miRTarBase - #MIRT726548 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC25A22   
Synonyms EIEE3, GC-1, GC1, NET44
Description solute carrier family 25 member 22
Transcript NM_024698   
Expression
Putative miRNA Targets on SLC25A22
3'UTR of SLC25A22
(miRNA target sites are highlighted)
>SLC25A22|NM_024698|3'UTR
   1 GCCCAGCACCCGCTCCACCCCAGCCAGCTGGGCAGGGCCGGTGTGGGGCTGGAGCCAGGCAGCTAGCCCAGGACGGAGCA
  81 AGGGAAGACCCCTCCCCAGCCCTCCCGTCGGCAGGGGCAGCAGGGGGCAGGGTGCAGGGTCCACATAGGTGGTGCACACG
 161 CAAGCCCCCCGGGGTGCTGCCTGCACCGTTGGGATCAATGTCTCATTTATGTAGAAAATGCAGAAATCTTTACATTCCTC
 241 AAGCTAGCCCCTGCCCCAATCCTGCCCTGGCCTGAACACCCCCAGGGACAGAGCTGGTCTCTGGGCTGGGGGCCCCCGGG
 321 CCTGGGCCGGGCAGGCTGGACCATACCCCCAGTCCACCAGCTCCAGTCTCCACAGCCATCCTGGCCCACACAGGCACCCC
 401 ACACAAACCTATTTATTGAATCTGCTGGACCCAAGCGGCTCTCCAGCCCTTCCGTCCTTCCCCAGCCGCTCTTGTCGCCT
 481 TGGCAGGACTTGACTCTGCCTCCCTGGCCAGCCTTGCAAGAGGACTGGGGTCTCCTGCCCTCTCTGTTGAGCCAGGAATC
 561 CCAAGTGAGGGGTTGCCCTGAGGTCTGACTCTTGGGGCAAGCCCGCCACCCACTGTGGGACTTTCTGGTGGGCTCCTCAG
 641 CTCCCACCCCAGGCTGGGGCCCAGATTGTGAGGTCTGTGTGCATGTGTGTGTGTATGTGTGTGTGCATGCGTGTGTGTGT
 721 TGTGGGGATCTGGCCTGGCCCTTGGGGATGGGGCTGCTGGGGACTGCCCCCCTTCCCGCCGTGGCCAGGCGCTCTGTGTG
 801 CTGTGTGTGCCCCAGGCTCTGTTGACCCCGTCCAGGAACTAACTTACCCAGCTTGGTCTCTCCTGAGTCCTCCACCCTGG
 881 CCTGGGATTGGCCAGGGAGCAGGGCGGGCATTGGGACCAGTGTGGAGCCTGAGGGTGCCTGCCCTGCTCTGGAGGGAGGG
 961 CCAGGAGCTGCCACACCCCCAAGTCCTCTCAGGGCCCACCCTCCTTTTTCAGCCTCTGCATAAGGCCCCTGGGTACACTG
1041 CAGAAGCCCCATCCTTCCCGCCTCCGGGCATAAGGCCCCTGACCACACTTCAGAAGCCCCATCCCCCCTGCCACCGGGCG
1121 ATCCCTGCTGTGAGCCGAAGCTCTCCCTGCCCCGCCCTGGCCATGTGATCGTGTTGGTGACAGACCCTGATGTGCTGGTG
1201 CTGTGTCCCCAAAACCGGGGCCCTCCACAGAGGCCCCTTCCCAGCGACACTACCTGGGGCTCAGGCCTGGACCCCCCCAG
1281 TTCACGGTTGCTCCTGGGAGCTGCCCCTCCCGTCACATCAGAACCTTGGAAGCTGCTGCTGCTGCTTACAGAATTATATT
1361 TTTTTCTTTTGAAGAGTTTTAAGAAGTTGTAACTTTTTGTGTCTTGTCATGTCAGAGAATAAATAAATATTCTAAGTAGA
1441 AAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAA--UAC-ACGACGAu 5'
            ||:| | ||  | | ||||||| 
Target 5' atCAGAACCTTGGAAGCTGCTGCTg 3'
1317 - 1341 154.00 -15.00
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:||| | |||||||| | 
Target 5' gaCAGACCCTGATGTGCTGGTg 3'
1179 - 1200 148.00 -22.10
3
miRNA  3' guGUUU--GGUAAUACACGACGau 5'
            |||:  ||   : |||||||  
Target 5' cgCAAGCCCCCCGGGGTGCTGCct 3'
159 - 182 130.00 -19.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
590074 4 ClinVar
139147 17 ClinVar
207155 20 ClinVar
159910 34 ClinVar
306257 39 ClinVar
306256 107 ClinVar
882799 171 ClinVar
306255 209 ClinVar
882798 221 ClinVar
306254 328 ClinVar
306253 436 ClinVar
306252 453 ClinVar
306251 510 ClinVar
306250 560 ClinVar
306249 693 ClinVar
306248 706 ClinVar
306247 711 ClinVar
306246 712 ClinVar
881636 746 ClinVar
306245 753 ClinVar
306244 760 ClinVar
881635 778 ClinVar
306243 780 ClinVar
306242 810 ClinVar
306241 841 ClinVar
306240 845 ClinVar
306239 906 ClinVar
881169 937 ClinVar
306238 940 ClinVar
881168 1000 ClinVar
306237 1013 ClinVar
306236 1041 ClinVar
306235 1057 ClinVar
306234 1084 ClinVar
306233 1153 ClinVar
306232 1277 ClinVar
883538 1292 ClinVar
883537 1301 ClinVar
306231 1430 ClinVar
306230 1431 ClinVar
COSN30508279 40 COSMIC
COSN8284092 334 COSMIC
COSN17182988 424 COSMIC
COSN22551888 604 COSMIC
COSN29193840 752 COSMIC
COSN4724191 829 COSMIC
COSN26031279 1013 COSMIC
COSN22883175 1103 COSMIC
rs4963153 453 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768181465 1 dbSNP
rs1314766783 2 dbSNP
rs1396699166 4 dbSNP
rs748865577 6 dbSNP
rs774988646 7 dbSNP
rs769239083 11 dbSNP
rs745830860 12 dbSNP
rs780956185 13 dbSNP
rs1299691174 15 dbSNP
rs1004867467 16 dbSNP
rs554507285 17 dbSNP
rs1258011670 19 dbSNP
rs796053237 20 dbSNP
rs746754610 21 dbSNP
rs1292043106 28 dbSNP
rs1435974680 30 dbSNP
rs778112073 33 dbSNP
rs74994790 34 dbSNP
rs1418251835 36 dbSNP
rs758687644 38 dbSNP
rs752899555 39 dbSNP
rs558189257 40 dbSNP
rs1268795723 42 dbSNP
rs755059251 45 dbSNP
rs1487919653 51 dbSNP
rs1190391009 60 dbSNP
rs956001281 61 dbSNP
rs1472625449 75 dbSNP
rs1050960871 90 dbSNP
rs1253582537 91 dbSNP
rs1031978352 92 dbSNP
rs1350078196 93 dbSNP
rs1435372823 100 dbSNP
rs1291449234 103 dbSNP
rs1179525366 106 dbSNP
rs4963152 107 dbSNP
rs191895858 109 dbSNP
rs776997448 110 dbSNP
rs1235182973 111 dbSNP
rs1273949669 114 dbSNP
rs1012662868 115 dbSNP
rs1219599367 119 dbSNP
rs946469688 124 dbSNP
rs895500520 126 dbSNP
rs372868529 127 dbSNP
rs552917330 128 dbSNP
rs1255339660 133 dbSNP
rs1476821977 133 dbSNP
rs773841719 137 dbSNP
rs536528731 138 dbSNP
rs1232706360 141 dbSNP
rs1413821010 148 dbSNP
rs897416511 152 dbSNP
rs1329909191 157 dbSNP
rs148144757 159 dbSNP
rs1408190915 160 dbSNP
rs1420675317 162 dbSNP
rs1005716573 164 dbSNP
rs934978871 165 dbSNP
rs888609195 166 dbSNP
rs1049832499 167 dbSNP
rs927581482 170 dbSNP
rs771093127 171 dbSNP
rs557227318 173 dbSNP
rs530664414 181 dbSNP
rs748169209 188 dbSNP
rs1413475536 192 dbSNP
rs1487198291 196 dbSNP
rs1212881036 208 dbSNP
rs537403010 209 dbSNP
rs143796598 210 dbSNP
rs978671518 217 dbSNP
rs551904948 221 dbSNP
rs1157704688 223 dbSNP
rs1358983540 226 dbSNP
rs1335377132 228 dbSNP
rs1368839429 228 dbSNP
rs1004873636 238 dbSNP
rs1445909573 241 dbSNP
rs954716877 243 dbSNP
rs1030248903 244 dbSNP
rs1440472992 253 dbSNP
rs768708575 253 dbSNP
rs959835766 255 dbSNP
rs998075306 257 dbSNP
rs1279224843 258 dbSNP
rs899728617 259 dbSNP
rs1207392352 269 dbSNP
rs528625732 270 dbSNP
rs747226243 273 dbSNP
rs1287565714 274 dbSNP
rs1226466904 278 dbSNP
rs1226797863 286 dbSNP
rs1350315510 287 dbSNP
rs1035818392 294 dbSNP
rs1425046517 310 dbSNP
rs993184950 311 dbSNP
rs561776675 312 dbSNP
rs566262436 313 dbSNP
rs1015833790 315 dbSNP
rs1052199726 317 dbSNP
rs780210144 318 dbSNP
rs1344066569 321 dbSNP
rs1436396912 323 dbSNP
rs187161044 328 dbSNP
rs747104481 329 dbSNP
rs377220453 331 dbSNP
rs1456246356 334 dbSNP
rs529513188 342 dbSNP
rs143320809 344 dbSNP
rs1246439633 348 dbSNP
rs974018608 349 dbSNP
rs1424982085 350 dbSNP
rs1367638376 354 dbSNP
rs544104515 355 dbSNP
rs773829232 366 dbSNP
rs942203600 372 dbSNP
rs867640690 374 dbSNP
rs1323180768 376 dbSNP
rs1330234381 377 dbSNP
rs1434051243 390 dbSNP
rs1280002326 397 dbSNP
rs1341129313 415 dbSNP
rs753651211 418 dbSNP
rs1255663270 427 dbSNP
rs1246107911 428 dbSNP
rs1041489403 430 dbSNP
rs934716534 431 dbSNP
rs1288706026 432 dbSNP
rs954768628 434 dbSNP
rs112476979 436 dbSNP
rs564581592 437 dbSNP
rs1211818883 438 dbSNP
rs974700060 439 dbSNP
rs964347334 449 dbSNP
rs1370229968 452 dbSNP
rs4963153 453 dbSNP
rs1011208209 463 dbSNP
rs893644649 467 dbSNP
rs1030817194 468 dbSNP
rs1403388185 472 dbSNP
rs1299851732 474 dbSNP
rs572635217 476 dbSNP
rs999290342 477 dbSNP
rs1276261060 480 dbSNP
rs1399267208 480 dbSNP
rs1341669138 483 dbSNP
rs1244898735 501 dbSNP
rs369702292 505 dbSNP
rs886048694 510 dbSNP
rs553046910 512 dbSNP
rs1429477734 525 dbSNP
rs928405287 526 dbSNP
rs542413126 535 dbSNP
rs1385763924 541 dbSNP
rs573790809 551 dbSNP
rs1424464325 552 dbSNP
rs556969774 560 dbSNP
rs1366904566 561 dbSNP
rs183389177 565 dbSNP
rs571647327 579 dbSNP
rs558217557 581 dbSNP
rs1360884796 582 dbSNP
rs1389768293 586 dbSNP
rs1418870132 592 dbSNP
rs1404339366 604 dbSNP
rs1169055556 615 dbSNP
rs1431383579 617 dbSNP
rs1396099558 620 dbSNP
rs1388298360 621 dbSNP
rs1187812637 624 dbSNP
rs1475144355 625 dbSNP
rs535033287 628 dbSNP
rs1005819683 632 dbSNP
rs559351146 641 dbSNP
rs895421517 650 dbSNP
rs1238506036 652 dbSNP
rs566013619 653 dbSNP
rs1247314480 659 dbSNP
rs1483888082 667 dbSNP
rs1201296829 672 dbSNP
rs1450015503 673 dbSNP
rs1199920627 678 dbSNP
rs1037964153 680 dbSNP
rs549458341 682 dbSNP
rs1254115400 683 dbSNP
rs752155405 685 dbSNP
rs1291315692 686 dbSNP
rs1206391785 689 dbSNP
rs952981529 692 dbSNP
rs375467519 693 dbSNP
rs570270747 694 dbSNP
rs1214457813 695 dbSNP
rs1379262477 695 dbSNP
rs1302213176 699 dbSNP
rs1466529839 699 dbSNP
rs1367725598 704 dbSNP
rs1019728232 706 dbSNP
rs139577104 706 dbSNP
rs901337284 706 dbSNP
rs1375784642 710 dbSNP
rs550204204 710 dbSNP
rs111723529 711 dbSNP
rs114476401 712 dbSNP
rs1233113681 715 dbSNP
rs1254769591 721 dbSNP
rs1199413763 726 dbSNP
rs1320018989 726 dbSNP
rs974751122 734 dbSNP
rs947342030 741 dbSNP
rs576938612 746 dbSNP
rs544567754 753 dbSNP
rs1269137831 754 dbSNP
rs139397585 760 dbSNP
rs1368423496 762 dbSNP
rs928445753 769 dbSNP
rs766005705 771 dbSNP
rs1030869137 772 dbSNP
rs1414912192 773 dbSNP
rs1460109608 773 dbSNP
rs999341429 777 dbSNP
rs971863478 778 dbSNP
rs886048693 780 dbSNP
rs1477075131 781 dbSNP
rs1268512371 790 dbSNP
rs1257556087 791 dbSNP
rs1024722451 794 dbSNP
rs1183127012 796 dbSNP
rs908937740 798 dbSNP
rs1484261470 799 dbSNP
rs763350462 803 dbSNP
rs886048692 810 dbSNP
rs1190475653 811 dbSNP
rs953012195 813 dbSNP
rs1478792521 821 dbSNP
rs1204461060 824 dbSNP
rs1313233620 830 dbSNP
rs1281329489 831 dbSNP
rs1217014764 840 dbSNP
rs116673603 841 dbSNP
rs1457712529 845 dbSNP
rs886048691 845 dbSNP
rs1301721181 848 dbSNP
rs1362981502 849 dbSNP
rs1401089548 851 dbSNP
rs1037748447 852 dbSNP
rs1278153537 855 dbSNP
rs1359889132 857 dbSNP
rs1230157373 862 dbSNP
rs1313702591 863 dbSNP
rs1321392579 864 dbSNP
rs942308652 868 dbSNP
rs976061263 870 dbSNP
rs886675681 875 dbSNP
rs542750433 879 dbSNP
rs1229797539 880 dbSNP
rs933484658 881 dbSNP
rs1348413215 886 dbSNP
rs965600937 886 dbSNP
rs1020180656 893 dbSNP
rs923409569 895 dbSNP
rs573754741 896 dbSNP
rs1021683339 901 dbSNP
rs943425806 905 dbSNP
rs118051043 906 dbSNP
rs34712290 906 dbSNP
rs894476789 911 dbSNP
rs17156066 913 dbSNP
rs1428635679 917 dbSNP
rs1344016618 937 dbSNP
rs543726213 940 dbSNP
rs1473664625 944 dbSNP
rs1410224173 945 dbSNP
rs577974181 948 dbSNP
rs1177061623 957 dbSNP
rs1244007186 961 dbSNP
rs1483769337 963 dbSNP
rs558106987 978 dbSNP
rs534970957 982 dbSNP
rs1311750068 986 dbSNP
rs1355518215 996 dbSNP
rs938579581 997 dbSNP
rs1445247555 1000 dbSNP
rs923851069 1001 dbSNP
rs907095642 1005 dbSNP
rs977953428 1007 dbSNP
rs1482660772 1010 dbSNP
rs1181297537 1012 dbSNP
rs542204237 1013 dbSNP
rs970556206 1019 dbSNP
rs572412088 1022 dbSNP
rs1208586465 1026 dbSNP
rs1158462554 1032 dbSNP
rs1440696925 1032 dbSNP
rs1406397068 1033 dbSNP
rs1416611945 1034 dbSNP
rs1036618990 1037 dbSNP
rs1358583537 1038 dbSNP
rs1450563598 1040 dbSNP
rs886048690 1041 dbSNP
rs1024773402 1046 dbSNP
rs1378009488 1047 dbSNP
rs1460499572 1050 dbSNP
rs908970706 1053 dbSNP
rs375049082 1057 dbSNP
rs959352369 1059 dbSNP
rs1229858356 1060 dbSNP
rs1201306812 1064 dbSNP
rs762429573 1065 dbSNP
rs535992217 1066 dbSNP
rs1228725309 1073 dbSNP
rs1006279251 1076 dbSNP
rs966031353 1081 dbSNP
rs1381032787 1082 dbSNP
rs1468293149 1082 dbSNP
rs1172954536 1083 dbSNP
rs768779780 1084 dbSNP
rs1451770444 1087 dbSNP
rs1327140628 1088 dbSNP
rs1333697535 1090 dbSNP
rs1405461417 1090 dbSNP
rs1321228636 1096 dbSNP
rs978000475 1098 dbSNP
rs967500110 1103 dbSNP
rs886728603 1104 dbSNP
rs1344851112 1109 dbSNP
rs1458885782 1109 dbSNP
rs1221130671 1110 dbSNP
rs1343701703 1113 dbSNP
rs1158614880 1114 dbSNP
rs1047977298 1115 dbSNP
rs570129087 1116 dbSNP
rs747118458 1119 dbSNP
rs1021756897 1120 dbSNP
rs1444490845 1124 dbSNP
rs1039585271 1136 dbSNP
rs943495720 1137 dbSNP
rs1424373505 1139 dbSNP
rs1210113900 1141 dbSNP
rs1477539020 1146 dbSNP
rs958720079 1147 dbSNP
rs549994645 1150 dbSNP
rs1259827734 1151 dbSNP
rs17156064 1153 dbSNP
rs1054500269 1154 dbSNP
rs907123054 1158 dbSNP
rs1402984284 1159 dbSNP
rs1036245085 1161 dbSNP
rs934650645 1164 dbSNP
rs924572077 1165 dbSNP
rs1287403665 1170 dbSNP
rs978005672 1171 dbSNP
rs1358074074 1180 dbSNP
rs1210784914 1181 dbSNP
rs970608597 1184 dbSNP
rs1291431192 1185 dbSNP
rs1489969802 1188 dbSNP
rs887605460 1195 dbSNP
rs1264548272 1210 dbSNP
rs1245163402 1217 dbSNP
rs1446485271 1221 dbSNP
rs34592943 1231 dbSNP
rs1048825159 1237 dbSNP
rs1365928953 1239 dbSNP
rs1191203717 1240 dbSNP
rs1299719406 1243 dbSNP
rs570780598 1244 dbSNP
rs547695882 1245 dbSNP
rs1163212990 1249 dbSNP
rs1384310065 1254 dbSNP
rs1422533336 1255 dbSNP
rs991045447 1258 dbSNP
rs1359904745 1260 dbSNP
rs1381129531 1262 dbSNP
rs1315667091 1266 dbSNP
rs1288529830 1268 dbSNP
rs1313928501 1272 dbSNP
rs1357669453 1273 dbSNP
rs1040455145 1275 dbSNP
rs191455128 1277 dbSNP
rs1443080528 1279 dbSNP
rs912808376 1279 dbSNP
rs1351988383 1281 dbSNP
rs977666014 1283 dbSNP
rs1424407010 1285 dbSNP
rs1016422308 1286 dbSNP
rs575292705 1301 dbSNP
rs1191025810 1303 dbSNP
rs990294259 1307 dbSNP
rs1260374587 1308 dbSNP
rs1191429330 1311 dbSNP
rs950392937 1312 dbSNP
rs1396119743 1315 dbSNP
rs1335657342 1324 dbSNP
rs1025914465 1325 dbSNP
rs997738405 1329 dbSNP
rs1449420823 1336 dbSNP
rs902092008 1337 dbSNP
rs367812123 1339 dbSNP
rs1342565848 1347 dbSNP
rs1237433828 1351 dbSNP
rs1003290288 1357 dbSNP
rs1258305392 1366 dbSNP
rs1276724863 1366 dbSNP
rs1226014272 1368 dbSNP
rs1345797613 1372 dbSNP
rs1305847672 1373 dbSNP
rs1294862830 1376 dbSNP
rs779716143 1377 dbSNP
rs559349713 1379 dbSNP
rs971421784 1391 dbSNP
rs1387423796 1393 dbSNP
rs548785686 1398 dbSNP
rs1008137803 1402 dbSNP
rs893255607 1403 dbSNP
rs1418285726 1409 dbSNP
rs887633301 1413 dbSNP
rs1048897855 1415 dbSNP
rs1379357851 1422 dbSNP
rs1469862991 1425 dbSNP
rs755572915 1430 dbSNP
rs529018067 1431 dbSNP
rs900254990 1431 dbSNP
rs944409908 1432 dbSNP
rs1171060120 1436 dbSNP
rs35813865 1439 dbSNP
rs1304050103 1441 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.698 4.5e-6 -0.242 9.1e-2 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.684 1.6e-4 0.525 5.1e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.587 3.3e-3 -0.669 6.3e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.41 2.1e-2 0.582 1.1e-3 25 Click to see details
GSE27834 Pluripotent stem cells 0.486 2.8e-2 0.518 2.0e-2 16 Click to see details
GSE21032 Prostate cancer -0.209 2.9e-2 -0.159 7.6e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.407 3.7e-2 -0.374 5.2e-2 20 Click to see details
GSE19783 ER- ER- breast cancer 0.175 6.1e-2 0.200 3.9e-2 79 Click to see details
GSE17498 Multiple myeloma -0.178 1.4e-1 -0.172 1.4e-1 40 Click to see details
GSE28260 Renal cortex and medulla 0.26 2.0e-1 0.132 3.3e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.091 2.4e-1 -0.039 3.8e-1 64 Click to see details
GSE19536 Breast cancer 0.07 2.4e-1 0.089 1.9e-1 100 Click to see details
GSE21849 B cell lymphoma 0.076 3.5e-1 0.316 4.7e-2 29 Click to see details
GSE14794 Lymphoblastoid cells 0.041 3.5e-1 0.101 1.7e-1 90 Click to see details
GSE19350 CNS germ cell tumors -0.089 3.9e-1 -0.126 3.5e-1 12 Click to see details
GSE38226 Liver fibrosis -0.043 4.3e-1 0.263 1.2e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.037 4.3e-1 0.139 2.5e-1 25 Click to see details
GSE28544 Breast cancer 0.036 4.3e-1 0.463 1.1e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.022 4.6e-1 -0.032 4.4e-1 24 Click to see details
GSE17306 Multiple myeloma -0.011 4.7e-1 0.011 4.7e-1 49 Click to see details
GSE17306 Multiple myeloma -0.011 4.7e-1 0.011 4.7e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.668 0 0.668 0 32 Click to see details
UCEC -0.505 0.01 -0.281 0.12 19 Click to see details
THCA 0.273 0.02 0.215 0.05 59 Click to see details
BRCA -0.21 0.03 -0.164 0.07 84 Click to see details
BLCA 0.445 0.03 0.517 0.01 18 Click to see details
LUSC 0.284 0.04 0.203 0.11 38 Click to see details
PRAD 0.238 0.05 0.188 0.1 50 Click to see details
CHOL -0.477 0.1 -0.467 0.1 9 Click to see details
HNSC 0.197 0.11 0.191 0.11 42 Click to see details
PAAD -0.717 0.14 -1.000 0.5 4 Click to see details
KIRP -0.185 0.16 -0.164 0.18 32 Click to see details
KICH 0.178 0.2 0.135 0.26 25 Click to see details
CESC 0.712 0.25 0.500 0.33 3 Click to see details
KIRC -0.076 0.27 -0.068 0.29 68 Click to see details
COAD 0.208 0.31 0.167 0.35 8 Click to see details
LUAD -0.141 0.33 -0.105 0.37 12 Click to see details
PCPG -0.452 0.35 -0.500 0.33 3 Click to see details
LIHC 0.035 0.41 0.028 0.42 49 Click to see details
ESCA -0.026 0.47 -0.109 0.37 11 Click to see details
ESCA -0.026 0.47 -0.109 0.37 11 Click to see details
ESCA -0.026 0.47 -0.109 0.37 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*