miRTarBase - #MIRT726511 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC7A5   
Synonyms 4F2LC, CD98, D16S469E, E16, LAT1, MPE16
Description solute carrier family 7 member 5
Transcript NM_003486   
Expression
Putative miRNA Targets on SLC7A5
3'UTR of SLC7A5
(miRNA target sites are highlighted)
>SLC7A5|NM_003486|3'UTR
   1 CCAGGAGGCCGAGTGGCTGCCGGAGGAGCATGCGCAGAGGCCAGTTAAAGTAGATCACCTCCTCGAACCCACTCCGGTTC
  81 CCCGCAACCCACAGCTCAGCTGCCCATCCCAGTCCCTCGCCGTCCCTCCCAGGTCGGGCAGTGGAGGCTGCTGTGAAAAC
 161 TCTGGTACGAATCTCATCCCTCAACTGAGGGCCAGGGACCCAGGTGTGCCTGTGCTCCTGCCCAGGAGCAGCTTTTGGTC
 241 TCCTTGGGCCCTTTTTCCCTTCCCTCCTTTGTTTACTTATATATATATTTTTTTTAAACTTAAATTTTGGGTCAACTTGA
 321 CACCACTAAGATGATTTTTTAAGGAGCTGGGGGAAGGCAGGAGCCTTCCTTTCTCCTGCCCCAAGGGCCCAGACCCTGGG
 401 CAAACAGAGCTACTGAGACTTGGAACCTCATTGCTACCACAGACTTGCACTGAAGCCGGACAGCTGCCCAGACACATGGG
 481 CTTGTGACATTCGTGAAAACCAACCCTGTGGGCTTATGTCTCTGCCTTAGGGTTTGCAGAGTGGAAACTCAGCCGTAGGG
 561 TGGCACTGGGAGGGGGTGGGGGATCTGGGCAAGGTGGGTGATTCCTCCCAGGAGGTGCTTGAGGCCCCGATGGACTCCTG
 641 ACCATAATCCTAGCCCCGAGACACCATCCTGAGCCAGGGAACAGCCCCAGGGTTGGGGGGTGCCGGCATCTCCCCTAGCT
 721 CACCAGGCCTGGCCTCTGGGCAGTGTGGCCTCTTGGCTATTTCTGTGTCCAGTTTTGGAGGCTGAGTTCTGGTTCATGCA
 801 GACAAAGCCCTGTCCTTCAGTCTTCTAGAAACAGAGACAAGAAAGGCAGACACACCGCGGCCAGGCACCCATGTGGGCGC
 881 CCACCCTGGGCTCCACACAGCAGTGTCCCCTGCCCCAGAGGTCGCAGCTACCCTCAGCCTCCAATGCATTGGCCTCTGTA
 961 CCGCCCGGCAGCCCCTTCTGGCCGGTGCTGGGTTCCCACTCCCGGCCTAGGCACCTCCCCGCTCTCCCTGTCACGCTCAT
1041 GTCCTGTCCTGGTCCTGATGCCCGTTGTCTAGGAGACAGAGCCAAGCACTGCTCACGTCTCTGCCGCCTGCGTTTGGAGG
1121 CCCCTGGGCTCTCACCCAGTCCCCACCCGCCTGCAGAGAGGGAACTAGGGCACCCCTTGTTTCTGTTGTTCCCGTGAATT
1201 TTTTTCGCTATGGGAGGCAGCCGAGGCCTGGCCAATGCGGCCCACTTTCCTGAGCTGTCGCTGCCTCCATGGCAGCAGCC
1281 AGGGACCCCCAGAACAAGAAGACCCCGCAGGATCCCTCCTGAGCTCGGGGGGCTCTGCCTTCTCAGGCCCCGGGCTTCCC
1361 TTCTCCCCAGCCAGAGGTGGAGCCAAGTGGTCCAGCGTCACTCCAGTGCTCAGCTGTGGCTGGAGGAGCTGGCCTGTGGC
1441 ACAGCCCTGAGTGTCCCAAGCCGGGAGCCAACGAAGCCGGACACGGCTTCACTGACCAGCGGCTGCTCAAGCCGCAAGCT
1521 CTCAGCAAGTGCCCAGTGGAGCCTGCCGCCCCCGCCTGGGCACCGGGACCCCCTCACCATCCAGTGGGCCCGGAGAAACC
1601 TGATGAACAGTTTGGGGACTCAGGACCAGATGTCCGTCTCTCTTGCTTGAGGAATGAAGACCTTTATTCACCCCTGCCCC
1681 GTTGCTTCCCGCTGCACATGGACAGACTTCACAGCGTCTGCTCATAGGACCTGCATCCTTCCTGGGGACGAATTCCACTC
1761 GTCCAAGGGACAGCCCACGGTCTGGAGGCCGAGGACCACCAGCAGGCAGGTGGACTGACTGTGTTGGGCAAGACCTCTTC
1841 CCTCTGGGCCTGTTCTCTTGGCTGCAAATAAGGACAGCAGCTGGTGCCCCACCTGCCTGGTGCATTGCTGTGTGAATCCA
1921 GGAGGCAGTGGACATCGTAGGCAGCCACGGCCCCGGGTCCAGGAGAAGTGCTCCCTGGAGGCACGCACCACTGCTTCCCA
2001 CTGGGGCCGGCGGGGCCCACGCACGACGTCAGCCTCTTACCTTCCCGCCTCGGCTAGGGGTCCTCGGGATGCCGTTCTGT
2081 TCCAACCTCCTGCTCTGGGACGTGGACATGCCTCAAGGATACAGGGAGCCGGCGGCCTCTCGACGGCACGCACTTGCCTG
2161 TTGGCTGCTGCGGCTGTGGGCGAGCATGGGGGCTGCCAGCGTCTGTTGTGGAAAGTAGCTGCTAGTGAAATGGCTGGGGC
2241 CGCTGGGGTCCGTCTTCACACTGCGCAGGTCTCTTCTGGGCGTCTGAGCTGGGGTGGGAGCTCCTCCGCAGAAGGTTGGT
2321 GGGGGGTCCAGTCTGTGATCCTTGGTGCTGTGTGCCCCACTCCAGCCTGGGGACCCCACTTCAGAAGGTAGGGGCCGTGT
2401 CCCGCGGTGCTGACTGAGGCCTGCTTCCCCCTCCCCCTCCTGCTGTGCTGGAATTCCACAGGGACCAGGGCCACCGCAGG
2481 GGACTGTCTCAGAAGACTTGATTTTTCCGTCCCTTTTTCTCCACACTCCACTGACAAACGTCCCCAGCGGTTTCCACTTG
2561 TGGGCTTCAGGTGTTTTCAAGCACAACCCACCACAACAAGCAAGTGCATTTTCAGTCGTTGTGCTTTTTTGTTTTGTGCT
2641 AACGTCTTACTAATTTAAAGATGCTGTCGGCACCATGTTTATTTATTTCCAGTGGTCATGCTCAGCCTTGCTGCTCTGCG
2721 TGGCGCAGGTGCCATGCCTGCTCCCTGTCTGTGTCCCAGCCACGCAGGGCCATCCACTGTGACGTCGGCCGACCAGGCTG
2801 GACACCCTCTGCCGAGTAATGACGTGTGTGGCTGGGACCTTCTTTATTCTGTGTTAATGGCTAACCTGTTACACTGGGCT
2881 GGGTTGGGTAGGGTGTTCTGGCTTTTTTGTGGGGTTTTTATTTTTAAAGAAACACTCAATCATCCTACCGCTGAAAAAAA
2961 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUG-GUAAUACACGACGAu 5'
            || :| ||   | ||||||| 
Target 5' gtCATGCTCAGCCT-TGCTGCTc 3'
2695 - 2716 143.00 -9.70
2
miRNA  3' guguuuGGUAAUACACGACGau 5'
                |::||:  ||||||  
Target 5' acttgcCTGTTGGCTGCTGCgg 3'
2152 - 2173 132.00 -14.10
3
miRNA  3' guGUUUGGUAAUA--CACGACGAu 5'
            ||: |::| ||   || |||| 
Target 5' tcCAGTCTGTGATCCTTGGTGCTg 3'
2327 - 2350 122.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26995521 10 COSMIC
COSN31560337 61 COSMIC
COSN31590226 75 COSMIC
COSN30517228 80 COSMIC
COSN30461435 82 COSMIC
COSN30163593 103 COSMIC
COSN30535564 119 COSMIC
COSN30500683 121 COSMIC
COSN30453121 128 COSMIC
COSN30453141 129 COSMIC
COSN30455814 134 COSMIC
COSN31526268 135 COSMIC
COSN30523267 144 COSMIC
COSN30758257 161 COSMIC
COSN30488986 162 COSMIC
COSN30190323 164 COSMIC
COSN30535874 200 COSMIC
COSN30514604 237 COSMIC
COSN30542081 251 COSMIC
COSN31480108 267 COSMIC
COSN20160565 644 COSMIC
COSN27546079 678 COSMIC
COSN20163598 858 COSMIC
COSN21788444 947 COSMIC
COSN32152255 1252 COSMIC
COSN6648019 1282 COSMIC
COSN20113172 1302 COSMIC
COSN20113171 1451 COSMIC
COSN25589910 1674 COSMIC
COSN8239569 1791 COSMIC
COSN8239568 2082 COSMIC
COSN16090756 2201 COSMIC
COSN24982271 2553 COSMIC
COSN22788595 2597 COSMIC
COSN28383258 2879 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750806434 1 dbSNP
rs747383028 2 dbSNP
rs778057796 5 dbSNP
rs758680565 8 dbSNP
rs141073967 9 dbSNP
rs1384125567 10 dbSNP
rs199652278 11 dbSNP
rs749900706 20 dbSNP
rs550600125 21 dbSNP
rs756902610 22 dbSNP
rs751411967 23 dbSNP
rs1473695619 31 dbSNP
rs764037421 33 dbSNP
rs369984883 34 dbSNP
rs1358789258 35 dbSNP
rs775549603 36 dbSNP
rs371881159 40 dbSNP
rs1248752446 43 dbSNP
rs776625917 44 dbSNP
rs1369263727 46 dbSNP
rs771159023 47 dbSNP
rs747293022 48 dbSNP
rs1370320146 51 dbSNP
rs1228602711 54 dbSNP
rs1372865734 54 dbSNP
rs1328474376 59 dbSNP
rs371639937 64 dbSNP
rs910813869 65 dbSNP
rs1295239839 74 dbSNP
rs986286333 75 dbSNP
rs532635996 76 dbSNP
rs1395342541 78 dbSNP
rs1327941976 80 dbSNP
rs571653934 83 dbSNP
rs116176256 84 dbSNP
rs1246375247 85 dbSNP
rs1162492907 87 dbSNP
rs962132602 91 dbSNP
rs1016203827 96 dbSNP
rs1449389666 97 dbSNP
rs1169846218 110 dbSNP
rs528287201 111 dbSNP
rs1374475168 112 dbSNP
rs1392390341 118 dbSNP
rs561136237 119 dbSNP
rs1006199232 121 dbSNP
rs1350124649 122 dbSNP
rs1437906043 125 dbSNP
rs1448448211 131 dbSNP
rs187682843 133 dbSNP
rs184153181 135 dbSNP
rs991325468 136 dbSNP
rs1353940103 137 dbSNP
rs958404320 138 dbSNP
rs1214939532 141 dbSNP
rs1035733294 143 dbSNP
rs1289347734 152 dbSNP
rs563272587 153 dbSNP
rs1322554722 163 dbSNP
rs776850971 164 dbSNP
rs1467574483 168 dbSNP
rs1289768306 169 dbSNP
rs1464538065 172 dbSNP
rs967558366 175 dbSNP
rs17782319 177 dbSNP
rs896308666 179 dbSNP
rs1020021141 184 dbSNP
rs1227962514 185 dbSNP
rs1371916544 187 dbSNP
rs1406729377 191 dbSNP
rs1011787659 199 dbSNP
rs113792715 202 dbSNP
rs893307550 205 dbSNP
rs1029252342 217 dbSNP
rs1435231476 220 dbSNP
rs569614757 237 dbSNP
rs996396555 238 dbSNP
rs1338639183 246 dbSNP
rs903629451 253 dbSNP
rs1284562266 261 dbSNP
rs1348100018 262 dbSNP
rs368640237 276 dbSNP
rs901857282 277 dbSNP
rs1040801480 280 dbSNP
rs545027130 282 dbSNP
rs2287119 283 dbSNP
rs2287118 284 dbSNP
rs1328525466 285 dbSNP
rs2287117 286 dbSNP
rs551055261 287 dbSNP
rs910769189 287 dbSNP
rs11117304 289 dbSNP
rs1187535341 289 dbSNP
rs1238392490 289 dbSNP
rs199861158 289 dbSNP
rs1049131374 295 dbSNP
rs565933814 296 dbSNP
rs931149477 296 dbSNP
rs1060252 309 dbSNP
rs1399515302 310 dbSNP
rs919724956 319 dbSNP
rs1334805685 326 dbSNP
rs1342009893 328 dbSNP
rs1407798011 333 dbSNP
rs1165875224 337 dbSNP
rs991376352 340 dbSNP
rs1229316280 341 dbSNP
rs984725093 341 dbSNP
rs1428707160 344 dbSNP
rs969798056 347 dbSNP
rs36027081 354 dbSNP
rs1195013178 355 dbSNP
rs1452003280 358 dbSNP
rs1279995224 366 dbSNP
rs1486832470 367 dbSNP
rs1203467514 369 dbSNP
rs1250521569 375 dbSNP
rs1472710380 377 dbSNP
rs1183605361 378 dbSNP
rs937230091 381 dbSNP
rs1375404917 388 dbSNP
rs1477430906 393 dbSNP
rs771974322 394 dbSNP
rs981544529 402 dbSNP
rs1023677587 405 dbSNP
rs1183198259 412 dbSNP
rs1307174848 415 dbSNP
rs540794282 419 dbSNP
rs1410643790 430 dbSNP
rs1013913884 436 dbSNP
rs967063517 437 dbSNP
rs1060253 438 dbSNP
rs1060254 440 dbSNP
rs1030821999 444 dbSNP
rs1204888108 446 dbSNP
rs989860836 448 dbSNP
rs957533752 457 dbSNP
rs16943310 458 dbSNP
rs996327229 463 dbSNP
rs1232231065 466 dbSNP
rs1483613899 467 dbSNP
rs115661907 469 dbSNP
rs1264866591 475 dbSNP
rs1280160249 485 dbSNP
rs575578649 489 dbSNP
rs1442850071 490 dbSNP
rs770691925 492 dbSNP
rs889446025 493 dbSNP
rs1396431098 495 dbSNP
rs1050816181 497 dbSNP
rs556889016 503 dbSNP
rs1390528625 506 dbSNP
rs1306024818 514 dbSNP
rs1300069046 518 dbSNP
rs1388868331 523 dbSNP
rs933552421 527 dbSNP
rs1005330425 531 dbSNP
rs1373356626 538 dbSNP
rs886401447 539 dbSNP
rs923546799 543 dbSNP
rs1036462736 554 dbSNP
rs1343266783 555 dbSNP
rs1230102370 556 dbSNP
rs1263255318 559 dbSNP
rs1355205296 560 dbSNP
rs368481957 563 dbSNP
rs1375728131 571 dbSNP
rs994850757 576 dbSNP
rs1175162865 577 dbSNP
rs75898183 579 dbSNP
rs546798283 582 dbSNP
rs1423876969 583 dbSNP
rs1055578711 589 dbSNP
rs144295628 594 dbSNP
rs1158573379 596 dbSNP
rs909262736 599 dbSNP
rs928579971 614 dbSNP
rs535145342 615 dbSNP
rs1165982353 617 dbSNP
rs1181969271 618 dbSNP
rs1396747484 620 dbSNP
rs114781228 628 dbSNP
rs550558160 629 dbSNP
rs1320412495 630 dbSNP
rs992196688 652 dbSNP
rs1030936017 654 dbSNP
rs960885051 654 dbSNP
rs912868222 656 dbSNP
rs77384806 657 dbSNP
rs967874558 658 dbSNP
rs563587509 661 dbSNP
rs755764174 679 dbSNP
rs1268615982 682 dbSNP
rs1486802573 683 dbSNP
rs1285045189 685 dbSNP
rs1180100395 688 dbSNP
rs561762733 692 dbSNP
rs1424215286 695 dbSNP
rs1188871691 696 dbSNP
rs1420320098 699 dbSNP
rs1225533348 700 dbSNP
rs113620181 704 dbSNP
rs543091980 705 dbSNP
rs1301650499 706 dbSNP
rs957086326 707 dbSNP
rs148779119 711 dbSNP
rs559329287 713 dbSNP
rs1348251228 714 dbSNP
rs1227479513 715 dbSNP
rs997878508 718 dbSNP
rs902072321 724 dbSNP
rs540754159 726 dbSNP
rs1255370556 727 dbSNP
rs1483426067 728 dbSNP
rs1212771494 731 dbSNP
rs1036577597 736 dbSNP
rs1471726334 741 dbSNP
rs11541879 745 dbSNP
rs1408769539 755 dbSNP
rs1420992152 760 dbSNP
rs190655752 764 dbSNP
rs1358215469 769 dbSNP
rs1318476896 771 dbSNP
rs1315179605 772 dbSNP
rs1369152467 776 dbSNP
rs1401919200 778 dbSNP
rs1298428606 783 dbSNP
rs1019617251 789 dbSNP
rs1216989457 802 dbSNP
rs1300432676 803 dbSNP
rs1481374522 807 dbSNP
rs1410448457 808 dbSNP
rs573735116 819 dbSNP
rs1049259921 822 dbSNP
rs1475791946 839 dbSNP
rs1204654909 845 dbSNP
rs948118167 850 dbSNP
rs1005098766 856 dbSNP
rs950730361 857 dbSNP
rs542815333 858 dbSNP
rs747673296 859 dbSNP
rs1176127220 861 dbSNP
rs978000670 867 dbSNP
rs895265388 872 dbSNP
rs575493117 873 dbSNP
rs1022122424 876 dbSNP
rs1055130024 878 dbSNP
rs1355931073 879 dbSNP
rs557244512 880 dbSNP
rs730214 884 dbSNP
rs1371156689 891 dbSNP
rs758971183 893 dbSNP
rs906997484 895 dbSNP
rs1046068427 900 dbSNP
rs1214958236 902 dbSNP
rs1273900684 903 dbSNP
rs1309483492 907 dbSNP
rs1219721821 908 dbSNP
rs1246176215 910 dbSNP
rs896826224 915 dbSNP
rs1196001463 917 dbSNP
rs1246748053 920 dbSNP
rs1267535425 923 dbSNP
rs537967503 924 dbSNP
rs1187475638 927 dbSNP
rs1015249706 945 dbSNP
rs912921529 946 dbSNP
rs1054150589 947 dbSNP
rs1005078893 949 dbSNP
rs1309675458 953 dbSNP
rs888053517 955 dbSNP
rs1049672812 956 dbSNP
rs935643738 961 dbSNP
rs553364140 962 dbSNP
rs1056553178 963 dbSNP
rs530878276 965 dbSNP
rs966617026 966 dbSNP
rs912033874 967 dbSNP
rs984126687 968 dbSNP
rs923929457 969 dbSNP
rs1385831311 970 dbSNP
rs1319233566 971 dbSNP
rs950989701 974 dbSNP
rs567766105 975 dbSNP
rs1266706888 979 dbSNP
rs1446924005 983 dbSNP
rs748196852 984 dbSNP
rs549160652 999 dbSNP
rs994834287 1001 dbSNP
rs959366222 1002 dbSNP
rs779580881 1003 dbSNP
rs1163186752 1004 dbSNP
rs1418142385 1007 dbSNP
rs80186383 1017 dbSNP
rs1420621422 1018 dbSNP
rs569937824 1019 dbSNP
rs551365734 1020 dbSNP
rs533293683 1021 dbSNP
rs1010055180 1022 dbSNP
rs1357170547 1026 dbSNP
rs1447041011 1029 dbSNP
rs953907232 1034 dbSNP
rs891750533 1035 dbSNP
rs1235441179 1044 dbSNP
rs976465883 1049 dbSNP
rs565527946 1054 dbSNP
rs1350108546 1056 dbSNP
rs961142925 1061 dbSNP
rs1015195744 1063 dbSNP
rs1286983529 1064 dbSNP
rs150027728 1068 dbSNP
rs1258742205 1069 dbSNP
rs952270031 1082 dbSNP
rs528909236 1086 dbSNP
rs1320923355 1088 dbSNP
rs563829290 1096 dbSNP
rs895313817 1099 dbSNP
rs1295965233 1101 dbSNP
rs1215974795 1105 dbSNP
rs1422993289 1106 dbSNP
rs1057068357 1111 dbSNP
rs1039205997 1112 dbSNP
rs1313259076 1112 dbSNP
rs1416832414 1112 dbSNP
rs1003614080 1121 dbSNP
rs186229967 1123 dbSNP
rs1440983043 1126 dbSNP
rs1281713983 1130 dbSNP
rs911611773 1134 dbSNP
rs542776237 1146 dbSNP
rs1373887341 1148 dbSNP
rs1350549122 1149 dbSNP
rs1292258299 1151 dbSNP
rs1249413262 1152 dbSNP
rs915105408 1169 dbSNP
rs531029077 1173 dbSNP
rs563932925 1175 dbSNP
rs1355498481 1176 dbSNP
rs920887078 1181 dbSNP
rs1172907737 1183 dbSNP
rs1453712417 1183 dbSNP
rs752758436 1185 dbSNP
rs545358826 1193 dbSNP
rs1396044842 1194 dbSNP
rs932597971 1202 dbSNP
rs1330957996 1206 dbSNP
rs1428140043 1207 dbSNP
rs1389768626 1210 dbSNP
rs973588578 1211 dbSNP
rs1304845310 1213 dbSNP
rs922450681 1217 dbSNP
rs767648007 1222 dbSNP
rs976578842 1223 dbSNP
rs1339656743 1225 dbSNP
rs959374483 1235 dbSNP
rs1189422813 1238 dbSNP
rs1033657476 1239 dbSNP
rs1194130241 1245 dbSNP
rs1254827370 1248 dbSNP
rs982623876 1251 dbSNP
rs970861279 1257 dbSNP
rs1447364082 1259 dbSNP
rs1251677695 1260 dbSNP
rs1373487727 1265 dbSNP
rs1462665203 1269 dbSNP
rs1169906300 1276 dbSNP
rs1392321117 1280 dbSNP
rs1060257 1282 dbSNP
rs1327099559 1286 dbSNP
rs1010112124 1287 dbSNP
rs1023091465 1288 dbSNP
rs1234432435 1297 dbSNP
rs201848498 1301 dbSNP
rs869243139 1302 dbSNP
rs397811145 1303 dbSNP
rs386385353 1305 dbSNP
rs959918920 1306 dbSNP
rs374667114 1307 dbSNP
rs386385352 1307 dbSNP
rs553239962 1307 dbSNP
rs5818648 1307 dbSNP
rs1195529296 1309 dbSNP
rs1032936774 1318 dbSNP
rs1300328707 1326 dbSNP
rs553047967 1327 dbSNP
rs373243616 1332 dbSNP
rs1452237446 1333 dbSNP
rs1288840193 1336 dbSNP
rs1174533419 1337 dbSNP
rs1038718622 1349 dbSNP
rs1436763821 1350 dbSNP
rs146380761 1351 dbSNP
rs141994153 1352 dbSNP
rs1294568524 1359 dbSNP
rs1432588935 1363 dbSNP
rs55936694 1375 dbSNP
rs893801484 1376 dbSNP
rs376915929 1386 dbSNP
rs920731137 1396 dbSNP
rs1250744824 1397 dbSNP
rs1420076300 1402 dbSNP
rs973639294 1403 dbSNP
rs938242015 1405 dbSNP
rs569850454 1406 dbSNP
rs1455866235 1408 dbSNP
rs1252967448 1424 dbSNP
rs1311427391 1432 dbSNP
rs1414982885 1439 dbSNP
rs1314361131 1442 dbSNP
rs557974979 1445 dbSNP
rs1390323444 1449 dbSNP
rs1307543898 1451 dbSNP
rs34684838 1455 dbSNP
rs796558699 1455 dbSNP
rs971132920 1462 dbSNP
rs113538348 1463 dbSNP
rs539347773 1472 dbSNP
rs1211819741 1473 dbSNP
rs565967507 1478 dbSNP
rs113089978 1479 dbSNP
rs1251407215 1481 dbSNP
rs1421374104 1482 dbSNP
rs1313805453 1483 dbSNP
rs1416857295 1484 dbSNP
rs1032820616 1485 dbSNP
rs1435748581 1486 dbSNP
rs796357152 1488 dbSNP
rs1302394493 1490 dbSNP
rs1454354785 1491 dbSNP
rs1171226094 1494 dbSNP
rs1175062512 1496 dbSNP
rs567627965 1500 dbSNP
rs964686234 1501 dbSNP
rs528874509 1502 dbSNP
rs1161321934 1504 dbSNP
rs1017928698 1508 dbSNP
rs1298240396 1509 dbSNP
rs368908903 1513 dbSNP
rs1410960827 1514 dbSNP
rs548369517 1517 dbSNP
rs1371399701 1522 dbSNP
rs1236239107 1526 dbSNP
rs9921219 1537 dbSNP
rs1305971340 1542 dbSNP
rs1204148749 1545 dbSNP
rs1443844659 1547 dbSNP
rs1047480445 1548 dbSNP
rs1192249429 1550 dbSNP
rs1252930786 1551 dbSNP
rs770805858 1552 dbSNP
rs1060258 1554 dbSNP
rs899358701 1555 dbSNP
rs1037858442 1557 dbSNP
rs1417892327 1560 dbSNP
rs35257784 1561 dbSNP
rs1485928353 1563 dbSNP
rs1028302359 1564 dbSNP
rs35886461 1568 dbSNP
rs997267289 1568 dbSNP
rs901057284 1572 dbSNP
rs1459435905 1573 dbSNP
rs182903836 1575 dbSNP
rs886933049 1580 dbSNP
rs1268172054 1582 dbSNP
rs1328997809 1585 dbSNP
rs1294357451 1588 dbSNP
rs1247417542 1589 dbSNP
rs537667433 1591 dbSNP
rs1047046161 1592 dbSNP
rs949420840 1593 dbSNP
rs769476851 1599 dbSNP
rs545589322 1606 dbSNP
rs1382948874 1608 dbSNP
rs767042312 1609 dbSNP
rs1216153417 1612 dbSNP
rs1240692702 1613 dbSNP
rs1387259288 1617 dbSNP
rs533420288 1626 dbSNP
rs1421222567 1627 dbSNP
rs1473901862 1634 dbSNP
rs1455640219 1635 dbSNP
rs560013529 1636 dbSNP
rs1316169976 1639 dbSNP
rs988240208 1645 dbSNP
rs1344333469 1646 dbSNP
rs958129713 1648 dbSNP
rs1289594758 1652 dbSNP
rs1342604117 1654 dbSNP
rs1165441475 1660 dbSNP
rs1292730144 1661 dbSNP
rs925344126 1672 dbSNP
rs928160820 1673 dbSNP
rs978624201 1678 dbSNP
rs964900663 1680 dbSNP
rs747878745 1681 dbSNP
rs1446727835 1690 dbSNP
rs113627776 1691 dbSNP
rs1484472706 1693 dbSNP
rs1428685997 1694 dbSNP
rs574061095 1699 dbSNP
rs1186828058 1701 dbSNP
rs1021118138 1702 dbSNP
rs954418024 1715 dbSNP
rs529511449 1716 dbSNP
rs1407163555 1723 dbSNP
rs1206274748 1725 dbSNP
rs78174881 1727 dbSNP
rs190296005 1728 dbSNP
rs138809019 1737 dbSNP
rs1274330227 1741 dbSNP
rs1212047775 1749 dbSNP
rs996820894 1750 dbSNP
rs1354724259 1751 dbSNP
rs901180687 1755 dbSNP
rs1350587310 1759 dbSNP
rs1228436194 1760 dbSNP
rs1002377021 1761 dbSNP
rs1288561709 1763 dbSNP
rs905324269 1765 dbSNP
rs1046655707 1768 dbSNP
rs949645916 1773 dbSNP
rs146102397 1774 dbSNP
rs1052462303 1775 dbSNP
rs141881425 1778 dbSNP
rs1255696177 1779 dbSNP
rs1180478128 1780 dbSNP
rs995758103 1783 dbSNP
rs894188352 1790 dbSNP
rs554056017 1791 dbSNP
rs751100968 1794 dbSNP
rs975457575 1796 dbSNP
rs1406972099 1797 dbSNP
rs1326920964 1798 dbSNP
rs1335287509 1799 dbSNP
rs938480875 1806 dbSNP
rs928273873 1809 dbSNP
rs1388329387 1822 dbSNP
rs1369157353 1823 dbSNP
rs1234021046 1824 dbSNP
rs58628744 1825 dbSNP
rs71973446 1825 dbSNP
rs964585511 1827 dbSNP
rs1462233975 1828 dbSNP
rs17175483 1831 dbSNP
rs914170354 1832 dbSNP
rs1180383805 1833 dbSNP
rs910349970 1834 dbSNP
rs987426996 1838 dbSNP
rs1186175489 1842 dbSNP
rs1194026895 1852 dbSNP
rs1379212886 1857 dbSNP
rs11541880 1859 dbSNP
rs1448316857 1861 dbSNP
rs954811490 1863 dbSNP
rs1395801249 1867 dbSNP
rs1201674932 1868 dbSNP
rs958451454 1872 dbSNP
rs1333872910 1873 dbSNP
rs535387532 1874 dbSNP
rs148106276 1880 dbSNP
rs1304593747 1882 dbSNP
rs1333233555 1886 dbSNP
rs1224743672 1893 dbSNP
rs1269256357 1894 dbSNP
rs549405626 1895 dbSNP
rs754205015 1896 dbSNP
rs778056149 1902 dbSNP
rs1270799312 1904 dbSNP
rs1019554145 1908 dbSNP
rs143140219 1910 dbSNP
rs570537685 1922 dbSNP
rs185833084 1930 dbSNP
rs1002331913 1936 dbSNP
rs905379104 1944 dbSNP
rs1025585170 1947 dbSNP
rs533595527 1948 dbSNP
rs756353030 1949 dbSNP
rs892755323 1954 dbSNP
rs55952628 1955 dbSNP
rs1461353450 1956 dbSNP
rs1329268513 1960 dbSNP
rs767739545 1965 dbSNP
rs1380902824 1969 dbSNP
rs181397450 1970 dbSNP
rs903824135 1975 dbSNP
rs1326651746 1980 dbSNP
rs536019703 1984 dbSNP
rs562062934 1985 dbSNP
rs543839456 1986 dbSNP
rs912631049 1987 dbSNP
rs1428650039 1988 dbSNP
rs1484731871 1992 dbSNP
rs1204325241 1994 dbSNP
rs1262232822 1999 dbSNP
rs987739325 2005 dbSNP
rs576416974 2008 dbSNP
rs564617634 2009 dbSNP
rs751678536 2012 dbSNP
rs1477360438 2017 dbSNP
rs545649184 2020 dbSNP
rs762915824 2021 dbSNP
rs980444973 2024 dbSNP
rs969570507 2025 dbSNP
rs1452341604 2027 dbSNP
rs1054444210 2028 dbSNP
rs149074946 2032 dbSNP
rs1014208139 2042 dbSNP
rs892597838 2045 dbSNP
rs1250008638 2046 dbSNP
rs565728885 2047 dbSNP
rs1310717200 2049 dbSNP
rs547693507 2051 dbSNP
rs553585014 2052 dbSNP
rs1001090802 2055 dbSNP
rs535352546 2058 dbSNP
rs1217532737 2061 dbSNP
rs1040135652 2065 dbSNP
rs942704072 2066 dbSNP
rs1274142670 2072 dbSNP
rs891240440 2073 dbSNP
rs138206111 2074 dbSNP
rs1352121154 2082 dbSNP
rs568359696 2083 dbSNP
rs919062404 2085 dbSNP
rs1027024868 2089 dbSNP
rs1181769966 2090 dbSNP
rs1381254610 2092 dbSNP
rs74039959 2093 dbSNP
rs35608280 2100 dbSNP
rs1060266 2101 dbSNP
rs909116929 2102 dbSNP
rs1423808988 2108 dbSNP
rs537464607 2109 dbSNP
rs1159680663 2110 dbSNP
rs1370587302 2115 dbSNP
rs1309917210 2123 dbSNP
rs189022360 2124 dbSNP
rs969076908 2129 dbSNP
rs1181907395 2130 dbSNP
rs1475689347 2133 dbSNP
rs1020048609 2134 dbSNP
rs1257804948 2137 dbSNP
rs1010028979 2138 dbSNP
rs892787169 2139 dbSNP
rs1442157769 2140 dbSNP
rs917659178 2141 dbSNP
rs936900372 2142 dbSNP
rs147009012 2144 dbSNP
rs563592783 2145 dbSNP
rs1031154326 2149 dbSNP
rs1001019181 2150 dbSNP
rs968318678 2152 dbSNP
rs11541884 2158 dbSNP
rs982825731 2165 dbSNP
rs1331044301 2171 dbSNP
rs930094921 2172 dbSNP
rs1219996678 2175 dbSNP
rs149804348 2177 dbSNP
rs533687834 2180 dbSNP
rs1218086875 2181 dbSNP
rs1258862899 2182 dbSNP
rs1286291470 2185 dbSNP
rs1459462526 2187 dbSNP
rs138559489 2188 dbSNP
rs1007343235 2189 dbSNP
rs974120862 2190 dbSNP
rs1489022655 2192 dbSNP
rs958845503 2196 dbSNP
rs1285627417 2197 dbSNP
rs746483004 2200 dbSNP
rs566257213 2201 dbSNP
rs548058831 2204 dbSNP
rs994188152 2205 dbSNP
rs1425211493 2207 dbSNP
rs529566759 2209 dbSNP
rs1325176259 2211 dbSNP
rs1387070858 2215 dbSNP
rs1158950995 2217 dbSNP
rs1286968775 2219 dbSNP
rs1036181612 2220 dbSNP
rs11541883 2227 dbSNP
rs892908849 2236 dbSNP
rs1180359416 2237 dbSNP
rs1472558291 2240 dbSNP
rs909159144 2241 dbSNP
rs1242779073 2242 dbSNP
rs1033066728 2245 dbSNP
rs1037511311 2249 dbSNP
rs1044948073 2251 dbSNP
rs116696164 2252 dbSNP
rs1039932612 2259 dbSNP
rs1264659042 2260 dbSNP
rs917563478 2264 dbSNP
rs991928870 2265 dbSNP
rs371258446 2271 dbSNP
rs956469735 2281 dbSNP
rs1047245274 2282 dbSNP
rs1322129849 2284 dbSNP
rs923675710 2293 dbSNP
rs1399585196 2294 dbSNP
rs1291691829 2296 dbSNP
rs979630735 2297 dbSNP
rs111922215 2298 dbSNP
rs771452324 2304 dbSNP
rs16943300 2307 dbSNP
rs1297770676 2308 dbSNP
rs1380518551 2317 dbSNP
rs1230584426 2321 dbSNP
rs551955281 2327 dbSNP
rs1436612932 2334 dbSNP
rs981349668 2341 dbSNP
rs971334078 2342 dbSNP
rs955574978 2344 dbSNP
rs868212111 2345 dbSNP
rs1186206719 2360 dbSNP
rs1020110519 2368 dbSNP
rs1320506138 2372 dbSNP
rs994115168 2379 dbSNP
rs1237598129 2381 dbSNP
rs897277022 2388 dbSNP
rs1473719083 2389 dbSNP
rs1038414471 2391 dbSNP
rs1458819858 2395 dbSNP
rs1006011400 2396 dbSNP
rs887583928 2403 dbSNP
rs1045401929 2404 dbSNP
rs947973839 2405 dbSNP
rs147766951 2406 dbSNP
rs1362691079 2412 dbSNP
rs187044466 2418 dbSNP
rs1359858710 2419 dbSNP
rs1170610614 2425 dbSNP
rs1450765522 2427 dbSNP
rs1278319756 2429 dbSNP
rs996203145 2431 dbSNP
rs1241318883 2433 dbSNP
rs1056171082 2436 dbSNP
rs964404182 2437 dbSNP
rs572487053 2438 dbSNP
rs934978989 2440 dbSNP
rs1278665480 2441 dbSNP
rs1202284332 2445 dbSNP
rs1018598118 2446 dbSNP
rs112381392 2450 dbSNP
rs1185875059 2456 dbSNP
rs979138398 2458 dbSNP
rs1180264590 2462 dbSNP
rs891397910 2471 dbSNP
rs1452776858 2472 dbSNP
rs946883770 2475 dbSNP
rs374132380 2476 dbSNP
rs898537787 2482 dbSNP
rs1248313949 2488 dbSNP
rs574357687 2489 dbSNP
rs11117303 2502 dbSNP
rs1400191375 2506 dbSNP
rs144333921 2508 dbSNP
rs756413254 2509 dbSNP
rs1232014333 2510 dbSNP
rs576760543 2511 dbSNP
rs1339472202 2513 dbSNP
rs1346421370 2514 dbSNP
rs748534290 2527 dbSNP
rs1256933855 2529 dbSNP
rs1458141917 2533 dbSNP
rs1016981477 2537 dbSNP
rs377702112 2540 dbSNP
rs1450847546 2542 dbSNP
rs373357057 2545 dbSNP
rs1387865655 2548 dbSNP
rs1370355450 2549 dbSNP
rs1168591104 2550 dbSNP
rs371057687 2558 dbSNP
rs1292206023 2561 dbSNP
rs558312406 2563 dbSNP
rs1371518259 2568 dbSNP
rs887625934 2573 dbSNP
rs533885645 2574 dbSNP
rs869308876 2574 dbSNP
rs989015436 2578 dbSNP
rs566576928 2580 dbSNP
rs957228350 2582 dbSNP
rs1428275730 2584 dbSNP
rs1276985466 2586 dbSNP
rs1318039127 2589 dbSNP
rs925818422 2594 dbSNP
rs1271215327 2595 dbSNP
rs1803523 2596 dbSNP
rs1355300798 2600 dbSNP
rs1210212285 2604 dbSNP
rs1269256239 2617 dbSNP
rs774359655 2618 dbSNP
rs1012481422 2619 dbSNP
rs1191811358 2620 dbSNP
rs554364978 2622 dbSNP
rs559348048 2623 dbSNP
rs536069933 2624 dbSNP
rs1367229993 2628 dbSNP
rs568739821 2630 dbSNP
rs1427157735 2634 dbSNP
rs1393381998 2635 dbSNP
rs182523553 2636 dbSNP
rs114696078 2643 dbSNP
rs1340539349 2644 dbSNP
rs898658774 2647 dbSNP
rs1252207086 2652 dbSNP
rs1290980173 2655 dbSNP
rs1206865061 2657 dbSNP
rs1481830145 2668 dbSNP
rs574212905 2669 dbSNP
rs1001609700 2674 dbSNP
rs905964377 2675 dbSNP
rs1045731738 2680 dbSNP
rs946509738 2681 dbSNP
rs950037774 2682 dbSNP
rs1423712958 2685 dbSNP
rs1188890998 2687 dbSNP
rs1370514529 2689 dbSNP
rs1438245350 2692 dbSNP
rs1299861554 2693 dbSNP
rs1360766079 2703 dbSNP
rs552334871 2719 dbSNP
rs985678517 2720 dbSNP
rs1310172205 2724 dbSNP
rs934150678 2725 dbSNP
rs1333698952 2727 dbSNP
rs1239152910 2740 dbSNP
rs935949250 2743 dbSNP
rs925794909 2745 dbSNP
rs922858814 2750 dbSNP
rs756680708 2751 dbSNP
rs746210823 2753 dbSNP
rs1173891459 2756 dbSNP
rs1480034126 2757 dbSNP
rs1274706485 2758 dbSNP
rs975004402 2761 dbSNP
rs527737576 2763 dbSNP
rs1173541771 2764 dbSNP
rs1376514666 2765 dbSNP
rs1466107693 2769 dbSNP
rs972925028 2770 dbSNP
rs560229419 2774 dbSNP
rs1249354433 2775 dbSNP
rs1016868786 2777 dbSNP
rs1311613898 2783 dbSNP
rs984511252 2783 dbSNP
rs766437709 2784 dbSNP
rs1198602442 2786 dbSNP
rs1026435912 2787 dbSNP
rs868454198 2790 dbSNP
rs541596804 2791 dbSNP
rs1330427717 2800 dbSNP
rs1177574900 2805 dbSNP
rs1420889221 2809 dbSNP
rs1465002450 2812 dbSNP
rs1012123692 2813 dbSNP
rs1290664479 2814 dbSNP
rs781663047 2822 dbSNP
rs896284172 2823 dbSNP
rs750273857 2824 dbSNP
rs529818513 2826 dbSNP
rs73251309 2836 dbSNP
rs1367157743 2845 dbSNP
rs1387614582 2846 dbSNP
rs1285224065 2858 dbSNP
rs905910672 2877 dbSNP
rs1024395915 2879 dbSNP
rs1313738064 2881 dbSNP
rs756912494 2886 dbSNP
rs1219809265 2890 dbSNP
rs1397951623 2904 dbSNP
rs1488584439 2908 dbSNP
rs1192600276 2909 dbSNP
rs1014385059 2913 dbSNP
rs1260347723 2929 dbSNP
rs891793538 2932 dbSNP
rs1053557365 2939 dbSNP
rs1425688148 2939 dbSNP
rs1302268256 2945 dbSNP
rs761656793 2948 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.641 8.7e-4 -0.478 1.4e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.635 1.3e-3 -0.743 8.7e-5 20 Click to see details
GSE14794 Lymphoblastoid cells 0.278 4.0e-3 0.158 6.8e-2 90 Click to see details
GSE17306 Multiple myeloma 0.295 2.0e-2 0.321 1.2e-2 49 Click to see details
GSE19536 Breast cancer -0.191 2.8e-2 -0.270 3.3e-3 100 Click to see details
GSE19783 ER- ER- breast cancer -0.189 4.8e-2 -0.259 1.1e-2 79 Click to see details
GSE17498 Multiple myeloma -0.252 5.8e-2 -0.157 1.7e-1 40 Click to see details
GSE27834 Pluripotent stem cells 0.378 7.4e-2 0.318 1.2e-1 16 Click to see details
GSE21032 Prostate cancer 0.159 7.6e-2 0.158 7.7e-2 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.257 1.1e-1 0.285 8.4e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.265 1.3e-1 -0.359 6.0e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.193 1.8e-1 0.433 1.5e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.181 2.0e-1 0.198 1.8e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.173 2.1e-1 -0.273 1.0e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.173 2.9e-1 -0.088 3.9e-1 13 Click to see details
GSE28544 Breast cancer -0.107 3.1e-1 -0.392 2.9e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.062 3.1e-1 0.007 4.8e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.073 3.5e-1 0.234 9.9e-2 32 Click to see details
GSE19350 CNS germ cell tumors -0.094 3.9e-1 0.021 4.7e-1 12 Click to see details
GSE21849 B cell lymphoma 0.042 4.1e-1 0.431 9.8e-3 29 Click to see details
GSE21849 B cell lymphoma 0.042 4.1e-1 0.431 9.8e-3 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.496 0 0.419 0 42 Click to see details
KIRC -0.257 0.02 -0.218 0.04 68 Click to see details
THCA 0.262 0.02 0.265 0.02 59 Click to see details
BRCA -0.213 0.03 -0.189 0.04 84 Click to see details
KICH 0.311 0.07 0.379 0.03 25 Click to see details
CESC -0.966 0.08 -1.000 0.5 3 Click to see details
PAAD -0.821 0.09 -0.800 0.1 4 Click to see details
LIHC -0.193 0.09 -0.157 0.14 49 Click to see details
PRAD 0.171 0.12 0.186 0.1 50 Click to see details
KIRP 0.21 0.12 0.269 0.07 32 Click to see details
UCEC -0.268 0.13 -0.119 0.31 19 Click to see details
COAD 0.377 0.18 0.500 0.1 8 Click to see details
BLCA 0.174 0.24 0.214 0.2 18 Click to see details
LUSC 0.114 0.25 0.051 0.38 38 Click to see details
STAD -0.104 0.29 -0.105 0.28 32 Click to see details
CHOL -0.212 0.29 -0.217 0.29 9 Click to see details
PCPG 0.23 0.43 0.500 0.33 3 Click to see details
LUAD -0.055 0.43 0.021 0.47 12 Click to see details
ESCA 0.035 0.46 -0.009 0.49 11 Click to see details
ESCA 0.035 0.46 -0.009 0.49 11 Click to see details
ESCA 0.035 0.46 -0.009 0.49 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17