miRTarBase - #MIRT726455 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SRPK1   
Synonyms SFRSK1
Description SRSF protein kinase 1
Transcript NM_003137   
Expression
Putative miRNA Targets on SRPK1
3'UTR of SRPK1
(miRNA target sites are highlighted)
>SRPK1|NM_003137|3'UTR
   1 GCCCCTGCCCAGCACCACAGCAGAGATCACACACTGACCCTCCGCCCTTCCCCTTCAAGCATTTTCCTCTTCCCTTTTCA
  81 GGGTGAAGCTCTTCCTTCAAGAGTTTCTAGATCTTGTTTTTTTTTTAATCCAACATGTTCATTTGGGTTTGCTTACTTGA
 161 CCCTGTGGAGATCCCCACAGCCATTGGGCATCCTAGGTGAATTTGGCCTTGGTTGGGCTCTGCCAAAGACTAATGGACTA
 241 AAATGTGAAACAGCCTCTTGCCCTGTACCTTTCCTTCCCATTAGGACATCCTTTAAATTATAAGCATCCTTTTTGAAAAG
 321 AGCTATGAAGGTGTATGAGCCCATCCTTTTATTCATTGACTCTAAGAGTCAAATTTTCTAGTGCATATCCTATTGCCAGC
 401 ATAAGGATGAGGAGGGGGAAAGGGTCTTAATTCTATGTACAGCAGAGACATTAAACTTGCTGTGTCCGGGCTGCATCATC
 481 TTCCTGGACTGTTTCTGTTGTTCTCTGTGTTCACATTTTTTCCTGCAACTTTTAAGCTACTGTCTTTTTTAAATAGCTAT
 561 ATGAACACCAAATTTGGGTACCATTTTATCACTGTTCAAAGCACTGTCAAATTCCTTTCATCCTTTAATAGTTAAGATCT
 641 TTGAATCTTCAGTCTGATTTTTAATGTAAGCAAAAACAGAACCATTGAATAGTAATTTCTTGAGAACCTCAGGTGTTCTA
 721 TAAACAGTCCTTTCCTGTATGTCTTCTATTACCCTAAGACCAGAGTTATTTTGGTTGGTTGTTTTGTTTTATTTTTTGTT
 801 TTTGTATCCATGGCTGGCACTTTACTCATTGCACTTGAGTTTATTGCCCCATAACTAAAGGATCAGGATGATGGTAGAAC
 881 GGAGATCTGGGTTTCAGAGCTTTCCCATTTAAGAAAAATAGATCTTGAGATTCTGATTCTTTTCCAAACAGTCCCCTGCT
 961 TTCATGTACAGCTTTTTCTTTACCTTACCCAAAATTCTGGCCTTGAAGCAGTTTTCCTCTATGGCTTTGCCTTTCTGATT
1041 TTCTCAGAGGCTCGAGTCTTTAATATAACCCCAAATGAAAGAACCAAGGGGAGGGGTGGGATGGCACTTTTTTTTGTTGG
1121 TCTTGTTTTGTTTTGTTTTTTGGTTGGTTGGTTCGTTATTTTTTAAGATTAGCCATTCTCTGCTGCTATTTCCCTACATA
1201 ATGTCAATTTTTAACCATAATTTTGACATGATTGAGATGTACTTGAGGCTTTTTTGTTTTAATTGAGAAAAGACTTTGCA
1281 ATTTTTTTTTTAGGATGAGCCTCTCCTAGACTTGACCTAGAATATTACATATTCCTCCAGTAAGTAATACTGAAGAGCAA
1361 AAGAGAGGCAGGATTGGGGTCACAGCCGCTTCTTCAGCATGGACCAAGTGGGCCTTGGGGATTGCAGCGTTCTCGAAGTG
1441 GCTGTAGGACTCGAATTTACAGAAAGCCACAGAGGTGCAACTTGAGGCTCTGCTAGCAAGCCACCAGTGAGGCTATTGGG
1521 TAACCACCTTTCTATACAGGAGATTGGAATCTACTTTGTCATTTATCCACCACAGTGACAAAGGAAAAGTGGTGCCGTTA
1601 TGCAATCCATTTAACTCATAAACATATTACTCTGAGTAACTGGCCAGCCATTCATCGGATCCTTCATTGGGTACTCCTGA
1681 AATCAGACATGTTCCTGTAGAAAGAATTTTAAGTTAGGCTTTCTATGCACCTATCAAGAATCAAGAGAATAGATTGTATC
1761 AAACAACGGCAGGGAAATCCTTCAGCAATTCTAATCCACTTTGGGTTTTCAGCTGTTTTTACATCTAAAGCAATAGACTA
1841 GAACTGAATTATCTTCTACATAGTAAAATCACAATTGTGGAATTACAGGAATTCTGGTGATATTAAGGTGAAATAACAAA
1921 ACACAAAAGGCCCTATTTTAACAGTTGATGTGACAGTAAGTTTTAATAGAACCTGTAACTTCATTTTGGAAATGCTTCTC
2001 CACCAAATAAGGGCTTTTTCCCCTATTTAAGGAGCCAGATGGATTGAAAGATGTGGAAATAGGCAGCTGTAGATCTTGAT
2081 CTTCCAGGTACCCCATGTACCTTTATTGAGCTTAATTATAATACTGTCAAATTGCCACGATCTCACTAAAGGATTTCTAT
2161 TTGCTGTCAGTTAAAAATAAAGCCCTAAATACATTTTTATTCTTTCTACTGAGGGCATTGTCTGTTTTCTTTGTAAATGC
2241 CGTACAATAAACAAATTATTTAATAACCTAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |:||||| | ||||||| 
Target 5' gattAGCCATTCTCTGCTGCTa 3'
1167 - 1188 170.00 -17.20
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :::||::|| | ||:||:| 
Target 5' ccTGGACTGTT-TCTGTTGTTc 3'
483 - 503 127.00 -7.50
3
miRNA  3' guguUUG--GUAAUAC----ACGACGAu 5'
              |||  |||| ||    |||| || 
Target 5' ctgtAACTTCATTTTGGAAATGCTTCTc 3'
1973 - 2000 126.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31510260 13 COSMIC
COSN30173050 74 COSMIC
COSN28995024 116 COSMIC
COSN28837679 117 COSMIC
COSN30165426 247 COSMIC
COSN20091378 251 COSMIC
COSN17037336 315 COSMIC
COSN31484178 389 COSMIC
COSN7052432 825 COSMIC
COSN31519894 1114 COSMIC
COSN15841956 1139 COSMIC
COSN31594884 1143 COSMIC
COSN20102767 1151 COSMIC
COSN31490308 1234 COSMIC
COSN20102766 1282 COSMIC
COSN20102765 1339 COSMIC
COSN17038029 1394 COSMIC
COSN27216364 1422 COSMIC
COSN31572476 1526 COSMIC
COSN31547483 1595 COSMIC
COSN8514238 1656 COSMIC
COSN32064219 1679 COSMIC
COSN30174168 1783 COSMIC
COSN31530843 1831 COSMIC
COSN15975475 1872 COSMIC
COSN6319397 1878 COSMIC
COSN16489613 1899 COSMIC
COSN31565327 2144 COSMIC
COSN31548676 2202 COSMIC
COSN22049792 2211 COSMIC
COSN24301743 2237 COSMIC
COSN28701195 2242 COSMIC
COSN19660470 2285 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs976935312 2 dbSNP
rs1416620395 6 dbSNP
rs1355997568 15 dbSNP
rs1312104213 19 dbSNP
rs1279930465 20 dbSNP
rs773264516 21 dbSNP
rs1400376455 22 dbSNP
rs372992921 30 dbSNP
rs766919610 35 dbSNP
rs1462565128 38 dbSNP
rs909439386 42 dbSNP
rs761328840 43 dbSNP
rs546836509 44 dbSNP
rs1410092092 52 dbSNP
rs1289632307 56 dbSNP
rs1343111894 60 dbSNP
rs1223359523 65 dbSNP
rs528395637 71 dbSNP
rs1314526637 81 dbSNP
rs1202838162 83 dbSNP
rs1233196771 90 dbSNP
rs1483481778 90 dbSNP
rs1333401652 95 dbSNP
rs1266786800 98 dbSNP
rs964228591 100 dbSNP
rs1191911199 103 dbSNP
rs1017757259 107 dbSNP
rs1425761308 109 dbSNP
rs758595221 113 dbSNP
rs564256941 115 dbSNP
rs1440601303 117 dbSNP
rs1007342868 118 dbSNP
rs968114646 121 dbSNP
rs1429930194 123 dbSNP
rs1309481210 127 dbSNP
rs530585321 127 dbSNP
rs1435111930 129 dbSNP
rs1293656997 140 dbSNP
rs1370319183 141 dbSNP
rs1213358332 157 dbSNP
rs1305053203 176 dbSNP
rs1388811829 180 dbSNP
rs991954018 183 dbSNP
rs1343332845 184 dbSNP
rs960700577 203 dbSNP
rs1021963528 207 dbSNP
rs1030859167 208 dbSNP
rs1009405113 211 dbSNP
rs1459779109 225 dbSNP
rs999332980 235 dbSNP
rs1390690756 260 dbSNP
rs892396961 262 dbSNP
rs1022246962 265 dbSNP
rs1034793691 280 dbSNP
rs1003313557 283 dbSNP
rs1389250059 297 dbSNP
rs1449842699 301 dbSNP
rs79712827 306 dbSNP
rs1170321242 313 dbSNP
rs746115145 323 dbSNP
rs778606212 325 dbSNP
rs1164815624 327 dbSNP
rs779044309 330 dbSNP
rs1007217338 333 dbSNP
rs1429164130 335 dbSNP
rs889157827 340 dbSNP
rs1366640033 341 dbSNP
rs905055393 344 dbSNP
rs144182676 351 dbSNP
rs772536979 351 dbSNP
rs1358950356 354 dbSNP
rs757159693 362 dbSNP
rs1292050096 368 dbSNP
rs1361568259 372 dbSNP
rs1200548312 378 dbSNP
rs1045550710 379 dbSNP
rs1247330472 384 dbSNP
rs1454487928 392 dbSNP
rs1190234186 398 dbSNP
rs933423718 405 dbSNP
rs1241071282 409 dbSNP
rs1472232213 411 dbSNP
rs941496323 414 dbSNP
rs1213503915 422 dbSNP
rs1415248397 422 dbSNP
rs527769044 435 dbSNP
rs1047105328 437 dbSNP
rs1270512932 444 dbSNP
rs940890815 448 dbSNP
rs930186247 450 dbSNP
rs1350038950 453 dbSNP
rs1448950416 455 dbSNP
rs1277914022 464 dbSNP
rs185686385 467 dbSNP
rs1372048322 468 dbSNP
rs377047440 478 dbSNP
rs985045487 487 dbSNP
rs948294828 494 dbSNP
rs1260959244 507 dbSNP
rs1302985604 507 dbSNP
rs1441637246 511 dbSNP
rs977028271 512 dbSNP
rs916255266 523 dbSNP
rs1468323479 529 dbSNP
rs1180783596 532 dbSNP
rs942853358 544 dbSNP
rs757339140 547 dbSNP
rs1473827355 550 dbSNP
rs761411483 551 dbSNP
rs551959819 559 dbSNP
rs530903163 561 dbSNP
rs986244201 567 dbSNP
rs1336614338 574 dbSNP
rs1438382599 575 dbSNP
rs1409476361 584 dbSNP
rs1289012685 589 dbSNP
rs1367115404 592 dbSNP
rs1230083332 597 dbSNP
rs960502337 600 dbSNP
rs865994112 603 dbSNP
rs1022349639 610 dbSNP
rs563487040 612 dbSNP
rs1280518279 621 dbSNP
rs1481842774 628 dbSNP
rs1382123636 630 dbSNP
rs1204022383 632 dbSNP
rs977821100 637 dbSNP
rs560172218 639 dbSNP
rs541798059 655 dbSNP
rs1196727037 670 dbSNP
rs956397442 682 dbSNP
rs574809563 684 dbSNP
rs1034888513 690 dbSNP
rs754313201 696 dbSNP
rs1478666955 700 dbSNP
rs764541217 702 dbSNP
rs1191374704 708 dbSNP
rs1417838783 718 dbSNP
rs1429282381 725 dbSNP
rs1023472917 730 dbSNP
rs1022130546 734 dbSNP
rs1006017521 737 dbSNP
rs1403162406 737 dbSNP
rs1330414055 742 dbSNP
rs1233916368 743 dbSNP
rs559511121 744 dbSNP
rs1006817563 748 dbSNP
rs1339813668 753 dbSNP
rs547190138 758 dbSNP
rs1274895263 763 dbSNP
rs1029012397 769 dbSNP
rs997895961 775 dbSNP
rs888554599 778 dbSNP
rs1047199670 782 dbSNP
rs1240655304 782 dbSNP
rs1449238102 788 dbSNP
rs1169684955 791 dbSNP
rs1282201672 792 dbSNP
rs753664861 798 dbSNP
rs929945963 804 dbSNP
rs901207332 808 dbSNP
rs1162695055 812 dbSNP
rs756499675 813 dbSNP
rs1387215288 817 dbSNP
rs181579152 824 dbSNP
rs911345274 832 dbSNP
rs887978352 836 dbSNP
rs978965758 843 dbSNP
rs1049659653 844 dbSNP
rs1298116425 850 dbSNP
rs1343810142 853 dbSNP
rs1242190894 854 dbSNP
rs577477441 862 dbSNP
rs1264289463 873 dbSNP
rs1344039455 877 dbSNP
rs1211185231 880 dbSNP
rs559186328 881 dbSNP
rs28718591 883 dbSNP
rs879097989 888 dbSNP
rs1464877676 889 dbSNP
rs528927195 891 dbSNP
rs537690666 895 dbSNP
rs987880545 897 dbSNP
rs1422232316 908 dbSNP
rs1187116644 915 dbSNP
rs1369340913 921 dbSNP
rs1056707151 932 dbSNP
rs939040992 947 dbSNP
rs1156951521 948 dbSNP
rs1386323967 963 dbSNP
rs956366829 964 dbSNP
rs1320925772 965 dbSNP
rs1367109079 966 dbSNP
rs559719997 967 dbSNP
rs1311563216 970 dbSNP
rs1340759388 978 dbSNP
rs1414817526 981 dbSNP
rs1374323003 988 dbSNP
rs1171358156 989 dbSNP
rs977870396 991 dbSNP
rs967756700 992 dbSNP
rs1270340004 994 dbSNP
rs1482480426 1000 dbSNP
rs1200302777 1017 dbSNP
rs915081221 1018 dbSNP
rs982399728 1021 dbSNP
rs1180056600 1023 dbSNP
rs1411356988 1043 dbSNP
rs985675676 1046 dbSNP
rs557128636 1053 dbSNP
rs953999816 1054 dbSNP
rs535214814 1058 dbSNP
rs1302096438 1063 dbSNP
rs969341669 1065 dbSNP
rs1030022228 1069 dbSNP
rs1397445701 1069 dbSNP
rs998094537 1089 dbSNP
rs1228544428 1094 dbSNP
rs1290744457 1097 dbSNP
rs966053274 1100 dbSNP
rs143170865 1103 dbSNP
rs370822508 1104 dbSNP
rs1484333480 1107 dbSNP
rs1203301511 1110 dbSNP
rs1005363785 1111 dbSNP
rs1014868440 1119 dbSNP
rs952680051 1121 dbSNP
rs534874495 1128 dbSNP
rs887822780 1130 dbSNP
rs1378010388 1140 dbSNP
rs1410036839 1140 dbSNP
rs1431407594 1140 dbSNP
rs1436131142 1142 dbSNP
rs1305793565 1143 dbSNP
rs1486003796 1144 dbSNP
rs1369626604 1145 dbSNP
rs397843864 1150 dbSNP
rs1409880058 1151 dbSNP
rs1309362538 1152 dbSNP
rs1366067621 1152 dbSNP
rs11546952 1154 dbSNP
rs994291931 1157 dbSNP
rs3840167 1158 dbSNP
rs61122704 1158 dbSNP
rs771418996 1158 dbSNP
rs1439827769 1159 dbSNP
rs200125744 1159 dbSNP
rs1049243786 1160 dbSNP
rs1012859671 1169 dbSNP
rs1274170636 1170 dbSNP
rs895300517 1173 dbSNP
rs1057159606 1179 dbSNP
rs901133747 1180 dbSNP
rs1213732720 1182 dbSNP
rs939575386 1188 dbSNP
rs1190561744 1194 dbSNP
rs923610298 1199 dbSNP
rs1166537271 1206 dbSNP
rs1041073579 1215 dbSNP
rs1389135796 1230 dbSNP
rs1007524839 1231 dbSNP
rs1171848800 1232 dbSNP
rs1347628765 1256 dbSNP
rs772801647 1256 dbSNP
rs1042038363 1260 dbSNP
rs1373899296 1263 dbSNP
rs946469330 1265 dbSNP
rs1233892769 1266 dbSNP
rs1354253870 1272 dbSNP
rs1310595879 1278 dbSNP
rs1043725995 1280 dbSNP
rs1230916465 1291 dbSNP
rs35223459 1292 dbSNP
rs914944578 1292 dbSNP
rs1411237114 1301 dbSNP
rs985212368 1304 dbSNP
rs1265938397 1309 dbSNP
rs1469798876 1317 dbSNP
rs1186396645 1318 dbSNP
rs1247211851 1323 dbSNP
rs1449642223 1335 dbSNP
rs1187912042 1342 dbSNP
rs1411270295 1344 dbSNP
rs3840168 1345 dbSNP
rs149057999 1348 dbSNP
rs368976177 1348 dbSNP
rs759833259 1348 dbSNP
rs922455838 1348 dbSNP
rs1397282350 1349 dbSNP
rs35242470 1350 dbSNP
rs570451615 1355 dbSNP
rs1409689414 1356 dbSNP
rs1320249939 1365 dbSNP
rs1366392907 1374 dbSNP
rs951468003 1380 dbSNP
rs961243972 1381 dbSNP
rs146430903 1384 dbSNP
rs771376047 1386 dbSNP
rs1378784884 1387 dbSNP
rs112328397 1388 dbSNP
rs1167736578 1389 dbSNP
rs532178164 1390 dbSNP
rs551949523 1392 dbSNP
rs1417229380 1404 dbSNP
rs1336795405 1421 dbSNP
rs1206762498 1428 dbSNP
rs1185949854 1429 dbSNP
rs983391828 1434 dbSNP
rs1233621314 1435 dbSNP
rs140939292 1441 dbSNP
rs200295899 1445 dbSNP
rs952035747 1448 dbSNP
rs981815371 1450 dbSNP
rs1204110384 1453 dbSNP
rs766422616 1461 dbSNP
rs1419416851 1464 dbSNP
rs540685092 1465 dbSNP
rs916485404 1493 dbSNP
rs1012331346 1498 dbSNP
rs1435859641 1501 dbSNP
rs1390104079 1507 dbSNP
rs1274874760 1512 dbSNP
rs1402784411 1515 dbSNP
rs1332655777 1516 dbSNP
rs895337941 1534 dbSNP
rs147319143 1536 dbSNP
rs1449059073 1551 dbSNP
rs576472744 1553 dbSNP
rs1348717090 1554 dbSNP
rs776588085 1557 dbSNP
rs1227938295 1565 dbSNP
rs1025484381 1567 dbSNP
rs1287639031 1573 dbSNP
rs994218559 1574 dbSNP
rs1351371318 1575 dbSNP
rs1225224656 1576 dbSNP
rs1276277216 1583 dbSNP
rs1441427317 1584 dbSNP
rs1210402042 1588 dbSNP
rs1291398388 1590 dbSNP
rs530141889 1594 dbSNP
rs1019608794 1596 dbSNP
rs75579999 1597 dbSNP
rs889797770 1601 dbSNP
rs1043279342 1605 dbSNP
rs1353108009 1608 dbSNP
rs576037520 1615 dbSNP
rs1328403341 1620 dbSNP
rs746994816 1624 dbSNP
rs1424922682 1634 dbSNP
rs1415192691 1641 dbSNP
rs541107658 1654 dbSNP
rs577466047 1656 dbSNP
rs1049979628 1664 dbSNP
rs372967375 1666 dbSNP
rs1462402102 1668 dbSNP
rs1308754904 1669 dbSNP
rs891960410 1673 dbSNP
rs932408707 1676 dbSNP
rs747135002 1679 dbSNP
rs1272801197 1681 dbSNP
rs1344039596 1689 dbSNP
rs922435676 1691 dbSNP
rs1053249075 1706 dbSNP
rs1390245573 1713 dbSNP
rs935066604 1714 dbSNP
rs1250643180 1715 dbSNP
rs544016406 1723 dbSNP
rs576678157 1725 dbSNP
rs189991739 1726 dbSNP
rs1478554807 1730 dbSNP
rs947714413 1731 dbSNP
rs1027647484 1733 dbSNP
rs916236944 1734 dbSNP
rs542606266 1737 dbSNP
rs574455260 1741 dbSNP
rs918411582 1743 dbSNP
rs115464911 1744 dbSNP
rs1321501988 1745 dbSNP
rs965225500 1750 dbSNP
rs1003686135 1752 dbSNP
rs771919305 1759 dbSNP
rs144068132 1767 dbSNP
rs1019667213 1768 dbSNP
rs1251316354 1774 dbSNP
rs985956556 1778 dbSNP
rs1011158151 1780 dbSNP
rs1207617353 1783 dbSNP
rs185377006 1788 dbSNP
rs1469340007 1791 dbSNP
rs1022082788 1792 dbSNP
rs552085915 1796 dbSNP
rs770251448 1798 dbSNP
rs1345836600 1799 dbSNP
rs939881374 1800 dbSNP
rs908381695 1804 dbSNP
rs1031779912 1811 dbSNP
rs1002971358 1815 dbSNP
rs1389878078 1829 dbSNP
rs1461915775 1845 dbSNP
rs907391136 1846 dbSNP
rs1046111028 1851 dbSNP
rs1386188490 1853 dbSNP
rs1434186183 1856 dbSNP
rs947837117 1857 dbSNP
rs545549376 1858 dbSNP
rs1327883383 1860 dbSNP
rs920597556 1861 dbSNP
rs894804742 1862 dbSNP
rs181414196 1866 dbSNP
rs569466858 1873 dbSNP
rs931200655 1874 dbSNP
rs867307236 1879 dbSNP
rs928064394 1880 dbSNP
rs918484049 1881 dbSNP
rs548094338 1895 dbSNP
rs1188191503 1897 dbSNP
rs530201482 1903 dbSNP
rs1240982147 1908 dbSNP
rs1021124472 1914 dbSNP
rs189418476 1923 dbSNP
rs1418684765 1935 dbSNP
rs1011168032 1943 dbSNP
rs958275225 1947 dbSNP
rs1028424103 1950 dbSNP
rs1456492557 1953 dbSNP
rs1349453675 1955 dbSNP
rs184525453 1956 dbSNP
rs996496446 1957 dbSNP
rs1280531127 1962 dbSNP
rs1233117494 1966 dbSNP
rs1393947337 1972 dbSNP
rs532588565 1974 dbSNP
rs565297696 1975 dbSNP
rs1040811972 1979 dbSNP
rs1299701530 1995 dbSNP
rs912386873 1999 dbSNP
rs985559086 2013 dbSNP
rs1329127768 2015 dbSNP
rs1240167665 2018 dbSNP
rs1003911006 2019 dbSNP
rs369083666 2030 dbSNP
rs954303339 2034 dbSNP
rs1021612188 2039 dbSNP
rs1258567230 2055 dbSNP
rs12198487 2061 dbSNP
rs532044050 2063 dbSNP
rs1409623859 2067 dbSNP
rs1048179348 2081 dbSNP
rs1377357945 2089 dbSNP
rs1174490148 2091 dbSNP
rs1365334874 2092 dbSNP
rs931244289 2095 dbSNP
rs1171632019 2099 dbSNP
rs867528924 2102 dbSNP
rs1375741501 2106 dbSNP
rs574044400 2106 dbSNP
rs542889978 2111 dbSNP
rs1031853348 2112 dbSNP
rs116329833 2117 dbSNP
rs907367560 2121 dbSNP
rs1393015094 2134 dbSNP
rs1023590494 2138 dbSNP
rs1011986235 2139 dbSNP
rs927946486 2146 dbSNP
rs1418649386 2147 dbSNP
rs552821058 2148 dbSNP
rs1184726600 2153 dbSNP
rs1350377364 2153 dbSNP
rs894913542 2157 dbSNP
rs1203065126 2159 dbSNP
rs182197421 2163 dbSNP
rs1251208017 2175 dbSNP
rs1374001990 2177 dbSNP
rs752909987 2178 dbSNP
rs1257689380 2184 dbSNP
rs189494916 2187 dbSNP
rs1252662827 2193 dbSNP
rs1431216737 2195 dbSNP
rs966747939 2198 dbSNP
rs930936982 2202 dbSNP
rs184395335 2206 dbSNP
rs536907279 2211 dbSNP
rs1166112912 2218 dbSNP
rs117793191 2241 dbSNP
rs1028601906 2242 dbSNP
rs1300403627 2246 dbSNP
rs554746720 2256 dbSNP
rs1386534841 2263 dbSNP
rs1304674342 2270 dbSNP
rs997505436 2272 dbSNP
rs755367208 2274 dbSNP
rs756655341 2280 dbSNP
rs1273921436 2285 dbSNP
rs1308145458 2286 dbSNP
rs1206783653 2288 dbSNP
rs1217406079 2290 dbSNP
rs753320422 2290 dbSNP
rs1019205668 2294 dbSNP
rs1192732007 2298 dbSNP
rs1253416805 2301 dbSNP
rs912389334 2303 dbSNP
rs1455253322 2306 dbSNP
rs1186275074 2307 dbSNP
rs1003920872 2315 dbSNP
rs985724788 2316 dbSNP
rs1414368713 2317 dbSNP
rs1171956688 2320 dbSNP
rs886838096 2322 dbSNP
rs932732554 2331 dbSNP
rs1326933471 2333 dbSNP
rs537631450 2334 dbSNP
rs1433429416 2339 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.603 1.2e-3 -0.458 1.4e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.261 6.5e-3 -0.276 4.2e-3 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.533 7.8e-3 0.606 2.3e-3 20 Click to see details
GSE19783 ER- ER- breast cancer -0.249 1.3e-2 -0.324 1.8e-3 79 Click to see details
GSE21687 Ependynoma primary tumors -0.268 1.6e-2 -0.221 4.0e-2 64 Click to see details
GSE19536 Breast cancer -0.177 3.9e-2 -0.238 8.6e-3 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.351 4.3e-2 0.463 9.9e-3 25 Click to see details
GSE21032 Prostate cancer 0.181 5.1e-2 0.164 6.9e-2 83 Click to see details
GSE28260 Renal cortex and medulla -0.471 5.2e-2 -0.615 1.3e-2 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.272 1.2e-1 -0.389 4.5e-2 20 Click to see details
GSE17498 Multiple myeloma -0.169 1.5e-1 -0.302 2.9e-2 40 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.203 1.7e-1 0.309 6.6e-2 25 Click to see details
GSE21849 B cell lymphoma 0.17 1.9e-1 0.510 2.4e-3 29 Click to see details
GSE27834 Pluripotent stem cells -0.233 1.9e-1 -0.300 1.3e-1 16 Click to see details
GSE32688 Pancreatic cancer 0.156 2.0e-1 0.204 1.3e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.173 2.1e-1 -0.064 3.8e-1 24 Click to see details
GSE38226 Liver fibrosis 0.15 2.6e-1 0.171 2.3e-1 21 Click to see details
GSE28544 Breast cancer 0.124 2.8e-1 0.515 5.0e-3 24 Click to see details
GSE17306 Multiple myeloma -0.027 4.3e-1 -0.017 4.5e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.038 4.5e-1 -0.210 2.6e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.038 4.5e-1 -0.210 2.6e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.564 0 0.547 0 32 Click to see details
KIRP -0.513 0 -0.427 0.01 32 Click to see details
BLCA 0.584 0.01 0.579 0.01 18 Click to see details
HNSC 0.355 0.01 0.368 0.01 42 Click to see details
UCEC 0.442 0.03 0.293 0.11 19 Click to see details
LUSC -0.306 0.03 -0.319 0.03 38 Click to see details
PCPG -0.983 0.06 -1.000 0.5 3 Click to see details
LUAD 0.275 0.19 0.301 0.17 12 Click to see details
BRCA -0.092 0.2 -0.103 0.18 84 Click to see details
THCA -0.107 0.21 -0.199 0.07 59 Click to see details
CHOL -0.296 0.22 -0.283 0.23 9 Click to see details
LIHC -0.109 0.23 -0.003 0.49 49 Click to see details
PRAD 0.088 0.27 -0.004 0.49 50 Click to see details
KIRC 0.055 0.33 0.049 0.35 68 Click to see details
PAAD 0.284 0.36 0.800 0.1 4 Click to see details
COAD 0.146 0.37 -0.143 0.37 8 Click to see details
KICH 0.057 0.39 0.208 0.16 25 Click to see details
CESC 0.262 0.42 0.500 0.33 3 Click to see details
ESCA 0.066 0.42 -0.036 0.46 11 Click to see details
ESCA 0.066 0.42 -0.036 0.46 11 Click to see details
ESCA 0.066 0.42 -0.036 0.46 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*