926 5084 dbSNP
rs1392236725 5099 dbSNP
rs1475981317 5104 dbSNP
rs1163033696 5120 dbSNP
rs199883961 5125 dbSNP
rs1160294837 5128 dbSNP
rs993431261 5131 dbSNP
rs1051595771 5147 dbSNP
rs1326018886 5156 dbSNP
rs997378761 5160 dbSNP
rs1432223042 5167 dbSNP
rs897819071 5173 dbSNP
rs1243802453 5176 dbSNP
rs1282156237 5190 dbSNP
rs2320484 5194 dbSNP
rs1358409308 5204 dbSNP
rs1384535350 5219 dbSNP
rs1184061434 5220 dbSNP
rs771844677 5231 dbSNP
rs1464543137 5237 dbSNP
rs1019401453 5249 dbSNP
rs903062001 5250 dbSNP
rs1239826009 5266 dbSNP
rs1447727771 5270 dbSNP
rs186609951 5281 dbSNP
rs566630828 5282 dbSNP
rs758225223 5284 dbSNP
rs745460004 5312 dbSNP
rs1285899951 5313 dbSNP
rs1474076514 5339 dbSNP
rs1008974875 5346 dbSNP
rs778991298 5349 dbSNP
rs914305288 5350 dbSNP
rs1055873552 5354 dbSNP
rs946884029 5364 dbSNP
rs1357657549 5375 dbSNP
rs1291709517 5377 dbSNP
rs936989534 5378 dbSNP
rs894031889 5387 dbSNP
rs1381931289 5391 dbSNP
rs1326994875 5396 dbSNP
rs928277152 5406 dbSNP
rs1262506728 5414 dbSNP
rs1351697355 5449 dbSNP
rs1200045279 5451 dbSNP
rs1254299915 5498 dbSNP
rs1430086050 5502 dbSNP
rs1189078223 5506 dbSNP
rs1251735497 5510 dbSNP
rs1471863762 5519 dbSNP
rs1183387026 5520 dbSNP
rs1363832210 5521 dbSNP
rs377070337 5521 dbSNP
rs1465084599 5524 dbSNP
rs1327312637 5544 dbSNP
rs1300197541 5555 dbSNP
rs201421185 5556 dbSNP
rs935591370 5558 dbSNP
rs1364673266 5561 dbSNP
rs1164169857 5565 dbSNP
rs1201402563 5574 dbSNP
rs1435182316 5574 dbSNP
rs1307103686 5577 dbSNP
rs927650590 5585 dbSNP
rs183441424 5590 dbSNP
rs951591991 5597 dbSNP
rs1411528585 5600 dbSNP
rs918786565 5602 dbSNP
rs1309277173 5606 dbSNP
rs1185491747 5611 dbSNP
rs1232591114 5621 dbSNP
rs1475454232 5630 dbSNP
rs1264890383 5641 dbSNP
rs5933123 5642 dbSNP
rs963136662 5643 dbSNP
rs1482379420 5650 dbSNP
rs1489968572 5654 dbSNP
rs1198124313 5656 dbSNP
rs1251845760 5673 dbSNP
rs1018320906 5684 dbSNP
rs755743519 5690 dbSNP
rs1223656124 5693 dbSNP
rs1396515739 5701 dbSNP
rs1454398817 5706 dbSNP
rs1167748675 5724 dbSNP
rs1368425013 5737 dbSNP
rs1431365085 5747 dbSNP
rs1298725574 5751 dbSNP
rs1324085913 5757 dbSNP
rs1386353927 5758 dbSNP
rs1299211036 5767 dbSNP
rs955406749 5775 dbSNP
rs1235250022 5783 dbSNP
rs1297104893 5784 dbSNP
rs1340548139 5788 dbSNP
rs1029613487 5810 dbSNP
rs1252481248 5819 dbSNP
rs1488404867 5822 dbSNP
rs1340083340 5823 dbSNP
rs947798006 5827 dbSNP
rs1187581241 5832 dbSNP
rs1387911441 5835 dbSNP
rs997410100 5836 dbSNP
rs1170872885 5850 dbSNP
rs1324007593 5850 dbSNP
rs916320914 5850 dbSNP
rs750033840 5868 dbSNP
rs1403297086 5870 dbSNP
rs1320211799 5872 dbSNP
rs983895890 5878 dbSNP
rs1216698526 5892 dbSNP
rs1303591075 5895 dbSNP
rs1438333946 5914 dbSNP
rs6654646 5920 dbSNP
rs952561677 5920 dbSNP
rs1352761144 5933 dbSNP
rs560077588 5938 dbSNP
rs866148344 5958 dbSNP
rs1038022575 5966 dbSNP
rs1025462642 5970 dbSNP
rs1275559221 5975 dbSNP
rs536500861 5993 dbSNP
rs903081386 6003 dbSNP
rs757006720 6004 dbSNP
rs972608076 6009 dbSNP
rs151166958 6031 dbSNP
rs1011371641 6034 dbSNP
rs892888185 6035 dbSNP
rs1173591699 6036 dbSNP
rs562574310 6056 dbSNP
rs1186912192 6064 dbSNP
rs1255169405 6066 dbSNP
rs1479934258 6068 dbSNP
rs1269136858 6069 dbSNP
rs1055583109 6085 dbSNP
rs143058437 6092 dbSNP
rs1231683101 6097 dbSNP
rs1358268784 6098 dbSNP
rs1204375633 6115 dbSNP
rs1462096302 6121 dbSNP
rs928309701 6122 dbSNP
rs1343670109 6146 dbSNP
rs1433091481 6151 dbSNP
rs1289845917 6153 dbSNP
rs752116166 6153 dbSNP
rs764558405 6153 dbSNP
rs763057232 6154 dbSNP
rs1227249651 6155 dbSNP
rs752809375 6155 dbSNP
rs1255031659 6164 dbSNP
rs1318387127 6164 dbSNP
rs58571332 6164 dbSNP
rs796289590 6164 dbSNP
rs1482187822 6180 dbSNP
rs1221743918 6198 dbSNP
rs759694406 6204 dbSNP
rs1258147802 6214 dbSNP
rs1472192869 6217 dbSNP
rs930223833 6217 dbSNP
rs776848612 6221 dbSNP
rs1405829339 6229 dbSNP
rs918817871 6230 dbSNP
rs1220745673 6242 dbSNP
rs193255181 6265 dbSNP
rs1358785896 6270 dbSNP
rs761687619 6278 dbSNP
rs1433320509 6283 dbSNP
rs1370836633 6290 dbSNP
rs1356672568 6304 dbSNP
rs1409699887 6307 dbSNP
rs1009315849 6310 dbSNP
rs889180709 6311 dbSNP
rs1223841266 6313 dbSNP
rs1300248246 6331 dbSNP
rs1029093503 6341 dbSNP
rs974649145 6342 dbSNP
rs1280711497 6346 dbSNP
rs1482708495 6347 dbSNP
rs188614148 6355 dbSNP
rs1234513892 6364 dbSNP
rs911369705 6374 dbSNP
rs183733745 6380 dbSNP
rs191458153 6388 dbSNP
rs1424731343 6391 dbSNP
rs1334188822 6392 dbSNP
rs955437559 6395 dbSNP
rs1468827891 6409 dbSNP
rs140906395 6410 dbSNP
rs185798422 6422 dbSNP
rs935563433 6423 dbSNP
rs906789278 6425 dbSNP
rs745571509 6438 dbSNP
rs999461026 6441 dbSNP
rs780881163 6450 dbSNP
rs1046028941 6467 dbSNP
rs967272316 6506 dbSNP
rs1292375874 6527 dbSNP
rs947729981 6539 dbSNP
rs1435296649 6559 dbSNP
rs1406183393 6560 dbSNP
rs916304014 6578 dbSNP
rs1212575832 6604 dbSNP
rs1275118230 6608 dbSNP
rs1176958220 6622 dbSNP
rs1458647011 6636 dbSNP
rs1020168364 6637 dbSNP
rs931089013 6645 dbSNP
rs1201927216 6661 dbSNP
rs182611740 6665 dbSNP
rs972547293 6669 dbSNP
rs1256828879 6686 dbSNP
rs763021101 6687 dbSNP
rs1166446594 6689 dbSNP
rs1422283636 6692 dbSNP
rs1410967375 6707 dbSNP
rs893010085 6709 dbSNP
rs1314942616 6712 dbSNP
rs1442441936 6714 dbSNP
rs190000622 6725 dbSNP
rs1034580149 6727 dbSNP
rs1326242440 6767 dbSNP
rs1364008355 6789 dbSNP
rs1428392602 6830 dbSNP
rs1271659631 6835 dbSNP
rs965284366 6840 dbSNP
rs1227634417 6843 dbSNP
rs1001315145 6846 dbSNP
rs1019965751 6853 dbSNP
rs906922579 6861 dbSNP
rs1045442855 6865 dbSNP
rs763767473 6879 dbSNP
rs1475925845 6892 dbSNP
rs953489105 6892 dbSNP
rs1163243845 6897 dbSNP
rs1029021445 6916 dbSNP
rs897419225 6918 dbSNP
rs1164929536 6926 dbSNP
rs1038647123 6933 dbSNP
rs1451292988 6938 dbSNP
rs1398545511 6955 dbSNP
rs958144222 6962 dbSNP
rs1031141540 6971 dbSNP
rs1000105946 7008 dbSNP
rs906761903 7013 dbSNP
rs1047101829 7017 dbSNP
rs1235228109 7031 dbSNP
rs1012531467 7054 dbSNP
rs1350264932 7060 dbSNP
rs1203649227 7066 dbSNP
rs1406111282 7069 dbSNP
rs185309075 7071 dbSNP
rs1447999918 7076 dbSNP
rs1187677854 7079 dbSNP
rs1256032368 7079 dbSNP
rs894797901 7082 dbSNP
rs941603138 7088 dbSNP
rs1005849994 7100 dbSNP
rs1048089920 7103 dbSNP
rs1410531750 7105 dbSNP
rs911416192 7115 dbSNP
rs918336975 7157 dbSNP
rs1385216355 7167 dbSNP
rs1036799541 7178 dbSNP
rs1310786061 7179 dbSNP
rs986018711 7200 dbSNP
rs1377220986 7201 dbSNP
rs558632438 7209 dbSNP
rs943882744 7217 dbSNP
rs1287610559 7222 dbSNP
rs934097196 7228 dbSNP
rs1236963812 7229 dbSNP
rs922650973 7237 dbSNP
rs7058774 7238 dbSNP
rs201494458 7239 dbSNP
rs765238573 7251 dbSNP
rs966719215 7252 dbSNP
rs1440699370 7253 dbSNP
rs1212278443 7278 dbSNP
rs1022715269 7304 dbSNP
rs921920980 7305 dbSNP
rs369735266 7309 dbSNP
rs1183262343 7323 dbSNP
rs1182222668 7329 dbSNP
rs1477461775 7343 dbSNP
rs989490455 7346 dbSNP
rs958070602 7355 dbSNP
rs551089674 7358 dbSNP
rs1307410595 7363 dbSNP
rs1435076529 7363 dbSNP
rs1394249802 7400 dbSNP
rs1256907519 7417 dbSNP
rs1183642724 7419 dbSNP
rs1336604770 7422 dbSNP
rs554845056 7439 dbSNP
rs1031110769 7443 dbSNP
rs1301486883 7467 dbSNP
rs999673007 7470 dbSNP
rs1485048251 7472 dbSNP
rs767727112 7475 dbSNP
rs1197058407 7479 dbSNP
rs530792328 7494 dbSNP
rs1217070204 7495 dbSNP
rs759977810 7506 dbSNP
rs1191408065 7513 dbSNP
rs1034201786 7526 dbSNP
rs1025167383 7538 dbSNP
rs1012911652 7544 dbSNP
rs1454604043 7552 dbSNP
rs895409332 7562 dbSNP
rs1371282518 7565 dbSNP
rs1048008751 7584 dbSNP
rs1169757088 7597 dbSNP
rs995150474 7600 dbSNP
rs1440235926 7622 dbSNP
rs896878257 7632 dbSNP
rs1373383405 7640 dbSNP
rs1442116687 7641 dbSNP
rs1037175669 7661 dbSNP
rs759659248 7667 dbSNP
rs1001344460 7671 dbSNP
rs1306298441 7673 dbSNP
rs1230307647 7674 dbSNP
rs754066642 7694 dbSNP
rs912380664 7699 dbSNP
rs1245102723 7705 dbSNP
rs1211276361 7706 dbSNP
rs1049615391 7713 dbSNP
rs906953799 7723 dbSNP
rs914496459 7726 dbSNP
rs143996791 7732 dbSNP
rs993909438 7736 dbSNP
rs1430052917 7737 dbSNP
rs1193872972 7754 dbSNP
rs761740661 7770 dbSNP
rs1460989436 7771 dbSNP
rs1289022798 7772 dbSNP
rs180691445 7774 dbSNP
rs978565958 7777 dbSNP
rs1288476549 7783 dbSNP
rs1360371818 7805 dbSNP
rs1384257519 7818 dbSNP
rs1296999172 7846 dbSNP
rs140173027 7851 dbSNP
rs1230943349 7855 dbSNP
rs1274454902 7861 dbSNP
rs1335113489 7872 dbSNP
rs1214683788 7873 dbSNP
rs941648541 7878 dbSNP
rs1486758474 7892 dbSNP
rs1205499400 7897 dbSNP
rs5977656 7908 dbSNP
rs1256734488 7910 dbSNP
rs765484021 7911 dbSNP
rs1185936479 7912 dbSNP
rs1420163022 7914 dbSNP
rs991005241 7922 dbSNP
rs1158722246 7945 dbSNP
rs1343645114 7946 dbSNP
rs1383992665 7947 dbSNP
rs1455681716 7955 dbSNP
rs762987033 7956 dbSNP
rs959591194 7960 dbSNP
rs775492370 7962 dbSNP
rs1413434464 7972 dbSNP
rs372159598 7973 dbSNP
rs745358091 7973 dbSNP
rs769243933 7973 dbSNP
rs867524937 7973 dbSNP
rs1222693688 7974 dbSNP
rs866765839 7974 dbSNP
rs774619885 7984 dbSNP
rs1318288072 7988 dbSNP
rs1216263283 7991 dbSNP
rs1279289355 7992 dbSNP
rs1358869293 7993 dbSNP
rs1484548738 8008 dbSNP
rs1369537314 8013 dbSNP
rs867378315 8015 dbSNP
rs780745467 8031 dbSNP
rs1258120209 8038 dbSNP
rs1483655908 8039 dbSNP
rs1176621603 8040 dbSNP
rs1189786209 8044 dbSNP
rs1426741713 8046 dbSNP
rs995743679 8061 dbSNP
rs1261313248 8068 dbSNP
rs934128356 8081 dbSNP
rs886094951 8090 dbSNP
rs145421254 8092 dbSNP
rs978188356 8093 dbSNP
rs374787403 8096 dbSNP
rs1360246903 8107 dbSNP
rs1440844892 8108 dbSNP
rs190682921 8109 dbSNP
rs1375112642 8141 dbSNP
rs1008384504 8142 dbSNP
rs778127521 8158 dbSNP
rs890888717 8162 dbSNP
rs1345534929 8168 dbSNP
rs1357041332 8181 dbSNP
rs1280957012 8187 dbSNP
rs1306794355 8189 dbSNP
rs1049987817 8201 dbSNP
rs932491538 8215 dbSNP
rs1481643327 8251 dbSNP
rs1340701499 8254 dbSNP
rs1171356255 8255 dbSNP
rs758699406 8257 dbSNP
rs1453039390 8261 dbSNP
rs893030907 8273 dbSNP
rs1267144282 8280 dbSNP
rs1224622085 8293 dbSNP
rs187054122 8295 dbSNP
rs1446862004 8310 dbSNP
rs748673630 8322 dbSNP
rs1368245906 8326 dbSNP
rs1442845600 8328 dbSNP
rs1299525634 8331 dbSNP
rs1278468855 8357 dbSNP
rs989859776 8359 dbSNP
rs779463090 8360 dbSNP
rs1301737598 8367 dbSNP
rs1034640722 8369 dbSNP
rs1275006100 8370 dbSNP
rs182067504 8371 dbSNP
rs759341456 8379 dbSNP
rs753923731 8380 dbSNP
rs1392086644 8392 dbSNP
rs979939806 8395 dbSNP
rs1165446964 8399 dbSNP
rs1272791546 8400 dbSNP
rs971253916 8401 dbSNP
rs1460547906 8402 dbSNP
rs766320978 8416 dbSNP
rs1171433876 8426 dbSNP
rs1247695236 8426 dbSNP
rs993940202 8430 dbSNP
rs961402537 8438 dbSNP
rs1417420350 8441 dbSNP
rs918025046 8442 dbSNP
rs1016612398 8445 dbSNP
rs1163505816 8447 dbSNP
rs1391869620 8449 dbSNP
rs1005592152 8458 dbSNP
rs890054251 8464 dbSNP
rs1325694924 8476 dbSNP
rs1198509985 8493 dbSNP
rs1027133812 8500 dbSNP
rs974293290 8505 dbSNP
rs766566446 8509 dbSNP
rs756417836 8518 dbSNP
rs1269395719 8539 dbSNP
rs1050002783 8557 dbSNP
rs189905876 8559 dbSNP
rs1211907056 8575 dbSNP
rs1258190367 8590 dbSNP
rs1446848479 8601 dbSNP
rs41300315 8606 dbSNP
rs1321052828 8615 dbSNP
rs1244345671 8623 dbSNP
rs1282168843 8631 dbSNP
rs1478405287 8645 dbSNP
rs1186647141 8647 dbSNP
rs762826270 8653 dbSNP
rs1233001276 8660 dbSNP
rs1331990865 8667 dbSNP
rs1163543244 8686 dbSNP
rs1326143167 8692 dbSNP
rs1383787799 8693 dbSNP
rs1390203758 8698 dbSNP
rs1042521674 8702 dbSNP
rs1400178728 8703 dbSNP
rs945495846 8731 dbSNP
rs1319977967 8746 dbSNP
rs1361116467 8747 dbSNP
rs1414133733 8752 dbSNP
rs1291335927 8754 dbSNP
rs773274613 8755 dbSNP
rs1247078393 8756 dbSNP
rs915289976 8759 dbSNP
rs1053793674 8766 dbSNP
rs937974648 8775 dbSNP
rs1222444051 8776 dbSNP
rs1288547785 8777 dbSNP
rs769867321 8780 dbSNP
rs775335692 8781 dbSNP
rs1175904297 8794 dbSNP
rs1256014185 8803 dbSNP
rs1028086624 8820 dbSNP
rs996627259 8831 dbSNP
rs1362878655 8834 dbSNP
rs1468240679 8855 dbSNP
rs746862692 8859 dbSNP
rs1054332330 8867 dbSNP
rs1433853242 8882 dbSNP
rs926636430 8886 dbSNP
rs1377123128 8902 dbSNP
rs1397869003 8921 dbSNP
rs1334857467 8943 dbSNP
rs980055182 8947 dbSNP
rs934558611 8959 dbSNP
rs1418484321 8965 dbSNP
rs971283376 8967 dbSNP
rs917113580 8986 dbSNP
rs972531148 8997 dbSNP
rs961171175 8999 dbSNP
rs1234019470 9010 dbSNP
rs1278820845 9029 dbSNP
rs1347685477 9033 dbSNP
rs1017062546 9034 dbSNP
rs1262144613 9050 dbSNP
rs1435543075 9059 dbSNP
rs1042755962 9072 dbSNP
rs1346642518 9073 dbSNP
rs949425457 9074 dbSNP
rs1005295219 9075 dbSNP
rs953885130 9095 dbSNP
rs1376901647 9113 dbSNP
rs1396832580 9116 dbSNP
rs1466446882 9124 dbSNP
rs1167226516 9151 dbSNP
rs1310552737 9156 dbSNP
rs1449112875 9159 dbSNP
rs1403942642 9160 dbSNP
rs1333792723 9161 dbSNP
rs1415297442 9162 dbSNP
rs1404592548 9163 dbSNP
rs1156654940 9164 dbSNP
rs200211416 9168 dbSNP
rs1377841387 9169 dbSNP
rs1491398362 9169 dbSNP
rs765185961 9169 dbSNP
rs1491422013 9170 dbSNP
rs867091112 9170 dbSNP
rs998422919 9171 dbSNP
rs759347223 9172 dbSNP
rs1258315000 9173 dbSNP
rs776230654 9173 dbSNP
rs990843163 9174 dbSNP
rs1010108322 9175 dbSNP
rs770374022 9176 dbSNP
rs1054311926 9177 dbSNP
rs879192183 9178 dbSNP
rs1371265951 9183 dbSNP
rs1464140602 9187 dbSNP
rs1172835331 9188 dbSNP
rs1324101224 9188 dbSNP
rs1387703035 9188 dbSNP
rs1401332253 9188 dbSNP
rs201650234 9188 dbSNP
rs58119368 9188 dbSNP
rs746672104 9188 dbSNP
rs1443840840 9189 dbSNP
rs1219955090 9190 dbSNP
rs1278230238 9190 dbSNP
rs1333481559 9190 dbSNP
rs1281688597 9192 dbSNP
rs772850200 9192 dbSNP
rs1211490848 9199 dbSNP
rs928415409 9199 dbSNP
rs1460681746 9202 dbSNP
rs1488725074 9208 dbSNP
rs1204263595 9214 dbSNP
rs938104741 9215 dbSNP
rs1478735011 9217 dbSNP
rs1287397305 9218 dbSNP
rs1424475954 9224 dbSNP
rs1474912869 9238 dbSNP
rs1163028139 9239 dbSNP
rs1370348286 9266 dbSNP
rs1242905431 9270 dbSNP
rs1458747591 9275 dbSNP
rs1288601638 9286 dbSNP
rs986844449 9301 dbSNP
rs1402436454 9303 dbSNP
rs1381186856 9304 dbSNP
rs1354339187 9305 dbSNP
rs1230920286 9307 dbSNP
rs772484462 9315 dbSNP
rs1448832148 9316 dbSNP
rs1258696968 9320 dbSNP
rs1342560477 9335 dbSNP
rs1217315206 9337 dbSNP
rs1256711067 9345 dbSNP
rs1485387855 9352 dbSNP
rs1180130270 9362 dbSNP
rs1416257765 9368 dbSNP
rs1424569972 9369 dbSNP
rs1378904191 9375 dbSNP
rs1421889352 9385 dbSNP
rs1159856510 9394 dbSNP
rs1375307303 9395 dbSNP
rs34122502 9397 dbSNP
rs1445198893 9399 dbSNP
rs748525572 9400 dbSNP
rs1028432363 9410 dbSNP
rs775517362 9418 dbSNP
rs1304387229 9432 dbSNP
rs926634340 9444 dbSNP
rs1355670323 9446 dbSNP
rs1240517819 9453 dbSNP
rs996597720 9461 dbSNP
rs139378357 9466 dbSNP
rs1422718137 9484 dbSNP
rs1412956648 9498 dbSNP
rs1239323524 9510 dbSNP
rs957144608 9520 dbSNP
rs150879742 9530 dbSNP
rs1233151156 9532 dbSNP
rs749698980 9537 dbSNP
rs1179593424 9542 dbSNP
rs1395039408 9544 dbSNP
rs1413225054 9544 dbSNP
rs1178831536 9546 dbSNP
rs1359288739 9552 dbSNP
rs1240019993 9585 dbSNP
rs972601931 9593 dbSNP
rs1328873766 9601 dbSNP
rs1378579380 9602 dbSNP
rs1447269646 9613 dbSNP
rs1191971408 9625 dbSNP
rs903067746 9626 dbSNP
rs961540223 9627 dbSNP
rs909714593 9647 dbSNP
rs771721537 9656 dbSNP
rs1014608154 9658 dbSNP
rs953810117 9666 dbSNP
rs896483683 9676 dbSNP
rs1256416627 9736 dbSNP
rs1055082330 9742 dbSNP
rs1027960356 9746 dbSNP
rs780285234 9777 dbSNP
rs965605211 9781 dbSNP
rs1038479948 9785 dbSNP
rs140836665 9792 dbSNP
rs184115497 9806 dbSNP
rs1358496775 9814 dbSNP
rs908732679 9816 dbSNP
rs987052438 9820 dbSNP
rs1347960494 9829 dbSNP
rs894002195 9830 dbSNP
rs750730628 9836 dbSNP
rs191663384 9877 dbSNP
rs1002727866 9881 dbSNP
rs905249460 9886 dbSNP
rs1361118847 9893 dbSNP
rs1341332795 9916 dbSNP
rs756529737 9925 dbSNP
rs1320061670 9935 dbSNP
rs1299865275 9946 dbSNP
rs1272771616 9971 dbSNP
rs756953320 9975 dbSNP
rs748956646 9993 dbSNP
rs1485802271 9994 dbSNP
rs949325042 10026 dbSNP
rs897822874 10035 dbSNP
rs1477853816 10051 dbSNP
rs774210574 10053 dbSNP
rs1406626933 10054 dbSNP
rs955855294 10076 dbSNP
rs1037396291 10110 dbSNP
rs1323916322 10116 dbSNP
rs920925477 10119 dbSNP
rs975085333 10130 dbSNP
rs1299941431 10140 dbSNP
rs1477971761 10157 dbSNP
rs1425310239 10163 dbSNP
rs1219323936 10171 dbSNP
rs569368617 10196 dbSNP
rs35991216 10197 dbSNP
rs939935479 10206 dbSNP
rs758306053 10210 dbSNP
rs752563604 10212 dbSNP
rs909735238 10231 dbSNP
rs1032773301 10232 dbSNP
rs998633119 10232 dbSNP
rs188356344 10242 dbSNP
rs868402219 10247 dbSNP
rs755711088 10250 dbSNP
rs1487672746 10257 dbSNP
rs1024596209 10261 dbSNP
rs1186534386 10264 dbSNP
rs932423807 10273 dbSNP
rs759534666 10296 dbSNP
rs1222898202 10301 dbSNP
rs551015790 10308 dbSNP
rs1163446113 10310 dbSNP
rs920975639 10315 dbSNP
rs1228330230 10331 dbSNP
rs976393865 10357 dbSNP
rs1160456633 10371 dbSNP
rs965047351 10372 dbSNP
rs1400712378 10374 dbSNP
rs1020572815 10375 dbSNP
rs866954982 10378 dbSNP
rs1055009035 10381 dbSNP
rs988820760 10406 dbSNP
rs1318945731 10411 dbSNP
rs1450517906 10412 dbSNP
rs765942233 10414 dbSNP
rs1353522031 10417 dbSNP
rs916805700 10422 dbSNP
rs1002179442 10427 dbSNP
rs1238343543 10431 dbSNP
rs1288797441 10437 dbSNP
rs760167389 10447 dbSNP
rs748822073 10454 dbSNP
rs898558291 10454 dbSNP
rs958301456 10466 dbSNP
rs1032936241 10468 dbSNP
rs1237185204 10473 dbSNP
rs1366588354 10474 dbSNP
rs1002352215 10477 dbSNP
rs1180220671 10491 dbSNP
rs1380872511 10502 dbSNP
rs1434066385 10507 dbSNP
rs1170714181 10532 dbSNP
rs1400230662 10557 dbSNP
rs1416236687 10563 dbSNP
rs183647474 10585 dbSNP
rs1376358600 10588 dbSNP
rs905279212 10597 dbSNP
rs1352668374 10604 dbSNP
rs1311866852 10605 dbSNP
rs1378072031 10607 dbSNP
rs1233222165 10608 dbSNP
rs1051737544 10609 dbSNP
rs1330165804 10612 dbSNP
rs1025099506 10613 dbSNP
rs1465687185 10616 dbSNP
rs1200464473 10617 dbSNP
rs1402029931 10619 dbSNP
rs759209999 10623 dbSNP
rs761954655 10624 dbSNP
rs776649420 10627 dbSNP
rs1013675049 10628 dbSNP
rs934226991 10634 dbSNP
rs1173751220 10636 dbSNP
rs1431831476 10638 dbSNP
rs1379228621 10643 dbSNP
rs1479054978 10648 dbSNP
rs1173183213 10651 dbSNP
rs1323563216 10652 dbSNP
rs1399879423 10655 dbSNP
rs1424955236 10656 dbSNP
rs1464302613 10656 dbSNP
rs1192117501 10657 dbSNP
rs1333592334 10660 dbSNP
rs1479320929 10661 dbSNP
rs10617253 10662 dbSNP
rs1173182477 10662 dbSNP
rs1190500313 10662 dbSNP
rs1207783615 10662 dbSNP
rs1233375016 10662 dbSNP
rs1277061160 10662 dbSNP
rs1299832377 10662 dbSNP
rs1315500304 10662 dbSNP
rs1333279534 10662 dbSNP
rs1360859151 10662 dbSNP
rs1373798137 10662 dbSNP
rs1386562357 10662 dbSNP
rs1393283028 10662 dbSNP
rs1401556157 10662 dbSNP
rs1423070154 10662 dbSNP
rs1452070774 10662 dbSNP
rs1476875690 10662 dbSNP
rs532972014 10662 dbSNP
rs576761361 10662 dbSNP
rs58768895 10662 dbSNP
rs769453952 10662 dbSNP
rs770037340 10662 dbSNP
rs781214715 10662 dbSNP
rs781592826 10662 dbSNP
rs869251283 10662 dbSNP
rs879020944 10662 dbSNP
rs1236875425 10663 dbSNP
rs897853504 10669 dbSNP
rs1298104679 10671 dbSNP
rs1198090598 10678 dbSNP
rs771682142 10696 dbSNP
rs1278456558 10720 dbSNP
rs1260263626 10722 dbSNP
rs761333301 10724 dbSNP
rs774791063 10725 dbSNP
rs1267037465 10733 dbSNP
rs1356763618 10735 dbSNP
rs935638724 10739 dbSNP
rs1215878076 10741 dbSNP
rs1048706874 10747 dbSNP
rs1260931077 10752 dbSNP
rs192189845 10753 dbSNP
rs749870799 10754 dbSNP
rs1423427579 10768 dbSNP
rs976508561 10769 dbSNP
rs189132049 10782 dbSNP
rs967566323 10796 dbSNP
rs1425679736 10802 dbSNP
rs1308360036 10803 dbSNP
rs185456953 10805 dbSNP
rs987796021 10806 dbSNP
rs750763707 10819 dbSNP
rs746933409 10833 dbSNP
rs1393977989 10845 dbSNP
rs980943416 10868 dbSNP
rs1340913017 10876 dbSNP
rs958590645 10877 dbSNP
rs969584587 10879 dbSNP
rs745909716 10881 dbSNP
rs1218933954 10884 dbSNP
rs1261433642 10896 dbSNP
rs768039437 10900 dbSNP
rs1359368120 10904 dbSNP
rs1445631750 10912 dbSNP
rs962093211 10931 dbSNP
rs781376929 10949 dbSNP
rs1177329281 10951 dbSNP
rs1015360143 10955 dbSNP
rs1006185271 10965 dbSNP
rs1016929642 10969 dbSNP
rs1004294939 10970 dbSNP
rs1304232757 10973 dbSNP
rs888370625 10975 dbSNP
rs1406286839 10981 dbSNP
rs1445809797 10983 dbSNP
rs1048341609 10985 dbSNP
rs757519292 11006 dbSNP
rs1379012543 11008 dbSNP
rs1051235158 11020 dbSNP
rs996714356 11024 dbSNP
rs1440434816 11026 dbSNP
rs751677677 11027 dbSNP
rs1208038926 11028 dbSNP
rs899697515 11031 dbSNP
rs1039959055 11042 dbSNP
rs936274746 11047 dbSNP
rs1236787211 11048 dbSNP
rs925600409 11051 dbSNP
rs977498698 11059 dbSNP
rs778778264 11065 dbSNP
rs1430968929 11068 dbSNP
rs754728471 11069 dbSNP
rs1406406447 11075 dbSNP
rs755487961 11085 dbSNP
rs1328850723 11094 dbSNP
rs1402272030 11100 dbSNP
rs1351163042 11140 dbSNP
rs992647589 11141 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.724 1.5e-4 0.768 3.8e-5 20 Click to see details
GSE21687 Ependynoma primary tumors -0.314 5.8e-3 -0.308 6.6e-3 64 Click to see details
GSE32688 Pancreatic cancer 0.427 7.4e-3 0.415 9.1e-3 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.498 7.8e-3 -0.581 1.8e-3 23 Click to see details
GSE21032 Prostate cancer -0.221 2.2e-2 -0.148 9.1e-2 83 Click to see details
GSE19783 ER- ER- breast cancer 0.193 4.4e-2 0.182 5.4e-2 79 Click to see details
GSE19536 Breast cancer 0.158 5.8e-2 0.134 9.2e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.293 7.8e-2 -0.275 9.2e-2 25 Click to see details
GSE17306 Multiple myeloma 0.195 9.0e-2 0.238 5.0e-2 49 Click to see details
GSE38226 Liver fibrosis 0.296 9.6e-2 0.391 4.0e-2 21 Click to see details
GSE27834 Pluripotent stem cells -0.327 1.1e-1 -0.221 2.1e-1 16 Click to see details
GSE28544 Breast cancer 0.231 1.4e-1 -0.040 4.3e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.175 2.1e-1 -0.122 2.9e-1 24 Click to see details
GSE17498 Multiple myeloma -0.103 2.6e-1 -0.145 1.9e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.122 2.8e-1 0.230 1.3e-1 25 Click to see details
GSE21849 B cell lymphoma 0.112 2.8e-1 0.161 2.0e-1 29 Click to see details
GSE19350 CNS germ cell tumors 0.144 3.3e-1 0.378 1.1e-1 12 Click to see details
GSE14794 Lymphoblastoid cells 0.034 3.8e-1 0.093 1.9e-1 90 Click to see details
GSE28260 Renal cortex and medulla 0.072 4.1e-1 -0.016 4.8e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.054 4.1e-1 0.078 3.7e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.054 4.1e-1 0.078 3.7e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.669 0 0.709 0 32 Click to see details
PAAD 0.985 0.01 0.800 0.1 4 Click to see details
THCA 0.285 0.01 0.230 0.04 59 Click to see details
KIRC 0.212 0.04 0.234 0.03 68 Click to see details
ESCA -0.523 0.05 -0.282 0.2 11 Click to see details
CHOL -0.528 0.07 -0.533 0.07 9 Click to see details
UCEC 0.321 0.09 0.177 0.23 19 Click to see details
HNSC 0.203 0.1 0.212 0.09 42 Click to see details
LUAD 0.362 0.12 0.196 0.27 12 Click to see details
PCPG -0.92 0.13 -0.500 0.33 3 Click to see details
KIRP 0.186 0.15 0.239 0.09 32 Click to see details
CESC 0.87 0.16 0.500 0.33 3 Click to see details
LUSC -0.157 0.17 -0.174 0.15 38 Click to see details
KICH 0.193 0.18 0.223 0.14 25 Click to see details
COAD -0.31 0.23 -0.476 0.12 8 Click to see details
BLCA 0.163 0.26 0.183 0.23 18 Click to see details
PRAD -0.088 0.27 -0.020 0.45 50 Click to see details
LIHC -0.068 0.32 -0.085 0.28 49 Click to see details
BRCA -0.039 0.36 -0.036 0.37 84 Click to see details
BRCA -0.039 0.36 -0.036 0.37 84 Click to see details
BRCA -0.039 0.36 -0.036 0.37 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1