miRTarBase - #MIRT726677 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPS6KA3   
Synonyms CLS, HU-3, ISPK-1, MAPKAPK1B, MRX19, RSK, RSK2, S6K-alpha3, p90-RSK2, pp90RSK2
Description ribosomal protein S6 kinase A3
Transcript NM_004586   
Expression
Putative miRNA Targets on RPS6KA3
3'UTR of RPS6KA3
(miRNA target sites are highlighted)
>RPS6KA3|NM_004586|3'UTR
   1 AGTGACCTCAGTGAGATATTTGGTACCATGGTGTAAGCTGATAGCACAAGTTCTGGCGACAGGTAGCACGTATCTGAGAG
  81 ACACCTGCAAGCACACACTGTCCCAGCTGGTACCCATAATGCTGCTGTTCCTGCTGCTGCTCCTGCTTTCCTCTCTTCTC
 161 GCTTTAAATGATTGTTAGCAAGTTAGATTTTCCTGGAGCTTCGGAAGAAATGAAAATGGAAACATGATGAAGATATAGTC
 241 ACTGAATCAATGAGAAAAATAATGAACATATGAATACCACCTAAAAATACACTGAATAAAGTACACCATATAGCATTATT
 321 TTTATAGGAAATATTTCATGTCCCTTAAATATTCTTTGTTAGTTATAGGGATGGACAGTTTATGTTAAGCACTTAGCTTA
 401 AACAATCCGTTTATATTAGCACTGTATCCCTTGTGCCATCCAACATTTTGTATGTTTTTGTAAACAGTTCATATACAGTA
 481 CATTTCTGTACTGCTTTCTTTAATGTATACATGCCTTGTTTAACTTGGAATCTATTATTATTAATCAATTGACTATTAAA
 561 TCTGGTTAAATAGTTCACCTGGATTAACAGTATTGTTGGACAGTCCTAAAAATGGCCAGATTGTGGAACAGCTGTTGAAT
 641 GTAATACTTCCAAAATGTACATATCTTTCCCCACGTCTGTTTCACTGGTTCGTTCATTTGTTTGTTTCTTAAAGTCAGGT
 721 GCTCTGTCAGACTAACCTAGAGAGCTGTTATGGTAGAGAAAGTTATCATATGTGTGTGGCATGAAATCAAGAATACACCT
 801 ATGAAGTTAGTCCATATACTTTGCAACTCCTTAGAGTACTTTTTTCCTTAATTAAGGAAGTAGTCCTTGCACTTCTAATC
 881 TTACATAGCATCCATACTTAGAATTTGGCATATCATCTGGGATTTTGCCAATATACGTCAAAGCCCTTTAAGAGTCATGG
 961 TAAGGAGATGGGTGAAGGAAAATTTAGCAACAGGTAATTGAAGTCCTATTGGATATTTCATGTTTAAATAGATATTCTAT
1041 ATTAAACACTAATTTAAATGTAATAAAGGCCAAAGGCCTCTGTATGAAATTGGATTTAAACTTTCTTATTTTAGGGAATA
1121 AAACATTATTGATCAAACAGTATCTGTTCTAACCTAAAATTATAGGTAGGGCAGGCTAAGTGAACAGCATTGAGTATTTT
1201 CTGAATCCCTCATGATAATTTATAGCCACATACTGCTTCCTTTGACTTCAGGAATGATCAGTTTTCATAATGGCCACTGG
1281 GCCTGCTTAGATTGCAGTATTCATTATCTGCATCTAATTTGGTAGTTTCCACAATCGTATTTGATGAAAGAAACTTCAGT
1361 CCCCATTATTACCTGTGTCTTTGCCAAGCTGCCTAGCATACATCAGTATGTAATGTAAAAGACATATGAGCAAGAAAAAA
1441 GTGATTTAACTTACCTCATCAAGAATGTGCCCCTACAGGCCGGGCGCAGTGGCTCACGCCTGTAATCCCAGCATTTTGGG
1521 AGGCCGAGGCAGGTGGATCACCTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA
1601 AAATACAAAAATTAGCTGGGCATGGTGGCGTGCACCTGTAATCCTAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCTTG
1681 AACCTGGGAGGTGGTGGTTGCAGTGAGCCAAGATCACACCATTGCACTCCAGCCTGGGTGACAGAGTGAGACTCTGTCTC
1761 AAGAAGGAAAAAAAAAAAAAAGAATGTACTCATACAGATTTTTGTTAGTCATCATGTAATAAGCCATTTATATCAGAAAC
1841 CTTTTTTCCTGCCACAGAAGCTTTAAATTTTCCCCTAAGAGTACAAAGCCAAGAGAGTGTGGTTTATCTAAATGTCCTGA
1921 AATCCACTTGTCATTCCTTAATTTCTCCTCTATGCAATTAAAGAGAAAGGGGAAATCTATAACATTTCTTTTGCCCAAGT
2001 GACACAAAAATGATTACTGCATAGAAATCAAATGTAAGTTTAGCTTCTAAATGAAATAATATATAGGAGGGATATCAGAA
2081 TGTCTAGATAGAGAAAGTATTTTCAAATTCTTGAATATATGGATGCTATTAAAAGCTGCTTTCCATTGCCTGGAAAGAGA
2161 GCTTTTTTCCCTCCTCTATTCAGTGTTTCAAACTTTGGTCATCTCAAATTATTGTCACTTTTAAAATGTTAATGTCATTC
2241 TGAGCAGAAATAGATATATTTTCAGATTTTTTTACACTGATGCTACTCCGTAATTGCTTAGGAGTATTGTCCATCATAGT
2321 ATTTTAGAACTAGAAGTAAACACATAAATCCTTATAAATTACCCAATCCAACTTTCTCATATTGCATGTAGAGAACCTGA
2401 GACACATATCAAAGTCTAGAATCCTTAACTTCTCCCCATTTTGTTTTTTTCCGCCTCATCACACCATGCTGCCTTTCCCT
2481 CATATGATCACCAACCAGTAGCTGAGTTCAAAAACTACATATTTCTTGGGCAGTCCTCTACTGGTATGTGATGCCAACTT
2561 TTATTTCTTTCGAAGATAATTGCCTTCTTTGCCTAGCCAAGCAGCCAATTTTATTGGAGAAAAGCAAGTTATATGTTCAC
2641 AAAATGGAAGGCTTTCTACCTAAATTTATTTCATCTGTGGTCCTCTTATTCTCTTCCATTGCTTTTGACATACAGTGGAA
2721 AAACTTGGCCAACGATGTGCTCTAAATATAGTGCTTGTGTTGGGTTAACTTTTCCATTAATTTCTCAACATCAATTATTC
2801 AGGCCCCTACAGTTGTGGTATTGAGGCCCCTAAAGGCTTCTGCCTTTCACCAATTAGTGCTGCCAGTTACTGAGGCTTCT
2881 CCCAAAAGGTATCAGTCCAGTCTTAAAGATATTTCATTGTGAAAGAAGAAACTAAACTATCAGGCCTCTTTTACAAAATG
2961 AGAGATTGAATTTAAGCTTGTCAAGCACGTACTGGAAGGTATGAATTACACTACCATGTGTTTTGTATCTTCCCTTTCAA
3041 GTGATGATGTTAAATGAAGGTAAGTTTTTCATCCTTTTTTAATTTTTGTTTTTTATAAATCATTTCAGCTTTTTCTGGTT
3121 TATAGAGGTGTCTTATTTCTAATGCAACAGACCCCCAACTTTAACAGATTTGATATGGATGCATTTATTCACAAGCAACC
3201 CCAAAAGTCCAAAAATGTAATAATTTTGACAAGGCCCAAAGTTGAGATGCTATGAAGCTTGTGTGTGTGAAAAGTCAGTT
3281 ATGATTGTCTGGAGAGAAGCTGTGGTGTGTATGCTGTAGAGTTTCCACATTTCACATGCAGTGTACTCCAAAAAGCGGGT
3361 TTGGGTCAACCATTTCCCATCTCTTTTTAAGAAGTGACTGCTGTTGGGGCCAGGGGACATCATGGGAGGTGGGGCTGTCC
3441 AGTTAGCTGTGCCCTGCACCTTCAGCCCAGGAAAGATTTGAACAGAGCAAAGGCTTCAAGAGAGGGCAGAATGTATTCGG
3521 CAGAAAAGGGACTCAGGTAAGCCCAGCCTGGGATGAGAGCAGAAAAGCATTCAAGATTTGCAGGCCTTGCTATGGATGCG
3601 CTTAATCACCATGGAGGCCAGCAATACCCATCTCAGCATGGCTTTGATATTCTCTACTTCCTGGCCTTTAAAAATGACCT
3681 ATAATTTTTCAGTTTGCTTTACTATATTTTATAAAGAAAATTCTATCTTATGGTTGATTGAGCATTGAGACTTATGAAGG
3761 CATTAGGATAGATAGCTCAGGAATGTAAAGGTTCAGAAAAGGTCTGTTTTCTCAGATTAACAAATATGATGGATTCCATG
3841 GCTGACCTTGGTGCTTAAACCAGGAGGTTTCAATCTAGTCCTAGAGTTGTGTCCCTCTGAAAGGCCCAATGCCATGTAAC
3921 TAACTTTAAACTGGATATATACTTTGAGCCTTACTTAATTCACAGATAAGTTGACTTAACTCAGTATTTTTATTTCAATT
4001 AATGAAAACAGTCCTCTTTTCAACCCCAGGTTGCTTACATTTTGCTGGTCTCCCCAAGTGACCATTGGTGGAGACCAATT
4081 AATGAAGGAATGAAATTCACTTTATTGGGACTGTGGTATTCAACAGAGCCACACTTAACCACTTTTTCCAATGAAGAATC
4161 TCCAGAATGATAATGCCCAAATATGGATGGCCAAGAAGAATTTGTATCTACGGTGTGCTTTATGTGTTTTTGACACTGCT
4241 GTATTCTGTGTGATCAAGTGATTTGCAGCTGGTTCCAATGTGACTGAGTGTTCTCAAAGATTTCTAGTAACTAAGTCAAC
4321 TTAATTTTCTTAAGCCTGGTATTACTATCAGCCTCACATTTACCACTTTGATTCTAGTTTTTTAACTGTTCATAACAGGG
4401 CATACCGAGGGTTGGGATGAGAGCCTACTTCCTACCTCTTAAGGCACTTTCCTCATTATTTTGCCATATAATCTTGAACT
4481 GCATGATAAGCTGTTTAAATGTCCATGACTTCTCCCAGAGCAACTAGCAAAGTATATGACATTTTGAATAGAGATTAGTG
4561 GAAAGGAAAATGTAGAGATTTAAGTTCAGAGGTACAAACCTCAATAAAACCTCCTTAGAGCACATACCATGAGTAGAGTA
4641 TATGTAAACGTATATGAGAAGAGAGTCGCTATAATAGTCCTCTCTAAGTAGATTAGTTCATTGTCTAATGGAAGTGAACA
4721 TCTTTACTCCTGTTATCACCATAGTACTGAATGAACTGTATAATGAGTTTTTCAAACAAGTATTTAAAATAGAACTTTCA
4801 CGTACAAAGCAAGGGCATAAAGATTTTGGTTTGTGTTTCTGTAAGTGTAGTTTACCATCTAAAGCTTTGGTTTTTAATTT
4881 TAAAAAAAGCTTCAAGGTATTGCCATTCCTTAGCATCCTTATTGATTATGGGTGATGAGTTTTTAACTCTTAAAATCATA
4961 TACGTGTATTAGTTTATCTTAACTGTTGCCCTAAGCAAAAGGGAAGGTATACACCTAAGGGATGTACTTATTTTGCATTT
5041 TTGGTCATGGGTGGGAATGGGGTGGGTGCCTACTTAAATAGTTTTTAAAAAAGAAAAAAATCACAAATATTTTTCTACTG
5121 TTATATATGATCTTCCTTTATACTAGTTTCTCTCTAGTAAGGCATGCCAGAAGCCCAAGATACCATATCATGAATTCTTA
5201 CATATTGTACCTTTTGTTGGTGGTTAAATCGCATCAGATGCTTGGCATTGCTGCCATAATTATAAAATGCTTGTAAAGGA
5281 TCAAATATCACTAAATACTTTAAATTGTTTTACTTAAGAGTCTAATCTGGGAAGTTTTCAAATCATACTATTAATGTGTA
5361 ATCTAAGCTCTTCAGATGTATCCATGAATAATCCTGGAACAATATTGCTTGTATTCCTGTCATAGAACAGGTTTTGTAAT
5441 CTTTAAAAGAAATGAAAATTTATATAATAAAGTTTCAAATCAATGCAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              | |||| |  ||||||| 
Target 5' tggtACCCATAA--TGCTGCTg 3'
108 - 127 154.00 -13.00
2
miRNA  3' guguuUGG-UAAUACACGACGau 5'
               ||| |||| |||||||  
Target 5' ctttcACCAATTA-GTGCTGCca 3'
2844 - 2865 144.00 -14.50
3
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||: ||  || ||| ||||| 
Target 5' taCAGTACATTTCTGTACTGCTt 3'
474 - 496 132.00 -13.40
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766391101 1 dbSNP
rs1468940982 5 dbSNP
rs762586348 7 dbSNP
rs1392937949 14 dbSNP
rs1250749344 16 dbSNP
rs1275846866 22 dbSNP
rs375972859 22 dbSNP
rs769333991 31 dbSNP
rs1468348401 40 dbSNP
rs1029691098 57 dbSNP
rs767703625 58 dbSNP
rs1317661362 61 dbSNP
rs1228912952 63 dbSNP
rs998252112 70 dbSNP
rs1036545474 96 dbSNP
rs1215292100 97 dbSNP
rs111335669 98 dbSNP
rs1247088070 104 dbSNP
rs1480093437 106 dbSNP
rs759749923 132 dbSNP
rs940899354 140 dbSNP
rs917493208 146 dbSNP
rs991805052 161 dbSNP
rs11550965 166 dbSNP
rs1018110166 169 dbSNP
rs999993308 173 dbSNP
rs1170501771 175 dbSNP
rs1278751755 175 dbSNP
rs904356751 183 dbSNP
rs1041998795 193 dbSNP
rs946016061 194 dbSNP
rs1439666496 195 dbSNP
rs1300173660 196 dbSNP
rs939049414 202 dbSNP
rs1414172659 203 dbSNP
rs1331589817 225 dbSNP
rs746752575 226 dbSNP
rs926391384 232 dbSNP
rs980514900 234 dbSNP
rs895456379 240 dbSNP
rs183365804 251 dbSNP
rs1290325617 267 dbSNP
rs137925384 268 dbSNP
rs112566025 271 dbSNP
rs1202202975 277 dbSNP
rs1234189393 278 dbSNP
rs1022058956 290 dbSNP
rs987934629 292 dbSNP
rs927012662 308 dbSNP
rs973130874 338 dbSNP
rs1254845540 349 dbSNP
rs1476457682 361 dbSNP
rs773648586 371 dbSNP
rs769272492 388 dbSNP
rs1441927228 391 dbSNP
rs1408513298 392 dbSNP
rs941510124 405 dbSNP
rs774119187 409 dbSNP
rs983424364 422 dbSNP
rs1311121639 426 dbSNP
rs1357491569 466 dbSNP
rs1450111630 475 dbSNP
rs747840199 476 dbSNP
rs770539818 478 dbSNP
rs1361192459 481 dbSNP
rs1222321525 494 dbSNP
rs1276541875 495 dbSNP
rs1342409095 503 dbSNP
rs780772299 505 dbSNP
rs1322260070 511 dbSNP
rs1283470089 524 dbSNP
rs1221916705 535 dbSNP
rs1277572597 544 dbSNP
rs768138743 544 dbSNP
rs762511654 548 dbSNP
rs772666701 549 dbSNP
rs1187651458 574 dbSNP
rs976780932 582 dbSNP
rs770270664 588 dbSNP
rs746567964 599 dbSNP
rs1474730369 612 dbSNP
rs748665372 616 dbSNP
rs1188602245 618 dbSNP
rs781485965 620 dbSNP
rs1018331326 621 dbSNP
rs1439744382 622 dbSNP
rs1000297887 632 dbSNP
rs968945549 641 dbSNP
rs956613133 643 dbSNP
rs1020141992 650 dbSNP
rs1019311503 661 dbSNP
rs149242733 663 dbSNP
rs1415047524 674 dbSNP
rs1010569770 675 dbSNP
rs758360641 675 dbSNP
rs1008896112 679 dbSNP
rs953525604 679 dbSNP
rs763785773 683 dbSNP
rs191110223 692 dbSNP
rs1233089866 708 dbSNP
rs1316830269 714 dbSNP
rs778778228 718 dbSNP
rs1381280218 730 dbSNP
rs1173362029 742 dbSNP
rs994893732 747 dbSNP
rs899266000 750 dbSNP
rs1249030442 751 dbSNP
rs185464716 753 dbSNP
rs1005063010 755 dbSNP
rs1397078154 761 dbSNP
rs1478493287 765 dbSNP
rs905556279 766 dbSNP
rs1191912453 767 dbSNP
rs1485577067 790 dbSNP
rs1037385596 801 dbSNP
rs1398881053 815 dbSNP
rs941817718 817 dbSNP
rs1322539846 827 dbSNP
rs939013416 840 dbSNP
rs182279239 842 dbSNP
rs1323678521 856 dbSNP
rs1332414154 880 dbSNP
rs1044724800 885 dbSNP
rs780296618 903 dbSNP
rs767902201 917 dbSNP
rs1047266916 920 dbSNP
rs189661956 921 dbSNP
rs1136247 930 dbSNP
rs138386284 936 dbSNP
rs922842697 937 dbSNP
rs1212159452 952 dbSNP
rs758603277 962 dbSNP
rs987924796 972 dbSNP
rs1345302020 975 dbSNP
rs956786245 981 dbSNP
rs911793920 995 dbSNP
rs1219364835 1008 dbSNP
rs1412568327 1028 dbSNP
rs1460875275 1032 dbSNP
rs1360636408 1034 dbSNP
rs1162500859 1038 dbSNP
rs766945022 1042 dbSNP
rs987822513 1054 dbSNP
rs911237054 1076 dbSNP
rs1327837090 1101 dbSNP
rs1333627904 1104 dbSNP
rs1411086750 1105 dbSNP
rs763529024 1141 dbSNP
rs1334743267 1171 dbSNP
rs1402433793 1180 dbSNP
rs1267604761 1220 dbSNP
rs1357572119 1244 dbSNP
rs773382138 1250 dbSNP
rs1471277876 1260 dbSNP
rs750509256 1261 dbSNP
rs994842853 1276 dbSNP
rs968872776 1296 dbSNP
rs186465753 1297 dbSNP
rs1474820680 1310 dbSNP
rs1010037922 1316 dbSNP
rs1005051142 1321 dbSNP
rs113253395 1336 dbSNP
rs1167141786 1337 dbSNP
rs1393811971 1337 dbSNP
rs1431305784 1344 dbSNP
rs756069500 1351 dbSNP
rs1417494147 1360 dbSNP
rs1195871557 1392 dbSNP
rs1057369882 1395 dbSNP
rs1315377774 1400 dbSNP
rs1478771823 1401 dbSNP
rs1227094794 1412 dbSNP
rs1263733691 1413 dbSNP
rs1249994367 1427 dbSNP
rs1344553596 1430 dbSNP
rs776241127 1441 dbSNP
rs1279696615 1447 dbSNP
rs906135910 1457 dbSNP
rs1001420386 1458 dbSNP
rs905522112 1469 dbSNP
rs1037351855 1471 dbSNP
rs1424351523 1473 dbSNP
rs1192176253 1476 dbSNP
rs114655077 1482 dbSNP
rs111612110 1483 dbSNP
rs1210347433 1485 dbSNP
rs752717737 1486 dbSNP
rs1464051462 1488 dbSNP
rs746478108 1498 dbSNP
rs1403468207 1500 dbSNP
rs1382201785 1505 dbSNP
rs930118737 1506 dbSNP
rs1292853500 1509 dbSNP
rs1219862288 1510 dbSNP
rs922782920 1514 dbSNP
rs1052157629 1522 dbSNP
rs1041287820 1526 dbSNP
rs1302880393 1534 dbSNP
rs774999202 1535 dbSNP
rs1212273361 1536 dbSNP
rs1256716680 1546 dbSNP
rs771841973 1561 dbSNP
rs745817380 1562 dbSNP
rs1204558336 1574 dbSNP
rs1245954171 1576 dbSNP
rs1451039116 1585 dbSNP
rs1188983365 1586 dbSNP
rs911225394 1587 dbSNP
rs181963682 1588 dbSNP
rs947385172 1589 dbSNP
rs1377735145 1603 dbSNP
rs1352918835 1606 dbSNP
rs1453665003 1612 dbSNP
rs913277426 1613 dbSNP
rs1172917638 1626 dbSNP
rs1391486026 1627 dbSNP
rs759384648 1629 dbSNP
rs1325677792 1630 dbSNP
rs1466207169 1632 dbSNP
rs1221196489 1634 dbSNP
rs1424322795 1641 dbSNP
rs935163964 1642 dbSNP
rs1187111346 1654 dbSNP
rs1316475397 1656 dbSNP
rs1236994869 1663 dbSNP
rs959873078 1664 dbSNP
rs1035517287 1671 dbSNP
rs751458765 1673 dbSNP
rs1182185459 1675 dbSNP
rs757055754 1676 dbSNP
rs1487281302 1680 dbSNP
rs987340222 1688 dbSNP
rs1200045778 1692 dbSNP
rs1267421565 1693 dbSNP
rs979970460 1698 dbSNP
rs1273148871 1707 dbSNP
rs1417941625 1717 dbSNP
rs1156321092 1721 dbSNP
rs1414770233 1756 dbSNP
rs1243288468 1758 dbSNP
rs1323973899 1760 dbSNP
rs1313896343 1763 dbSNP
rs1164623220 1767 dbSNP
rs1348574117 1769 dbSNP
rs1372882713 1782 dbSNP
rs953378873 1782 dbSNP
rs1408040322 1784 dbSNP
rs969985851 1795 dbSNP
rs1391117573 1825 dbSNP
rs1331101401 1830 dbSNP
rs749078121 1842 dbSNP
rs1272310798 1844 dbSNP
rs1319764345 1852 dbSNP
rs1371538976 1853 dbSNP
rs1333606469 1867 dbSNP
rs1246859669 1895 dbSNP
rs1480124382 1899 dbSNP
rs1179358925 1917 dbSNP
rs1447681356 1922 dbSNP
rs1473203092 1926 dbSNP
rs1187946825 1928 dbSNP
rs1393791697 1932 dbSNP
rs1407370462 1945 dbSNP
rs1162832350 1983 dbSNP
rs1456353092 1989 dbSNP
rs112349695 2008 dbSNP
rs973394903 2019 dbSNP
rs781526087 2020 dbSNP
rs1428121783 2021 dbSNP
rs1005851615 2043 dbSNP
rs190321307 2051 dbSNP
rs777763952 2066 dbSNP
rs1418271223 2067 dbSNP
rs983971610 2072 dbSNP
rs766052124 2076 dbSNP
rs762518861 2089 dbSNP
rs751632956 2110 dbSNP
rs1290357053 2112 dbSNP
rs1340982316 2113 dbSNP
rs960165922 2117 dbSNP
rs766570191 2119 dbSNP
rs1026037937 2121 dbSNP
rs1457899082 2143 dbSNP
rs1483062699 2148 dbSNP
rs1251856924 2162 dbSNP
rs758472707 2177 dbSNP
rs750927757 2179 dbSNP
rs868675913 2190 dbSNP
rs765709943 2203 dbSNP
rs1182787012 2218 dbSNP
rs772719028 2247 dbSNP
rs1041276248 2251 dbSNP
rs7051785 2254 dbSNP
rs1351938248 2259 dbSNP
rs1170783929 2263 dbSNP
rs1371417440 2274 dbSNP
rs1434113247 2274 dbSNP
rs1332310650 2279 dbSNP
rs906115697 2282 dbSNP
rs1450175584 2285 dbSNP
rs777006822 2286 dbSNP
rs1311796441 2290 dbSNP
rs763684715 2298 dbSNP
rs890009825 2304 dbSNP
rs1241190802 2311 dbSNP
rs1370464489 2334 dbSNP
rs1323989592 2335 dbSNP
rs1043704026 2354 dbSNP
rs1275947412 2355 dbSNP
rs1444608472 2358 dbSNP
rs1392865955 2369 dbSNP
rs1211526618 2370 dbSNP
rs34935677 2376 dbSNP
rs1241881079 2396 dbSNP
rs35161999 2400 dbSNP
rs1294015788 2406 dbSNP
rs760328707 2407 dbSNP
rs913237806 2409 dbSNP
rs988900106 2432 dbSNP
rs938791207 2439 dbSNP
rs35080296 2442 dbSNP
rs979939371 2449 dbSNP
rs1394028654 2451 dbSNP
rs771601192 2451 dbSNP
rs969872762 2452 dbSNP
rs745422670 2453 dbSNP
rs1452823034 2457 dbSNP
rs7064020 2460 dbSNP
rs1205027790 2463 dbSNP
rs950382498 2468 dbSNP
rs770807697 2469 dbSNP
rs1272573017 2470 dbSNP
rs1346584065 2486 dbSNP
rs1487573681 2503 dbSNP
rs769196336 2517 dbSNP
rs1217735572 2519 dbSNP
rs1347438042 2524 dbSNP
rs997274234 2539 dbSNP
rs1249088240 2548 dbSNP
rs1273284365 2557 dbSNP
rs901629501 2558 dbSNP
rs1348403289 2560 dbSNP
rs1248683956 2561 dbSNP
rs868555805 2571 dbSNP
rs1331718771 2572 dbSNP
rs1294890602 2575 dbSNP
rs1399348966 2580 dbSNP
rs1158098959 2583 dbSNP
rs747356497 2589 dbSNP
rs1455618608 2602 dbSNP
rs7051161 2608 dbSNP
rs1043285777 2614 dbSNP
rs1385867317 2622 dbSNP
rs1321110985 2631 dbSNP
rs931868546 2633 dbSNP
rs921844685 2645 dbSNP
rs1420074256 2652 dbSNP
rs186670813 2665 dbSNP
rs1349152284 2677 dbSNP
rs891777302 2681 dbSNP
rs1170424876 2682 dbSNP
rs56377002 2686 dbSNP
rs779013427 2698 dbSNP
rs973342653 2701 dbSNP
rs747229415 2707 dbSNP
rs928687911 2708 dbSNP
rs1452427846 2710 dbSNP
rs1044462191 2714 dbSNP
rs1477137623 2721 dbSNP
rs1265896879 2724 dbSNP
rs1217878110 2733 dbSNP
rs941998929 2734 dbSNP
rs948530089 2735 dbSNP
rs757385850 2736 dbSNP
rs1471569311 2741 dbSNP
rs984710115 2743 dbSNP
rs1364327112 2753 dbSNP
rs1457162883 2758 dbSNP
rs1161278387 2772 dbSNP
rs983492353 2779 dbSNP
rs181544007 2786 dbSNP
rs758481332 2789 dbSNP
rs1306841656 2792 dbSNP
rs1348148993 2794 dbSNP
rs781262903 2797 dbSNP
rs975714151 2801 dbSNP
rs1289451277 2811 dbSNP
rs750506111 2816 dbSNP
rs1340431449 2838 dbSNP
rs201718012 2840 dbSNP
rs1250842614 2853 dbSNP
rs1035809900 2869 dbSNP
rs1216802145 2875 dbSNP
rs796694777 2878 dbSNP
rs1204786556 2882 dbSNP
rs1272560710 2885 dbSNP
rs1338422479 2888 dbSNP
rs1484046451 2893 dbSNP
rs965706808 2900 dbSNP
rs1400439361 2912 dbSNP
rs1251107357 2917 dbSNP
rs1423197908 2931 dbSNP
rs1339620629 2945 dbSNP
rs1370018153 2946 dbSNP
rs1444861719 2967 dbSNP
rs537070574 2975 dbSNP
rs1007329155 2981 dbSNP
rs12010722 2989 dbSNP
rs1332847323 2991 dbSNP
rs1431060887 2995 dbSNP
rs970221806 2996 dbSNP
rs751304288 3005 dbSNP
rs1394839409 3009 dbSNP
rs1336550884 3013 dbSNP
rs1402406602 3034 dbSNP
rs1228150264 3046 dbSNP
rs1295594690 3060 dbSNP
rs1166817401 3081 dbSNP
rs766102558 3089 dbSNP
rs757723941 3090 dbSNP
rs1255538559 3095 dbSNP
rs1426470238 3119 dbSNP
rs188510492 3122 dbSNP
rs1011827644 3128 dbSNP
rs1198727992 3130 dbSNP
rs1258197284 3137 dbSNP
rs1461550725 3147 dbSNP
rs1187730592 3148 dbSNP
rs764441745 3152 dbSNP
rs1021817185 3170 dbSNP
rs1450993344 3176 dbSNP
rs1475141836 3182 dbSNP
rs892075444 3199 dbSNP
rs1236104171 3217 dbSNP
rs1464968922 3223 dbSNP
rs761090880 3229 dbSNP
rs1305054096 3232 dbSNP
rs1407484026 3234 dbSNP
rs1011753771 3235 dbSNP
rs1434776277 3238 dbSNP
rs752326953 3249 dbSNP
rs183795967 3250 dbSNP
rs149126485 3252 dbSNP
rs145207444 3263 dbSNP
rs1044428558 3267 dbSNP
rs1031044229 3268 dbSNP
rs770844828 3275 dbSNP
rs948833135 3286 dbSNP
rs909027290 3296 dbSNP
rs1324212021 3303 dbSNP
rs1207853853 3305 dbSNP
rs1246005153 3309 dbSNP
rs750073198 3323 dbSNP
rs1186799664 3340 dbSNP
rs762989095 3342 dbSNP
rs1266253118 3344 dbSNP
rs929164756 3349 dbSNP
rs1177645203 3354 dbSNP
rs1259964668 3357 dbSNP
rs1219207369 3360 dbSNP
rs1355493143 3361 dbSNP
rs1454491865 3364 dbSNP
rs1293092373 3385 dbSNP
rs931786207 3389 dbSNP
rs900366923 3399 dbSNP
rs1284055740 3404 dbSNP
rs919132090 3406 dbSNP
rs1227780110 3414 dbSNP
rs180861530 3416 dbSNP
rs941905582 3430 dbSNP
rs1216248762 3433 dbSNP
rs1264456952 3434 dbSNP
rs188000869 3441 dbSNP
rs965674250 3447 dbSNP
rs1340772207 3454 dbSNP
rs1192410859 3458 dbSNP
rs1269027151 3459 dbSNP
rs1472549881 3472 dbSNP
rs910249501 3476 dbSNP
rs985859975 3484 dbSNP
rs1330238779 3490 dbSNP
rs1414857639 3493 dbSNP
rs1401608974 3505 dbSNP
rs907798065 3506 dbSNP
rs1348335501 3512 dbSNP
rs764981216 3515 dbSNP
rs1459676475 3518 dbSNP
rs1370088282 3519 dbSNP
rs1170709911 3522 dbSNP
rs968243186 3534 dbSNP
rs1375489829 3535 dbSNP
rs1311805812 3539 dbSNP
rs1319521811 3557 dbSNP
rs1405304915 3559 dbSNP
rs1223402991 3563 dbSNP
rs1291854821 3565 dbSNP
rs769698871 3572 dbSNP
rs748003870 3573 dbSNP
rs1412174486 3578 dbSNP
rs983825871 3586 dbSNP
rs780288469 3591 dbSNP
rs1165428858 3592 dbSNP
rs772212082 3599 dbSNP
rs1232575361 3606 dbSNP
rs866705729 3616 dbSNP
rs1012124467 3620 dbSNP
rs956234794 3635 dbSNP
rs776172835 3636 dbSNP
rs745907337 3637 dbSNP
rs1164385021 3644 dbSNP
rs1389785429 3663 dbSNP
rs1427862221 3666 dbSNP
rs1176970524 3670 dbSNP
rs1309964514 3675 dbSNP
rs970128249 3681 dbSNP
rs1003090533 3690 dbSNP
rs1442892948 3694 dbSNP
rs764578516 3702 dbSNP
rs761172648 3706 dbSNP
rs1247919315 3731 dbSNP
rs990279869 3733 dbSNP
rs149737107 3734 dbSNP
rs775878780 3741 dbSNP
rs1031957707 3750 dbSNP
rs999595731 3755 dbSNP
rs1049149659 3763 dbSNP
rs1236241101 3778 dbSNP
rs1287640021 3781 dbSNP
rs1184630694 3782 dbSNP
rs1247593902 3788 dbSNP
rs929109941 3791 dbSNP
rs376109810 3794 dbSNP
rs772356984 3802 dbSNP
rs1040301930 3806 dbSNP
rs944630240 3818 dbSNP
rs910218379 3826 dbSNP
rs1410452489 3827 dbSNP
rs1237533949 3829 dbSNP
rs1378578277 3836 dbSNP
rs1454332579 3838 dbSNP
rs113632608 3843 dbSNP
rs1363971541 3856 dbSNP
rs1432534137 3871 dbSNP
rs946410171 3873 dbSNP
rs900253935 3875 dbSNP
rs914934829 3879 dbSNP
rs1218131196 3895 dbSNP
rs1277069978 3909 dbSNP
rs184765410 3916 dbSNP
rs1204690123 3928 dbSNP
rs1326082888 3933 dbSNP
rs1463712174 3941 dbSNP
rs956371407 3952 dbSNP
rs1190816131 3958 dbSNP
rs1406361341 3970 dbSNP
rs1006068989 3974 dbSNP
rs193049962 3998 dbSNP
rs1422945758 4011 dbSNP
rs756442116 4014 dbSNP
rs1176879459 4018 dbSNP
rs1387705376 4022 dbSNP
rs1157181205 4028 dbSNP
rs529280346 4034 dbSNP
rs1326687358 4038 dbSNP
rs1441792340 4052 dbSNP
rs1435069037 4055 dbSNP
rs1381084675 4060 dbSNP
rs1272623501 4071 dbSNP
rs938675860 4073 dbSNP
rs1347910669 4074 dbSNP
rs1224737020 4084 dbSNP
rs749374482 4087 dbSNP
rs1023182334 4100 dbSNP
rs928621317 4110 dbSNP
rs1477075893 4129 dbSNP
rs1207266826 4139 dbSNP
rs1285170427 4148 dbSNP
rs1013295542 4151 dbSNP
rs1219421486 4157 dbSNP
rs1044378351 4160 dbSNP
rs1481369294 4177 dbSNP
rs1223715271 4179 dbSNP
rs1452058093 4192 dbSNP
rs1471463717 4201 dbSNP
rs1285055367 4211 dbSNP
rs1214093587 4212 dbSNP
rs887803844 4221 dbSNP
rs1404443248 4244 dbSNP
rs1028127762 4251 dbSNP
rs767150286 4256 dbSNP
rs759123950 4263 dbSNP
rs751015310 4278 dbSNP
rs188787217 4280 dbSNP
rs765801948 4285 dbSNP
rs1405044309 4286 dbSNP
rs1288200270 4299 dbSNP
rs1349214941 4316 dbSNP
rs1218180602 4339 dbSNP
rs200643266 4347 dbSNP
rs1355905466 4361 dbSNP
rs948783808 4366 dbSNP
rs897635592 4369 dbSNP
rs773259872 4379 dbSNP
rs1490514110 4386 dbSNP
rs1250920618 4390 dbSNP
rs1437835398 4399 dbSNP
rs1183686270 4401 dbSNP
rs1360385022 4406 dbSNP
rs769891885 4407 dbSNP
rs990265114 4428 dbSNP
rs1386713860 4435 dbSNP
rs867467370 4436 dbSNP
rs944599086 4445 dbSNP
rs368616130 4467 dbSNP
rs1424701106 4483 dbSNP
rs889000155 4503 dbSNP
rs778007065 4506 dbSNP
rs1036040172 4509 dbSNP
rs956231656 4516 dbSNP
rs868375457 4517 dbSNP
rs924854284 4520 dbSNP
rs1329948411 4539 dbSNP
rs987104604 4540 dbSNP
rs955820433 4541 dbSNP
rs1029957650 4550 dbSNP
rs761656990 4558 dbSNP
rs1360461443 4559 dbSNP
rs1227730989 4561 dbSNP
rs1272626944 4570 dbSNP
rs754906854 4574 dbSNP
rs995859269 4587 dbSNP
rs946350575 4590 dbSNP
rs1175604170 4600 dbSNP
rs914925374 4605 dbSNP
rs776311012 4606 dbSNP
rs752744527 4610 dbSNP
rs1244548041 4614 dbSNP
rs1444917835 4616 dbSNP
rs772275736 4616 dbSNP
rs746078129 4623 dbSNP
rs935116919 4626 dbSNP
rs1168929705 4634 dbSNP
rs746940575 4649 dbSNP
rs779257454 4650 dbSNP
rs770980883 4652 dbSNP
rs373118422 4656 dbSNP
rs1489135041 4661 dbSNP
rs779856257 4667 dbSNP
rs1002756188 4668 dbSNP
rs139614664 4673 dbSNP
rs907134439 4679 dbSNP
rs1344250610 4686 dbSNP
rs1280143483 4698 dbSNP
rs1264844228 4712 dbSNP
rs1461478897 4723 dbSNP
rs1044347514 4729 dbSNP
rs1219238329 4736 dbSNP
rs952129040 4741 dbSNP
rs1429729011 4746 dbSNP
rs1377534945 4756 dbSNP
rs185124420 4771 dbSNP
rs1407378293 4780 dbSNP
rs748488989 4780 dbSNP
rs1457061414 4786 dbSNP
rs914641266 4788 dbSNP
rs1302579699 4789 dbSNP
rs1464740749 4790 dbSNP
rs1364388643 4794 dbSNP
rs1361040773 4799 dbSNP
rs1054508127 4801 dbSNP
rs1300738688 4802 dbSNP
rs934815542 4824 dbSNP
rs1221670026 4828 dbSNP
rs1285129105 4831 dbSNP
rs924768647 4837 dbSNP
rs1207911577 4856 dbSNP
rs1258528307 4861 dbSNP
rs1465157181 4864 dbSNP
rs1486668513 4876 dbSNP
rs897948378 4880 dbSNP
rs1168409456 4881 dbSNP
rs1019046694 4882 dbSNP
rs1478740182 4886 dbSNP
rs1008694694 4889 dbSNP
rs1266134591 4889 dbSNP
rs888968811 4895 dbSNP
rs1479736781 4898 dbSNP
rs934235077 4903 dbSNP
rs758096345 4905 dbSNP
rs921525653 4909 dbSNP
rs750281180 4912 dbSNP
rs1157404404 4913 dbSNP
rs1347162350 4915 dbSNP
rs974390320 4922 dbSNP
rs1010853218 4931 dbSNP
rs765267780 4952 dbSNP
rs781415114 4952 dbSNP
rs1406849599 4958 dbSNP
rs1181011359 4974 dbSNP
rs764852649 4975 dbSNP
rs893444462 4988 dbSNP
rs1304645858 4989 dbSNP
rs1318345401 4990 dbSNP
rs950523575 5006 dbSNP
rs1264509709 5017 dbSNP
rs1052145923 5020 dbSNP
rs1203821632 5031 dbSNP
rs935066851 5036 dbSNP
rs754385305 5043 dbSNP
rs927680215 5046 dbSNP
rs1003133419 5060 dbSNP
rs1175818966 5061 dbSNP
rs1410704406 5072 dbSNP
rs1420062639 5073 dbSNP
rs1256763334 5079 dbSNP
rs1046150624 5087 dbSNP
rs1221025203 5095 dbSNP
rs1426574224 5101 dbSNP
rs907105618 5101 dbSNP
rs1022860124 5124 dbSNP
rs1012867223 5144 dbSNP
rs1312459482 5152 dbSNP
rs866445253 5169 dbSNP
rs1296225845 5173 dbSNP
rs916108901 5185 dbSNP
rs755438063 5190 dbSNP
rs192999792 5202 dbSNP
rs1391768104 5215 dbSNP
rs952371241 5216 dbSNP
rs920586143 5217 dbSNP
rs1381691202 5224 dbSNP
rs1291921747 5227 dbSNP
rs1303623081 5230 dbSNP
rs903283842 5231 dbSNP
rs1398238905 5248 dbSNP
rs972057946 5267 dbSNP
rs1333394515 5274 dbSNP
rs1481139379 5281 dbSNP
rs1181659177 5297 dbSNP
rs1467134932 5301 dbSNP
rs1051241872 5328 dbSNP
rs1446714976 5341 dbSNP
rs1164287804 5358 dbSNP
rs962040000 5360 dbSNP
rs934180165 5365 dbSNP
rs1019014271 5381 dbSNP
rs1008995846 5382 dbSNP
rs1356241648 5412 dbSNP
rs921495737 5425 dbSNP
rs975699304 5444 dbSNP
rs953176029 5451 dbSNP
rs1335901408 5452 dbSNP
rs1380087619 5462 dbSNP
rs187178397 5464 dbSNP
rs941603825 5472 dbSNP
rs1315124568 5481 dbSNP
rs756966676 5488 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer -0.336 1.2e-3 -0.391 1.8e-4 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.638 1.2e-3 0.744 8.5e-5 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.524 3.6e-3 0.556 2.0e-3 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.526 5.0e-3 0.538 4.0e-3 23 Click to see details
GSE32688 Pancreatic cancer 0.409 1.0e-2 0.313 4.1e-2 32 Click to see details
GSE21032 Prostate cancer 0.244 1.3e-2 0.131 1.2e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.408 2.1e-2 0.604 6.9e-4 25 Click to see details
GSE28260 Renal cortex and medulla -0.521 3.4e-2 -0.626 1.1e-2 13 Click to see details
GSE19536 Breast cancer -0.178 3.8e-2 -0.310 8.5e-4 100 Click to see details
GSE27834 Pluripotent stem cells -0.269 1.6e-1 -0.200 2.3e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.116 1.8e-1 -0.152 1.2e-1 64 Click to see details
GSE21849 B cell lymphoma -0.174 1.8e-1 0.192 1.6e-1 29 Click to see details
GSE38226 Liver fibrosis 0.195 2.0e-1 0.205 1.9e-1 21 Click to see details
GSE28544 Breast cancer 0.153 2.4e-1 0.518 4.8e-3 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.143 2.5e-1 -0.188 1.9e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.179 2.9e-1 0.294 1.8e-1 12 Click to see details
GSE17306 Multiple myeloma 0.065 3.3e-1 0.059 3.4e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.046 3.3e-1 0.051 3.2e-1 90 Click to see details
GSE17498 Multiple myeloma 0.044 3.9e-1 0.177 1.4e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer 0.027 4.6e-1 -0.086 3.6e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer 0.027 4.6e-1 -0.086 3.6e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.878 0 -0.967 0 9 Click to see details
KICH 0.47 0.01 0.498 0.01 25 Click to see details
KIRC 0.263 0.02 0.279 0.01 68 Click to see details
CESC 0.998 0.02 1.000 0.5 3 Click to see details
PAAD 0.956 0.02 0.400 0.3 4 Click to see details
PCPG -0.992 0.04 -1.000 0.5 3 Click to see details
LUAD 0.505 0.05 0.643 0.01 12 Click to see details
THCA 0.185 0.08 0.106 0.21 59 Click to see details
BLCA -0.344 0.08 -0.280 0.13 18 Click to see details
HNSC -0.185 0.12 -0.196 0.11 42 Click to see details
LUSC 0.157 0.17 0.180 0.14 38 Click to see details
STAD 0.17 0.18 0.195 0.14 32 Click to see details
KIRP -0.159 0.19 -0.164 0.18 32 Click to see details
UCEC 0.143 0.28 0.028 0.45 19 Click to see details
LIHC -0.075 0.3 0.065 0.33 49 Click to see details
PRAD 0.066 0.32 -0.055 0.35 50 Click to see details
COAD 0.118 0.39 0.000 0.5 8 Click to see details
BRCA -0.02 0.43 -0.020 0.43 84 Click to see details
ESCA -0.029 0.47 -0.027 0.47 11 Click to see details
ESCA -0.029 0.47 -0.027 0.47 11 Click to see details
ESCA -0.029 0.47 -0.027 0.47 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*