miRTarBase - #MIRT726422 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol STX17   
Synonyms -
Description syntaxin 17
Transcript NM_017919   
Expression
Putative miRNA Targets on STX17
3'UTR of STX17
(miRNA target sites are highlighted)
>STX17|NM_017919|3'UTR
   1 AAACCAAATTTCAGTATTATTGGTGCCAACATGTCTATCCTGAGGACCTTTGCTGCTGTTGGACACTCCGTCACCTTTTG
  81 GAACACAAGTATATCAAGATAGTGGCTACTGATGTTCAAGTGGGATTGAAGTGTGATAAATGGATATATTTTGTTGTTTG
 161 CTGGGGTGTTCATGGAGATGTTAAGAGATTGAGGCCCTGGGCTGAGGGTATATAATGTATGTCAGGTAAAGTTTGAAGAC
 241 TGCCAAGGAGCAGATTTTCTCCCTGGAAATGTGAAAACTGAACCTATAACTCTGATAAGGACTTGAGATGTGTAGAAACG
 321 TTGGGTTATGGAAGACTAGTTTCTTCCATAACCCTGAATTGGAGACCTTAATGCTAAGTGTAGATTATTGAGGTTTGTTA
 401 GTGAGGAAAAGAATAAGAGTTCAGAAGCCTTTGTTATCAGATAGCGAAATCAGGGCCTAGTGAGGAGCACAGGTCGACTA
 481 CATAATGGAGTCCATTGGCGAACCCTATTGCAATTTGGTCCAACTATATCTTCTGGTGAAGGAAATTAATGATGTAAGAA
 561 AATGCAAGAGGCTCAACTTCTCTTCCAAAAATCTTCTGGCTTCTGAACTCTTCCTCTGCCTCTCTTTAAATAAATAACAC
 641 AGAATTTCAAGTGGTAGGAGACTTATTAAGCCAGTCACCAAGCTTGGTCTGTCAGCCTGTCTTCTAACACCTCAAAGATC
 721 TTGTGCCCTGTGCTGTCCCTCCCTTGTAATTATGAAAAGTTCTTTGGTTTCTGGGGTGAATTCTACCCATGTATAATGAG
 801 GAATTCTCTCATAACCTTTTTTGTCTTGTCTGTCATCTCTGTTCATCCCTTCCTATAACCTCTAGGTAAAAAGAAAAGAA
 881 AAAAAGAAATTTCGAGATATTTTCAACATTGTTAGAGTTTGGGCTAAAATGAGCAAGGAGAAAAAAACCACCAAGAACAT
 961 TTCCTGGGGCATGTTCCAGTTTTGAGGGGTGATATATCTGCCAGATAGGGGGTATCTGACCCAGTCTTCTTTTCAGCTGG
1041 TCTCTGGGGGGAGCTGAGAACTCGCTTGCTACCTCACATCCTTTTCCCCAGACTTTTTATCTCCTATGCATCCCTTTGCT
1121 TTCTATAGCTGGTGTTTCTTCCCCAAAATGGCGTTCCCATGCTTACCTTTCTCACATTCTAGACAATGATGGACAAAGAC
1201 GCATGCAAGACTCAGACCCGGGGAATGGTGTGGTGCTAATCTCAACACCTGACATTCACAGCAAGCATGGCCCAGCCCAA
1281 CTGCATGTCTATCTCAAACCGCAGAAAGGCTTTAATACTGGAAAAAAAGAATTCAAGACTACAGGCAGCTCCCCTCTGTA
1361 CCCCAACTCATTTAAAATAGGAGGAATCACTTTTTGCCTTACTTAACGCTTTTTTCTGAGCACAGGGATGGGCACCTGCA
1441 CCCCAGAAGGTGTGAGCTGTCTCTCTGCCAGGAGCTAAGGTTCATTAGGGGATTGGATGGTTTATCACTTCTTTCTTTCT
1521 GAGTTTACTTTTAGTAACTTTTATTGATGGCTACCTTTCATGTCCCTGTCTAAAGAGACTTTCTCTTTCATACGTCTTAA
1601 ATCTCATCAATGAAATCCAGTGAAACAGCACCATTTCTTAGTATCATTAAATAACTAGAAAGTATCAAGTATTGCTCTCT
1681 GCTGCTTTATATCATTAACATATTAATAATACCAAGAAGGAAATACTTTGAATAAGTGTCAGATTCTGATCCAGTATTGG
1761 ACACCTGTGATATTGGACACCTGTGAGGCTGGGATAATTACTTTTGAATTACACCTCTTCTCTAGTTTCTGGACCTTGCT
1841 CTGTCACTTTAACACAGGGTGATCAAACCTGAATGAGGATCAGAACTCACCCAGGCACATACTAAAGCAAGATTCCTAAA
1921 CCTCAGTTCCAGGGGTAATTCTGACATCACCCGTCCAGCATAGTCAGCTGAAATTATAAATCTAAGAAACAGTTACATCA
2001 AGATTCTGCTGTGTCATTTAATTCTGAAACTCCCAGTATTCTACCCTTCTTCATCACTGCATATTACCCCACTCTTCCAT
2081 CCCAAATTGGCTATCCTTTCAGCCCACCAACTTAGCGGCAGCACTAGGGATTCATTATAAGGTAAATCTGGTTTACATAA
2161 AGACCTGAAGGAGGCCTGTATTTGAAGCTCACACTTGGTATTGGTATCTCTCATTTTTACTGAGCCAGTGTGGAATACCA
2241 CTGTATGTACTCATATAAGCCCTTGACTTTTACTGCTCATCAGGATTGGAATATTACTCTAGCAGTCTTCACACATAGGC
2321 AAGTTACAGTCCTTTTAAAAAGTATCTCATTTCCCTATAATGGAACCTAATAGCCAACTTTTTCATAGAAATTGCTAGAA
2401 GAGTTTGATCAACTATAAATGATAAAGTGTTTATAAGCATAGTCAGTGTGACACAGAAACCAATCTTAAAATTGAATTTA
2481 ATGTTTTATCATATCAGATTAAATATTTTCTCCATGTCTTATTTTTACTGCAACAAGTTAGAAAGTGGGAACACTTTGAT
2561 TAATGTCTTAAAATTTGTGGGCCCTCATTTGGATAAAGGCAGCAATCCTAAGGACTTTTTTTTTTTTTTTAACATAATCT
2641 GAGAATTTCTCTGTAGAGCAGAGACTTTCAAACCTTTTGGCTGTAACCCACAGTAAAAAACGCATTTATATCAAACCTTA
2721 GAATATGTTTAATGAACAATACTTACCATTCTGATGCTTTTTATTGTTTCAGTTTTTAAAATATGCCAGTTGCAACCCAC
2801 TAAATTGATATCTACCAATGGGTTGCAACCCTTAGCTTGAAAAAAACACCCTCACAGAGGAACTGGTATTTCTTGAATAC
2881 CTTCTGTTTGCCAGGCACTTCACCAGGCATTTTACAAGTAAGGAAACTGGGCTTCAGAGAAAATAATTTGCAGAGGTTTA
2961 CTCAACTACAAAGGGGTGAAGCCAGGAATGTTAACTAGGTCTGTTGAGCTACAAAAACTTTTATGTCTCTCAGACTATAC
3041 AGCCTCTATACAAAATTGAGATGGGGGTTGGGGGCAGGGGCTCATGCCTGCAATCCCAGCACTTAGGGAGGCAGAGGCCA
3121 GAGGATCACTTGAGCCCAGGAGTTTGAGACCAGCCTGGGCAACATAGTGAGACTCTTGTCTGTATGAAAAAAATTAAGAA
3201 TTAGCTGGGTGTGGCATAGCACACACCTGTGGTCCCAGCTACATGGGAAGCTGAAGTGGGAGGATCACTTGAACTCAGGA
3281 GCAGCCTTGGTGACAGAACAAGACCCTCTCTCAAAAAAATATTTAAAAAAAGGTGGGTCATCCATTCTCCTTTACCAAAC
3361 AGGCTTTGAAATGACACATTCCATTCATTTGCATCTTTTTAAAAAACTTCTGATTCCTTACTGAGTGTCCAGCAGCCTCA
3441 AAGTTTTTAATGGTAGCTGATGCAGACATAAACAGTGCTCAATTTGGCCCTTAAACTATAAAATCAAGAAAGAGTATTTC
3521 AATCCCATCCACCTGCCTGCAAGATTTCTTAATGTTCACTAGTTATAACCATTGTTTAAACAGTGCTTTTTGTGTAATTT
3601 AAAAATAAACTTTAATGCTTTTTAAAACAAATTTATCATAATTCATAGATCAAATGATTATCCTTTAAAATGATACCCTT
3681 GGGAAATCATGTACTTACTGTAGTGATGCTAGTATTAATATTACTTAGACCAATTTTGAAACTGTTCTTTCAGAATTGCC
3761 TCCAAAGACATTTTGCAGATCATCCCAGAAAAGGGGGTATGATGGTGCTGTGTAGAACTGACCAGAGTTCCTGGAGGATT
3841 TTGAGGTTATACTGAAACTGAGTGCTGTACAGGGAGAATTGCATGAGTCCAGAAACTTCCTTCTGTGGGCTGCCTGCCTT
3921 CCTGCCCTCCCTTAAGTGCTCTAAGATTTTTGTACAGGAGTAAGAATCAAATACTGGTAACATCAATCACAAGAAGTTGA
4001 GGAAACCTGTAATATAGCTAGATAATATACAACGTTTGTCTTCCATCAGAGTGCAGAAACCAAACCATGCTTTGTGTTAA
4081 CCTTAAATATGAAAGGTGTTTCTCAGGGTCCCCTTTGTCCTTCGTTGCTGCCATATGAAATCTTACAAGGAAGGATGAGG
4161 AAAAGCCTGGGGGGAGGTTCTCCTCGGAAATGAGGTGGTTTTTTTTGTTATTAAGTAGAACGTGGCTGTGGTTCACAGGT
4241 ACTTAACGAATGTTAGATGATGTTCTTAAGTAATCAGAGGCCTAATAAAAGGCAGGGGAGTTTCTCTTCTAGCCTAAATT
4321 AATATTAAAAGTTCAGGGGTATTTTTTGTTTTTAAATTAATACTTTATTGTTTTTAACAGGTGGTTCTCATAATTTACAT
4401 TCATTAATTTGATGCCCTTTTACAAAGAAACTTCTTAGGTATTATAAACCATCAATGTAAAGGATCCACATGGTATGTAT
4481 CCACATTGCTACTCTCAAATAGAAATGGGAGATAAGAAATATATCTGTGCAATATTAAATTGAAAAAAAAAAACCCATAA
4561 AAAGTGTCAAAGGCAAATAATTTGCTCTAGATCACAAAACTAGTTAGCACAAGGCTAGGATTATAACCAGGGTCTAGGAA
4641 AAAATCCTGAAGGTGATTTAACTGAGTGTTAGGCCCTGTCAAGCCACCTGCTAAGGCTCATGGTCTTTCAGACTAGCTTC
4721 AACATTCCAAATCAGGCAATAGCTACAACGGAAAGATAATTGGACGGGGAATCCTGAGATCAGAGTCCTAGTTTGGCTTT
4801 GTCTCTTGTAGCAGGATTTTTTAAATCAGGGGCAGCTCTCTTCTCCCATCCCAGCCATGAATCTTTCAACCTTAGTGGTC
4881 ACCAACTTGACTCCATTCCTTATATCAAGACTTGTCCTGTCAATTCTCCCTTAAATGTTAGTTGCATCCATTTCTAAATA
4961 TATCCATGGCCATCACCCTAGTAAAAAGACTATTACCTCACACCCCGCACTTGATCTTCCCCCAACTTTAAGTGACTCAG
5041 TTCCTTATATCACTGCCACAAGAATTAACAACCATGTCCATCTTTCATTTTTCTGCTGAAAGATTTTCAGTGGTTCCCAC
5121 TGAATACCAAATAAAGTTCGAATCCCTTAGATTGGCATTCACAGCCTTCTACGTTCTGGCCCCAGCTTTATCTCTTGAAA
5201 CTCACTACTCACCATCTGACAATGCCACTAAAAATCCACAAGAGTGATTTTAAGGTTTTTCTATGGTGAAGGTTCAAACT
5281 GGTAATAAACCATGTTTACATTTTTCTGGTCTAAAATAATTTCTATATTACTTTATAATAGTCAGCTGGGGGTTATTTAA
5361 GCTCTTGGACGAGCCTAAAACTTGTATCCTGAAGAAAATATTTTTTTCCACCAGAAGAAATTGCTTTCAATTTCTTAACC
5441 TTCAAAACAATGTCAGTGTTGTCACCTGTGCATTTGATAGCCACAGCACAAGTATTCTTCAGGAGCATAAATCCTCCAGC
5521 CTTGAATGGACCATTGTCCAGCTCCTGTGAAAAACTTAATATTTGAGAAAGACATTCAATGGTACATGTTTTCTGTACAC
5601 TTCATGAGTAGTTGAGATTTTCTTGTATTAAGGTTAATCACTAAAAAGGTGTTTACTTGGGTTTCGTTAACTAAACCCCC
5681 TAAAGATGTTTTCCATTTTATTGTTAAACACTTGGTGTTAGCAAGGGTCAGCACGAGAAAAGGCCCAATGGCAAGAATTT
5761 CTGCAAACTCTGTAAAGCTTACTGAATTCATTTGTCATTTATTACATTGCTGAGTGGTGCTTGAATAAGGAAACATGCAA
5841 TAAATTTACTTATTTAACCAACAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU---ACACGACGAu 5'
            |||: :|||:   | ||||||| 
Target 5' atCAAG-TATTGCTCTCTGCTGCTt 3'
1664 - 1687 155.00 -10.10
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ::||| ||   ||||||| 
Target 5' tgaGGACC-TT---TGCTGCTg 3'
41 - 58 147.00 -12.50
3
miRNA  3' guGUUUGG------UAAUACACGACGAu 5'
            ||:|||      || :|||| |||| 
Target 5' ctCAGACCCGGGGAATGGTGTGGTGCTa 3'
1211 - 1238 134.00 -16.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31525625 11 COSMIC
COSN30612500 16 COSMIC
COSN30131184 48 COSMIC
COSN30506749 70 COSMIC
COSN30473524 81 COSMIC
COSN30525650 89 COSMIC
COSN31599608 132 COSMIC
COSN23088841 162 COSMIC
COSN6372383 635 COSMIC
COSN2301607 873 COSMIC
COSN31482217 1057 COSMIC
COSN26641446 1104 COSMIC
COSN16540598 1161 COSMIC
COSN31528231 1211 COSMIC
COSN28668422 1283 COSMIC
COSN29570013 1659 COSMIC
rs9556 1283 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1278502536 6 dbSNP
rs768534022 11 dbSNP
rs777848296 14 dbSNP
rs749303630 18 dbSNP
rs771210131 21 dbSNP
rs774422836 23 dbSNP
rs772291814 24 dbSNP
rs368860879 26 dbSNP
rs1187430828 28 dbSNP
rs761286692 30 dbSNP
rs1185962077 31 dbSNP
rs1401395938 32 dbSNP
rs373451406 33 dbSNP
rs764636624 39 dbSNP
rs753399894 48 dbSNP
rs761399692 49 dbSNP
rs1197010935 59 dbSNP
rs968394004 65 dbSNP
rs1011731085 70 dbSNP
rs758122472 71 dbSNP
rs1355354459 82 dbSNP
rs1454091765 83 dbSNP
rs978507832 89 dbSNP
rs1290592035 92 dbSNP
rs1382901447 96 dbSNP
rs148320568 104 dbSNP
rs963838963 108 dbSNP
rs1369804286 110 dbSNP
rs1444164013 119 dbSNP
rs976586057 122 dbSNP
rs1355956765 124 dbSNP
rs1385743885 126 dbSNP
rs1170694083 133 dbSNP
rs141429435 134 dbSNP
rs1035950556 143 dbSNP
rs1166036640 147 dbSNP
rs1346841374 152 dbSNP
rs959991194 155 dbSNP
rs1287302852 161 dbSNP
rs983897941 164 dbSNP
rs1481644216 169 dbSNP
rs1233719513 176 dbSNP
rs1317943050 180 dbSNP
rs533415635 185 dbSNP
rs922488292 189 dbSNP
rs1289252102 190 dbSNP
rs1248107164 195 dbSNP
rs1360015777 204 dbSNP
rs929923996 205 dbSNP
rs1221634637 206 dbSNP
rs942138694 208 dbSNP
rs1298401023 216 dbSNP
rs973245248 217 dbSNP
rs1047451807 226 dbSNP
rs150823710 262 dbSNP
rs774110767 279 dbSNP
rs1157365709 280 dbSNP
rs1051599177 281 dbSNP
rs1408722751 287 dbSNP
rs1271226304 300 dbSNP
rs941399321 302 dbSNP
rs890409096 311 dbSNP
rs1045093211 320 dbSNP
rs1224497598 327 dbSNP
rs905288013 354 dbSNP
rs139658492 355 dbSNP
rs1056645605 357 dbSNP
rs1285304555 359 dbSNP
rs144521155 367 dbSNP
rs1318214485 369 dbSNP
rs554773281 384 dbSNP
rs1011048188 389 dbSNP
rs568232548 403 dbSNP
rs1160946023 411 dbSNP
rs1023011395 415 dbSNP
rs1366646890 428 dbSNP
rs1343302935 434 dbSNP
rs1457401823 434 dbSNP
rs1284785349 445 dbSNP
rs968367773 446 dbSNP
rs999872543 451 dbSNP
rs1405992662 453 dbSNP
rs1360279796 464 dbSNP
rs186439795 474 dbSNP
rs556637006 476 dbSNP
rs576477498 477 dbSNP
rs1345882088 478 dbSNP
rs1408892122 483 dbSNP
rs1407423640 489 dbSNP
rs1001705607 494 dbSNP
rs1431782900 496 dbSNP
rs1200409308 499 dbSNP
rs10988928 500 dbSNP
rs1262133024 505 dbSNP
rs566409546 509 dbSNP
rs963808067 514 dbSNP
rs1035942181 515 dbSNP
rs552685871 524 dbSNP
rs1373553813 525 dbSNP
rs1264687190 527 dbSNP
rs1393518956 527 dbSNP
rs1340310016 528 dbSNP
rs1310945341 532 dbSNP
rs748330511 536 dbSNP
rs922449047 537 dbSNP
rs983458335 541 dbSNP
rs1384450290 550 dbSNP
rs1363317256 564 dbSNP
rs1015363436 575 dbSNP
rs4397463 577 dbSNP
rs963431537 584 dbSNP
rs1408305282 592 dbSNP
rs1247426072 595 dbSNP
rs1465255190 597 dbSNP
rs951313319 609 dbSNP
rs1294561543 613 dbSNP
rs973869541 614 dbSNP
rs1168109782 615 dbSNP
rs982711372 617 dbSNP
rs909810682 627 dbSNP
rs1262418152 635 dbSNP
rs1181200770 637 dbSNP
rs922029302 655 dbSNP
rs941325727 660 dbSNP
rs1045063174 667 dbSNP
rs1203926691 677 dbSNP
rs931779266 693 dbSNP
rs1233680008 695 dbSNP
rs1230137016 698 dbSNP
rs926679898 702 dbSNP
rs1481700118 705 dbSNP
rs1180327441 706 dbSNP
rs1312642679 709 dbSNP
rs987297571 712 dbSNP
rs1385116731 719 dbSNP
rs1337427526 731 dbSNP
rs911794391 736 dbSNP
rs935266085 737 dbSNP
rs1253883999 742 dbSNP
rs939423507 753 dbSNP
rs1052381489 754 dbSNP
rs1463397530 757 dbSNP
rs1056972311 764 dbSNP
rs1373362589 766 dbSNP
rs1443755569 768 dbSNP
rs893433275 777 dbSNP
rs1442645876 784 dbSNP
rs770089186 788 dbSNP
rs573078656 791 dbSNP
rs1456913064 792 dbSNP
rs1043951444 799 dbSNP
rs773453097 811 dbSNP
rs999841322 823 dbSNP
rs1463262891 829 dbSNP
rs1001697328 833 dbSNP
rs1017967885 842 dbSNP
rs1057349054 845 dbSNP
rs542028493 856 dbSNP
rs749345674 858 dbSNP
rs997927773 860 dbSNP
rs12346621 863 dbSNP
rs771612019 865 dbSNP
rs1239593277 869 dbSNP
rs3207956 874 dbSNP
rs1334056916 879 dbSNP
rs1363571413 879 dbSNP
rs1331131728 881 dbSNP
rs1392117785 885 dbSNP
rs1005524753 889 dbSNP
rs539675482 894 dbSNP
rs562321854 895 dbSNP
rs774709967 898 dbSNP
rs1309315558 908 dbSNP
rs1016781914 909 dbSNP
rs1469241281 912 dbSNP
rs1208340104 914 dbSNP
rs1183565003 921 dbSNP
rs1419263737 933 dbSNP
rs962614086 936 dbSNP
rs994853192 941 dbSNP
rs1029023717 942 dbSNP
rs1216446039 944 dbSNP
rs1460732401 949 dbSNP
rs34001267 963 dbSNP
rs953490207 964 dbSNP
rs539818519 965 dbSNP
rs926606114 971 dbSNP
rs1447515798 972 dbSNP
rs939384820 977 dbSNP
rs1240065052 983 dbSNP
rs992644106 989 dbSNP
rs1185856528 990 dbSNP
rs1419684249 991 dbSNP
rs911701069 992 dbSNP
rs1281586983 994 dbSNP
rs992250678 996 dbSNP
rs1367202784 1006 dbSNP
rs1303693179 1008 dbSNP
rs531071365 1010 dbSNP
rs1399992469 1011 dbSNP
rs544889105 1013 dbSNP
rs945527202 1021 dbSNP
rs756299157 1024 dbSNP
rs1043937073 1026 dbSNP
rs1159838718 1028 dbSNP
rs564467485 1037 dbSNP
rs988428010 1041 dbSNP
rs915165191 1046 dbSNP
rs904077438 1047 dbSNP
rs1481628270 1048 dbSNP
rs1044787261 1049 dbSNP
rs926347804 1052 dbSNP
rs1445732796 1060 dbSNP
rs147423974 1064 dbSNP
rs1056244615 1065 dbSNP
rs547097718 1070 dbSNP
rs1271261428 1082 dbSNP
rs1347186676 1098 dbSNP
rs763699013 1107 dbSNP
rs553303658 1126 dbSNP
rs1029373834 1127 dbSNP
rs1382365660 1129 dbSNP
rs886876699 1130 dbSNP
rs1005061053 1149 dbSNP
rs768106846 1153 dbSNP
rs899455962 1154 dbSNP
rs554372425 1157 dbSNP
rs1204068629 1162 dbSNP
rs369437222 1164 dbSNP
rs994781488 1168 dbSNP
rs558227652 1170 dbSNP
rs1028971343 1174 dbSNP
rs962540964 1183 dbSNP
rs1194513959 1185 dbSNP
rs190795894 1187 dbSNP
rs1241291564 1192 dbSNP
rs1380935392 1201 dbSNP
rs765283894 1202 dbSNP
rs960708414 1204 dbSNP
rs1272532840 1207 dbSNP
rs1213833012 1208 dbSNP
rs570122753 1212 dbSNP
rs139682006 1219 dbSNP
rs913966559 1220 dbSNP
rs945467134 1221 dbSNP
rs1188888714 1235 dbSNP
rs1428169886 1236 dbSNP
rs181588166 1240 dbSNP
rs1406428673 1244 dbSNP
rs1178121988 1258 dbSNP
rs925425362 1263 dbSNP
rs1422014263 1271 dbSNP
rs915136179 1273 dbSNP
rs9556 1283 dbSNP
rs1185550707 1284 dbSNP
rs1461815066 1286 dbSNP
rs557264345 1287 dbSNP
rs570099112 1301 dbSNP
rs1039296312 1302 dbSNP
rs980416441 1310 dbSNP
rs72746344 1316 dbSNP
rs1358697337 1317 dbSNP
rs1312807735 1320 dbSNP
rs1434423730 1322 dbSNP
rs34950614 1322 dbSNP
rs1379260397 1324 dbSNP
rs1278596958 1325 dbSNP
rs1439497238 1329 dbSNP
rs541639640 1330 dbSNP
rs1292950892 1332 dbSNP
rs1424398721 1336 dbSNP
rs1364314059 1339 dbSNP
rs1166011215 1341 dbSNP
rs1445317207 1342 dbSNP
rs1213728955 1343 dbSNP
rs939014159 1355 dbSNP
rs933647473 1360 dbSNP
rs543320159 1365 dbSNP
rs1286658414 1375 dbSNP
rs552570759 1384 dbSNP
rs1326866525 1398 dbSNP
rs1490122088 1399 dbSNP
rs886805627 1408 dbSNP
rs749975778 1409 dbSNP
rs1036559158 1431 dbSNP
rs1282882213 1434 dbSNP
rs572568435 1436 dbSNP
rs186440576 1437 dbSNP
rs764499586 1441 dbSNP
rs1404792893 1451 dbSNP
rs898324178 1457 dbSNP
rs368947092 1460 dbSNP
rs377652544 1464 dbSNP
rs1425788080 1481 dbSNP
rs1344713025 1490 dbSNP
rs1267627806 1496 dbSNP
rs1002002673 1500 dbSNP
rs1490363006 1506 dbSNP
rs756442485 1512 dbSNP
rs1198964473 1539 dbSNP
rs1249110331 1546 dbSNP
rs1469969507 1550 dbSNP
rs555631566 1554 dbSNP
rs1270821921 1566 dbSNP
rs1410811113 1580 dbSNP
rs1013560989 1584 dbSNP
rs115678875 1591 dbSNP
rs966759648 1594 dbSNP
rs144962811 1595 dbSNP
rs1268372817 1604 dbSNP
rs925393252 1611 dbSNP
rs964833683 1616 dbSNP
rs1019444004 1623 dbSNP
rs1321879567 1630 dbSNP
rs1285535255 1638 dbSNP
rs1387673065 1639 dbSNP
rs1335335820 1641 dbSNP
rs1441210942 1655 dbSNP
rs1279990696 1657 dbSNP
rs1352556655 1665 dbSNP
rs573342402 1668 dbSNP
rs892584629 1675 dbSNP
rs1468386432 1679 dbSNP
rs1009801984 1692 dbSNP
rs1022152762 1695 dbSNP
rs1261034338 1701 dbSNP
rs1433541397 1701 dbSNP
rs1184638138 1703 dbSNP
rs1486568120 1706 dbSNP
rs974925328 1712 dbSNP
rs564803500 1713 dbSNP
rs1459730283 1720 dbSNP
rs933554041 1724 dbSNP
rs1272062988 1726 dbSNP
rs1047997875 1730 dbSNP
rs1182080775 1755 dbSNP
rs991866647 1773 dbSNP
rs908282861 1778 dbSNP
rs1235024593 1780 dbSNP
rs939808332 1781 dbSNP
rs908199467 1790 dbSNP
rs1183559832 1796 dbSNP
rs1366051544 1812 dbSNP
rs1386362478 1820 dbSNP
rs1450505489 1848 dbSNP
rs1408648254 1851 dbSNP
rs939720927 1853 dbSNP
rs1303640067 1856 dbSNP
rs576508312 1856 dbSNP
rs974245494 1862 dbSNP
rs10988929 1878 dbSNP
rs1372230317 1887 dbSNP
rs1426651706 1888 dbSNP
rs1430193355 1888 dbSNP
rs920743438 1891 dbSNP
rs1182494241 1893 dbSNP
rs578255957 1902 dbSNP
rs1244669075 1904 dbSNP
rs540600453 1905 dbSNP
rs930819912 1908 dbSNP
rs1480519686 1912 dbSNP
rs1166720995 1919 dbSNP
rs1038049639 1922 dbSNP
rs898255592 1926 dbSNP
rs1314949053 1929 dbSNP
rs1001971583 1935 dbSNP
rs1055382793 1936 dbSNP
rs889404945 1947 dbSNP
rs1390987364 1951 dbSNP
rs1450132306 1952 dbSNP
rs944701520 1953 dbSNP
rs553636692 1954 dbSNP
rs1431373927 1961 dbSNP
rs1247542236 1962 dbSNP
rs1162852766 1970 dbSNP
rs896350124 1974 dbSNP
rs892526846 1985 dbSNP
rs1009631692 1991 dbSNP
rs1418111601 1999 dbSNP
rs1338171683 2014 dbSNP
rs1022816426 2016 dbSNP
rs903657163 2020 dbSNP
rs1013903896 2035 dbSNP
rs1020911088 2039 dbSNP
rs1361706844 2044 dbSNP
rs542170013 2047 dbSNP
rs1238378352 2050 dbSNP
rs1033596500 2075 dbSNP
rs1309401553 2082 dbSNP
rs967105589 2092 dbSNP
rs1196066722 2097 dbSNP
rs945884106 2101 dbSNP
rs1274638004 2104 dbSNP
rs778116458 2107 dbSNP
rs992214106 2109 dbSNP
rs529326208 2117 dbSNP
rs1032403674 2118 dbSNP
rs1452404608 2122 dbSNP
rs1203383805 2124 dbSNP
rs190859810 2130 dbSNP
rs1183810410 2133 dbSNP
rs919672157 2138 dbSNP
rs1447046964 2143 dbSNP
rs974852997 2153 dbSNP
rs1268562555 2155 dbSNP
rs1197925186 2158 dbSNP
rs1187211345 2167 dbSNP
rs923413419 2175 dbSNP
rs954938854 2187 dbSNP
rs561724060 2189 dbSNP
rs986295908 2195 dbSNP
rs1348628416 2198 dbSNP
rs1372627237 2207 dbSNP
rs984099028 2209 dbSNP
rs908124739 2217 dbSNP
rs543798982 2220 dbSNP
rs944984548 2221 dbSNP
rs913876180 2229 dbSNP
rs1332810510 2239 dbSNP
rs1400272075 2245 dbSNP
rs1324114504 2247 dbSNP
rs1381165150 2248 dbSNP
rs1468047965 2274 dbSNP
rs1382068313 2279 dbSNP
rs148637846 2302 dbSNP
rs1406541429 2306 dbSNP
rs1457404804 2313 dbSNP
rs1043780350 2317 dbSNP
rs1174783152 2328 dbSNP
rs1055187 2344 dbSNP
rs1325388748 2379 dbSNP
rs1378782520 2380 dbSNP
rs182343688 2385 dbSNP
rs563780382 2386 dbSNP
rs1445369442 2390 dbSNP
rs896308746 2396 dbSNP
rs1249929062 2404 dbSNP
rs1054995653 2413 dbSNP
rs1320904731 2420 dbSNP
rs1221521854 2424 dbSNP
rs1222515815 2426 dbSNP
rs1275381212 2441 dbSNP
rs1013454497 2444 dbSNP
rs1226539317 2446 dbSNP
rs1264203558 2447 dbSNP
rs1322015696 2449 dbSNP
rs1435158562 2466 dbSNP
rs1404970795 2470 dbSNP
rs1042664938 2482 dbSNP
rs896336288 2484 dbSNP
rs1416525703 2487 dbSNP
rs1462914875 2492 dbSNP
rs1426248274 2494 dbSNP
rs1013472578 2495 dbSNP
rs1015933460 2523 dbSNP
rs1392537161 2528 dbSNP
rs72746345 2550 dbSNP
rs995617451 2553 dbSNP
rs1026683289 2555 dbSNP
rs1000839824 2568 dbSNP
rs73503622 2577 dbSNP
rs900527105 2585 dbSNP
rs1279020762 2604 dbSNP
rs1195344264 2615 dbSNP
rs10610607 2616 dbSNP
rs1299711240 2616 dbSNP
rs139884177 2616 dbSNP
rs1449707226 2616 dbSNP
rs560633063 2616 dbSNP
rs5899399 2616 dbSNP
rs754221159 2616 dbSNP
rs765337767 2616 dbSNP
rs777143174 2616 dbSNP
rs869061698 2616 dbSNP
rs1328654935 2631 dbSNP
rs1360145020 2631 dbSNP
rs1408551677 2632 dbSNP
rs1376138283 2633 dbSNP
rs1480272007 2634 dbSNP
rs1424111733 2636 dbSNP
rs1177402598 2638 dbSNP
rs1383406878 2638 dbSNP
rs1183848414 2639 dbSNP
rs1429798831 2640 dbSNP
rs1470818153 2641 dbSNP
rs1287081604 2642 dbSNP
rs1384102740 2644 dbSNP
rs1473271435 2650 dbSNP
rs1232492753 2653 dbSNP
rs996258825 2661 dbSNP
rs368005658 2662 dbSNP
rs966625216 2664 dbSNP
rs976327411 2668 dbSNP
rs955006828 2670 dbSNP
rs1343079059 2672 dbSNP
rs1358139427 2685 dbSNP
rs1287087481 2693 dbSNP
rs1404000932 2694 dbSNP
rs555476942 2702 dbSNP
rs1015569685 2703 dbSNP
rs963613643 2705 dbSNP
rs973655808 2710 dbSNP
rs575731422 2716 dbSNP
rs919577093 2717 dbSNP
rs1260664414 2722 dbSNP
rs1352644947 2723 dbSNP
rs1351941864 2738 dbSNP
rs1424537274 2744 dbSNP
rs538459877 2755 dbSNP
rs558401019 2756 dbSNP
rs1167064570 2758 dbSNP
rs1406010576 2764 dbSNP
rs578240330 2764 dbSNP
rs540934601 2767 dbSNP
rs1471493483 2768 dbSNP
rs1490200907 2770 dbSNP
rs917682794 2773 dbSNP
rs949203471 2790 dbSNP
rs1042236648 2797 dbSNP
rs1490178935 2805 dbSNP
rs902376737 2808 dbSNP
rs1013838625 2815 dbSNP
rs1156601134 2817 dbSNP
rs1283126903 2829 dbSNP
rs1226135808 2832 dbSNP
rs1363163875 2836 dbSNP
rs140207581 2841 dbSNP
rs746378411 2843 dbSNP
rs1363209410 2847 dbSNP
rs897097022 2851 dbSNP
rs1295793941 2872 dbSNP
rs1437285030 2888 dbSNP
rs1053740637 2899 dbSNP
rs1344620159 2901 dbSNP
rs1316529144 2903 dbSNP
rs145905846 2908 dbSNP
rs765744278 2916 dbSNP
rs1159698799 2920 dbSNP
rs146625078 2921 dbSNP
rs563027649 2928 dbSNP
rs750943227 2928 dbSNP
rs1488530316 2938 dbSNP
rs1390033646 2942 dbSNP
rs1306818057 2943 dbSNP
rs1336713744 2954 dbSNP
rs1206247812 2960 dbSNP
rs890564964 2963 dbSNP
rs141366784 2971 dbSNP
rs7039464 2972 dbSNP
rs1223346915 2973 dbSNP
rs563948569 2977 dbSNP
rs1358861287 2984 dbSNP
rs754943895 2988 dbSNP
rs1294239150 2996 dbSNP
rs1361401934 2996 dbSNP
rs1437344792 3002 dbSNP
rs1389740256 3004 dbSNP
rs1336319272 3005 dbSNP
rs976697665 3011 dbSNP
rs1021200640 3014 dbSNP
rs1479743856 3015 dbSNP
rs967396099 3016 dbSNP
rs1176820190 3022 dbSNP
rs1433739404 3023 dbSNP
rs963538625 3032 dbSNP
rs1418676610 3035 dbSNP
rs973624370 3036 dbSNP
rs1034598832 3043 dbSNP
rs1249612912 3046 dbSNP
rs1450785160 3049 dbSNP
rs1419417479 3051 dbSNP
rs1202575564 3062 dbSNP
rs1482492459 3063 dbSNP
rs935648608 3072 dbSNP
rs145096560 3074 dbSNP
rs138853022 3076 dbSNP
rs1211227746 3078 dbSNP
rs1307476936 3085 dbSNP
rs1383249352 3094 dbSNP
rs187502230 3096 dbSNP
rs917628131 3097 dbSNP
rs190976658 3107 dbSNP
rs990861910 3110 dbSNP
rs1163593514 3120 dbSNP
rs1366887728 3121 dbSNP
rs1470584256 3124 dbSNP
rs1466348397 3125 dbSNP
rs1369945781 3127 dbSNP
rs1460205012 3130 dbSNP
rs1431114609 3135 dbSNP
rs1390200609 3136 dbSNP
rs1297231530 3137 dbSNP
rs548866247 3138 dbSNP
rs1421732468 3143 dbSNP
rs1393461209 3152 dbSNP
rs1182868753 3153 dbSNP
rs183197654 3165 dbSNP
rs1207847034 3166 dbSNP
rs1342992528 3173 dbSNP
rs112886344 3174 dbSNP
rs1291083415 3174 dbSNP
rs11336521 3176 dbSNP
rs796348860 3176 dbSNP
rs897052279 3177 dbSNP
rs1246815801 3181 dbSNP
rs548779941 3186 dbSNP
rs568901463 3188 dbSNP
rs923765962 3197 dbSNP
rs936521687 3210 dbSNP
rs1053668119 3233 dbSNP
rs760999036 3242 dbSNP
rs763787050 3243 dbSNP
rs931950538 3247 dbSNP
rs1051787533 3250 dbSNP
rs1162184438 3257 dbSNP
rs1371058323 3257 dbSNP
rs1204135732 3261 dbSNP
rs1252066142 3278 dbSNP
rs1369909167 3287 dbSNP
rs1480846855 3295 dbSNP
rs890483560 3296 dbSNP
rs1200232648 3305 dbSNP
rs1250006891 3313 dbSNP
rs769698539 3313 dbSNP
rs1006516532 3315 dbSNP
rs1444003858 3316 dbSNP
rs1019321088 3320 dbSNP
rs1184114381 3320 dbSNP
rs1415396156 3325 dbSNP
rs900954881 3326 dbSNP
rs1358476787 3330 dbSNP
rs1426189691 3335 dbSNP
rs1238535095 3344 dbSNP
rs1036446511 3350 dbSNP
rs1328254669 3356 dbSNP
rs1403967697 3364 dbSNP
rs1286268564 3371 dbSNP
rs149374482 3374 dbSNP
rs1354707629 3383 dbSNP
rs370341389 3392 dbSNP
rs1392186575 3395 dbSNP
rs1335065794 3396 dbSNP
rs1034525274 3400 dbSNP
rs1161895414 3401 dbSNP
rs1409274869 3401 dbSNP
rs1454026659 3401 dbSNP
rs1339227439 3408 dbSNP
rs1197297337 3411 dbSNP
rs1359988335 3421 dbSNP
rs1453420400 3422 dbSNP
rs1214005318 3432 dbSNP
rs1021567749 3439 dbSNP
rs56245214 3442 dbSNP
rs979643960 3444 dbSNP
rs534486694 3457 dbSNP
rs764667917 3462 dbSNP
rs1014949349 3468 dbSNP
rs1032596483 3469 dbSNP
rs1329523264 3479 dbSNP
rs143687938 3483 dbSNP
rs1221905273 3484 dbSNP
rs970838707 3490 dbSNP
rs1332350729 3506 dbSNP
rs573930197 3508 dbSNP
rs917995522 3509 dbSNP
rs188262363 3519 dbSNP
rs957815581 3523 dbSNP
rs1458107795 3524 dbSNP
rs1239091662 3526 dbSNP
rs989329593 3528 dbSNP
rs921820016 3531 dbSNP
rs1133711 3549 dbSNP
rs1479311734 3552 dbSNP
rs918387391 3553 dbSNP
rs1133713 3559 dbSNP
rs1188074649 3578 dbSNP
rs1447732135 3582 dbSNP
rs556297121 3582 dbSNP
rs931906228 3583 dbSNP
rs1185375951 3584 dbSNP
rs1052141840 3588 dbSNP
rs1277606270 3594 dbSNP
rs1198484831 3607 dbSNP
rs1347102414 3614 dbSNP
rs1419799587 3624 dbSNP
rs1227034124 3627 dbSNP
rs1362322817 3629 dbSNP
rs1478638732 3635 dbSNP
rs549409885 3639 dbSNP
rs749899189 3647 dbSNP
rs940721792 3652 dbSNP
rs1429071626 3654 dbSNP
rs1036371591 3657 dbSNP
rs576440351 3664 dbSNP
rs1416507982 3667 dbSNP
rs192118300 3677 dbSNP
rs1040717023 3691 dbSNP
rs762825699 3695 dbSNP
rs1392052210 3697 dbSNP
rs143800252 3704 dbSNP
rs1189494412 3710 dbSNP
rs548036711 3719 dbSNP
rs1430109353 3722 dbSNP
rs532997976 3733 dbSNP
rs1235925272 3734 dbSNP
rs1020037547 3742 dbSNP
rs1443859107 3744 dbSNP
rs894658040 3748 dbSNP
rs540118003 3752 dbSNP
rs1364154250 3757 dbSNP
rs1204286930 3761 dbSNP
rs1403388369 3763 dbSNP
rs373764698 3771 dbSNP
rs1025011629 3782 dbSNP
rs1001071234 3790 dbSNP
rs1355275076 3794 dbSNP
rs562399242 3795 dbSNP
rs970382569 3798 dbSNP
rs1450641652 3804 dbSNP
rs1341387304 3805 dbSNP
rs1307985251 3820 dbSNP
rs1408501062 3823 dbSNP
rs1372919288 3824 dbSNP
rs999192166 3861 dbSNP
rs1404829669 3862 dbSNP
rs184201751 3863 dbSNP
rs1165156282 3865 dbSNP
rs1012235319 3869 dbSNP
rs1025372441 3873 dbSNP
rs957785838 3875 dbSNP
rs1482060321 3879 dbSNP
rs973194990 3880 dbSNP
rs918683109 3888 dbSNP
rs989259456 3906 dbSNP
rs1314991755 3912 dbSNP
rs983954755 3913 dbSNP
rs1229628470 3918 dbSNP
rs911126209 3919 dbSNP
rs1214981409 3922 dbSNP
rs942646402 3923 dbSNP
rs1226922319 3928 dbSNP
rs1352929906 3932 dbSNP
rs1242257171 3935 dbSNP
rs921769673 3937 dbSNP
rs1040987604 3942 dbSNP
rs1348148109 3945 dbSNP
rs1488965650 3949 dbSNP
rs922224700 3953 dbSNP
rs953375834 3954 dbSNP
rs987400758 3959 dbSNP
rs911806593 3963 dbSNP
rs1158219594 3967 dbSNP
rs1471484367 3969 dbSNP
rs1414101265 3975 dbSNP
rs1041853240 3987 dbSNP
rs940662521 3991 dbSNP
rs1244433914 4002 dbSNP
rs1223093765 4003 dbSNP
rs866769515 4018 dbSNP
rs1480973987 4020 dbSNP
rs1267089666 4026 dbSNP
rs1207303715 4028 dbSNP
rs1331597828 4029 dbSNP
rs904306271 4034 dbSNP
rs529195009 4035 dbSNP
rs1174609161 4050 dbSNP
rs1053980801 4061 dbSNP
rs377169822 4066 dbSNP
rs1012475842 4075 dbSNP
rs1388264137 4081 dbSNP
rs1318711258 4082 dbSNP
rs930710099 4088 dbSNP
rs1025233124 4095 dbSNP
rs1159785529 4097 dbSNP
rs1413883250 4097 dbSNP
rs1422952455 4098 dbSNP
rs1454331090 4099 dbSNP
rs1214602209 4102 dbSNP
rs1246841252 4104 dbSNP
rs1489170831 4105 dbSNP
rs1055844364 4109 dbSNP
rs1362584407 4110 dbSNP
rs1422780634 4115 dbSNP
rs1302802419 4117 dbSNP
rs971097080 4122 dbSNP
rs1346326876 4124 dbSNP
rs894634935 4125 dbSNP
rs1026143311 4135 dbSNP
rs568763594 4152 dbSNP
rs1045941763 4160 dbSNP
rs983902478 4169 dbSNP
rs1370896514 4170 dbSNP
rs1362884157 4171 dbSNP
rs903450303 4182 dbSNP
rs1223200111 4184 dbSNP
rs1284813625 4186 dbSNP
rs999161202 4187 dbSNP
rs571134257 4195 dbSNP
rs1355252638 4196 dbSNP
rs911034688 4198 dbSNP
rs1388967426 4199 dbSNP
rs963862356 4199 dbSNP
rs977032524 4199 dbSNP
rs1030661605 4200 dbSNP
rs945694303 4205 dbSNP
rs1041410548 4207 dbSNP
rs1181709255 4222 dbSNP
rs533706842 4223 dbSNP
rs1239738362 4230 dbSNP
rs575359211 4233 dbSNP
rs1212166539 4240 dbSNP
rs757447971 4242 dbSNP
rs544206407 4245 dbSNP
rs77131177 4246 dbSNP
rs1272625319 4253 dbSNP
rs1230675240 4257 dbSNP
rs1308366847 4258 dbSNP
rs1312277088 4262 dbSNP
rs771180549 4264 dbSNP
rs1055566001 4271 dbSNP
rs147440414 4276 dbSNP
rs1133718 4278 dbSNP
rs1415361538 4291 dbSNP
rs1029196093 4293 dbSNP
rs1369847496 4293 dbSNP
rs1305704983 4298 dbSNP
rs551542460 4305 dbSNP
rs1463065791 4306 dbSNP
rs953206003 4307 dbSNP
rs987713082 4316 dbSNP
rs1018840407 4317 dbSNP
rs1231574892 4320 dbSNP
rs1469917973 4321 dbSNP
rs1416360750 4326 dbSNP
rs1189056227 4332 dbSNP
rs567544185 4342 dbSNP
rs1178317372 4343 dbSNP
rs1250236760 4346 dbSNP
rs759957702 4357 dbSNP
rs1382651893 4366 dbSNP
rs571857328 4367 dbSNP
rs1242826712 4371 dbSNP
rs139744565 4381 dbSNP
rs1294950487 4385 dbSNP
rs920592042 4385 dbSNP
rs1233659426 4390 dbSNP
rs1366274603 4403 dbSNP
rs1349866975 4404 dbSNP
rs906822681 4406 dbSNP
rs554095618 4407 dbSNP
rs369436591 4415 dbSNP
rs1025671402 4423 dbSNP
rs1441145874 4431 dbSNP
rs1396195440 4436 dbSNP
rs1326023670 4452 dbSNP
rs772728493 4454 dbSNP
rs1410411374 4457 dbSNP
rs1184532037 4469 dbSNP
rs1309897116 4471 dbSNP
rs1005566348 4474 dbSNP
rs1208110337 4487 dbSNP
rs1489620490 4488 dbSNP
rs1274036062 4492 dbSNP
rs780589049 4495 dbSNP
rs1328154544 4497 dbSNP
rs776098820 4507 dbSNP
rs1378930372 4514 dbSNP
rs1241049432 4523 dbSNP
rs538760848 4525 dbSNP
rs1336249596 4533 dbSNP
rs1300053446 4542 dbSNP
rs11312818 4543 dbSNP
rs1384555541 4543 dbSNP
rs1457059570 4543 dbSNP
rs398011636 4543 dbSNP
rs747166208 4543 dbSNP
rs763195266 4543 dbSNP
rs1386851766 4546 dbSNP
rs1454806047 4553 dbSNP
rs963841086 4553 dbSNP
rs1196927750 4554 dbSNP
rs976654366 4554 dbSNP
rs536552398 4555 dbSNP
rs1253881368 4560 dbSNP
rs1359507942 4561 dbSNP
rs73656926 4562 dbSNP
rs769010328 4573 dbSNP
rs576402898 4581 dbSNP
rs1270398997 4597 dbSNP
rs1206650978 4603 dbSNP
rs1351384604 4604 dbSNP
rs375835230 4624 dbSNP
rs1437638000 4630 dbSNP
rs1230449373 4633 dbSNP
rs977755516 4639 dbSNP
rs1303725378 4644 dbSNP
rs761389862 4649 dbSNP
rs1433952520 4662 dbSNP
rs1362549155 4668 dbSNP
rs1383119669 4670 dbSNP
rs545088921 4679 dbSNP
rs1171278920 4688 dbSNP
rs1205593755 4689 dbSNP
rs1436681971 4691 dbSNP
rs558659571 4694 dbSNP
rs1240578951 4703 dbSNP
rs1447946983 4714 dbSNP
rs776922828 4718 dbSNP
rs868671737 4723 dbSNP
rs761476244 4736 dbSNP
rs1443402327 4738 dbSNP
rs143678221 4740 dbSNP
rs893471493 4742 dbSNP
rs1010587013 4743 dbSNP
rs1028703259 4746 dbSNP
rs1349465136 4750 dbSNP
rs888881725 4751 dbSNP
rs1008703442 4757 dbSNP
rs540009030 4766 dbSNP
rs1227006048 4775 dbSNP
rs961891770 4775 dbSNP
rs1339713208 4776 dbSNP
rs1271503962 4779 dbSNP
rs560100412 4785 dbSNP
rs1340194189 4805 dbSNP
rs1332805426 4809 dbSNP
rs1417204464 4810 dbSNP
rs187822418 4825 dbSNP
rs1307563200 4826 dbSNP
rs930213549 4827 dbSNP
rs1421925973 4828 dbSNP
rs1168652888 4829 dbSNP
rs1047318851 4832 dbSNP
rs952008057 4834 dbSNP
rs1486642967 4838 dbSNP
rs370231687 4847 dbSNP
rs1331862267 4849 dbSNP
rs1402181346 4855 dbSNP
rs1450421068 4869 dbSNP
rs991915081 4871 dbSNP
rs1435507240 4884 dbSNP
rs192388644 4886 dbSNP
rs1214754483 4889 dbSNP
rs1355170871 4893 dbSNP
rs1005545045 4901 dbSNP
rs1291879022 4909 dbSNP
rs2698999 4911 dbSNP
rs981574771 4912 dbSNP
rs1268061911 4913 dbSNP
rs1338269157 4922 dbSNP
rs762499633 4924 dbSNP
rs1356308454 4925 dbSNP
rs924772661 4927 dbSNP
rs1329834414 4929 dbSNP
rs531372017 4931 dbSNP
rs551481603 4934 dbSNP
rs1460244202 4940 dbSNP
rs1054681385 4944 dbSNP
rs998416021 4945 dbSNP
rs1203635229 4947 dbSNP
rs1476025712 4967 dbSNP
rs1029470206 4976 dbSNP
rs914830626 5004 dbSNP
rs946341792 5007 dbSNP
rs1444209701 5008 dbSNP
rs1204579621 5009 dbSNP
rs1450742174 5018 dbSNP
rs1191025241 5019 dbSNP
rs1270882174 5019 dbSNP
rs571339672 5019 dbSNP
rs1335842142 5024 dbSNP
rs1268080722 5025 dbSNP
rs977327172 5026 dbSNP
rs1222530165 5027 dbSNP
rs1050529072 5033 dbSNP
rs781451173 5037 dbSNP
rs957018377 5037 dbSNP
rs1173066264 5039 dbSNP
rs888817485 5053 dbSNP
rs1328100911 5058 dbSNP
rs1462837965 5062 dbSNP
rs1347391091 5063 dbSNP
rs1394893175 5073 dbSNP
rs1009059198 5074 dbSNP
rs1040157672 5078 dbSNP
rs1398928905 5081 dbSNP
rs1425556207 5086 dbSNP
rs991192207 5088 dbSNP
rs1177348137 5098 dbSNP
rs1477371277 5111 dbSNP
rs1195061990 5114 dbSNP
rs527399179 5117 dbSNP
rs1469217548 5119 dbSNP
rs1224034607 5121 dbSNP
rs1267942744 5126 dbSNP
rs766282246 5136 dbSNP
rs915644087 5140 dbSNP
rs374145345 5141 dbSNP
rs547927577 5147 dbSNP
rs1027502607 5153 dbSNP
rs951975201 5170 dbSNP
rs930136296 5173 dbSNP
rs1047298361 5174 dbSNP
rs1262020772 5180 dbSNP
rs1441965926 5191 dbSNP
rs888740297 5192 dbSNP
rs1288129770 5209 dbSNP
rs185595024 5211 dbSNP
rs1346900410 5212 dbSNP
rs1413436066 5228 dbSNP
rs1392682323 5257 dbSNP
rs1039709936 5264 dbSNP
rs1279670342 5265 dbSNP
rs1247024398 5267 dbSNP
rs1185142600 5273 dbSNP
rs1487019327 5273 dbSNP
rs1243219228 5276 dbSNP
rs1209979773 5278 dbSNP
rs1484958087 5282 dbSNP
rs1235097530 5287 dbSNP
rs899845845 5293 dbSNP
rs1321897397 5295 dbSNP
rs2253297 5307 dbSNP
rs1212603278 5310 dbSNP
rs1363756643 5314 dbSNP
rs1289407327 5323 dbSNP
rs1051618560 5325 dbSNP
rs971464039 5326 dbSNP
rs981926930 5328 dbSNP
rs1347825995 5333 dbSNP
rs1203882267 5335 dbSNP
rs1389179123 5339 dbSNP
rs549841601 5340 dbSNP
rs998721773 5347 dbSNP
rs550245214 5349 dbSNP
rs1181615562 5357 dbSNP
rs28673001 5363 dbSNP
rs990335208 5371 dbSNP
rs1479341806 5372 dbSNP
rs1198337608 5374 dbSNP
rs1249858016 5387 dbSNP
rs1022599459 5389 dbSNP
rs1296093278 5390 dbSNP
rs1377986417 5398 dbSNP
rs1467576026 5401 dbSNP
rs145496332 5403 dbSNP
rs1214100194 5404 dbSNP
rs558548753 5409 dbSNP
rs1295913101 5451 dbSNP
rs1383673484 5455 dbSNP
rs919007181 5455 dbSNP
rs932884876 5457 dbSNP
rs1420670795 5492 dbSNP
rs757453564 5493 dbSNP
rs1472324543 5499 dbSNP
rs910124412 5505 dbSNP
rs572171409 5516 dbSNP
rs941588814 5518 dbSNP
rs910201009 5522 dbSNP
rs536796724 5537 dbSNP
rs1481117485 5541 dbSNP
rs1343177364 5551 dbSNP
rs1039952099 5554 dbSNP
rs1302478697 5560 dbSNP
rs1332341546 5562 dbSNP
rs921236862 5566 dbSNP
rs944394896 5580 dbSNP
rs1335071282 5584 dbSNP
rs1237573057 5591 dbSNP
rs1260607608 5599 dbSNP
rs1304304454 5606 dbSNP
rs779165577 5609 dbSNP
rs1373613606 5614 dbSNP
rs1218810630 5624 dbSNP
rs1289870542 5626 dbSNP
rs933993747 5628 dbSNP
rs1460227266 5634 dbSNP
rs534798061 5639 dbSNP
rs903305377 5642 dbSNP
rs553930496 5648 dbSNP
rs1453740044 5652 dbSNP
rs1362557241 5666 dbSNP
rs553597631 5667 dbSNP
rs993260891 5668 dbSNP
rs1048866123 5676 dbSNP
rs573795199 5677 dbSNP
rs1252631708 5678 dbSNP
rs542891686 5683 dbSNP
rs1191937011 5695 dbSNP
rs1179619673 5698 dbSNP
rs1254710544 5701 dbSNP
rs1363114169 5704 dbSNP
rs139108922 5705 dbSNP
rs1349951676 5709 dbSNP
rs143979685 5718 dbSNP
rs368401380 5727 dbSNP
rs544988548 5735 dbSNP
rs564881386 5736 dbSNP
rs1159999054 5744 dbSNP
rs1013248518 5748 dbSNP
rs1022917005 5760 dbSNP
rs971772176 5765 dbSNP
rs1327066608 5777 dbSNP
rs1382010560 5792 dbSNP
rs1002881159 5798 dbSNP
rs1031738009 5804 dbSNP
rs1160743623 5820 dbSNP
rs750520391 5825 dbSNP
rs971050792 5826 dbSNP
rs1171819164 5835 dbSNP
rs1393365566 5837 dbSNP
rs1389980323 5849 dbSNP
rs146643439 5850 dbSNP
rs1395914147 5854 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.374 2.5e-4 0.288 4.1e-3 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.446 1.3e-2 0.533 3.0e-3 25 Click to see details
GSE27834 Pluripotent stem cells 0.368 8.0e-2 0.385 7.0e-2 16 Click to see details
GSE19350 CNS germ cell tumors 0.427 8.3e-2 0.538 3.6e-2 12 Click to see details
GSE14794 Lymphoblastoid cells 0.134 1.0e-1 0.150 7.9e-2 90 Click to see details
GSE17498 Multiple myeloma 0.202 1.1e-1 0.155 1.7e-1 40 Click to see details
GSE28544 Breast cancer -0.252 1.2e-1 -0.608 8.1e-4 24 Click to see details
GSE21687 Ependynoma primary tumors 0.142 1.3e-1 0.124 1.6e-1 64 Click to see details
GSE19536 Breast cancer 0.099 1.6e-1 0.050 3.1e-1 100 Click to see details
GSE28260 Renal cortex and medulla -0.274 1.8e-1 -0.159 3.0e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.182 2.0e-1 0.183 2.0e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.148 2.4e-1 -0.218 1.5e-1 25 Click to see details
GSE38226 Liver fibrosis -0.155 2.5e-1 -0.127 2.9e-1 21 Click to see details
GSE17306 Multiple myeloma -0.09 2.7e-1 -0.173 1.2e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.092 3.3e-1 0.039 4.3e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.092 3.5e-1 -0.063 4.0e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.065 3.6e-1 -0.356 2.3e-2 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.036 4.4e-1 0.177 2.3e-1 20 Click to see details
GSE21849 B cell lymphoma 0.026 4.5e-1 -0.026 4.5e-1 29 Click to see details
GSE19783 ER- ER- breast cancer 0.01 4.7e-1 -0.038 3.7e-1 79 Click to see details
GSE19783 ER- ER- breast cancer 0.01 4.7e-1 -0.038 3.7e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.511 0 -0.511 0 32 Click to see details
BLCA -0.634 0 -0.610 0 18 Click to see details
PRAD 0.282 0.02 0.259 0.03 50 Click to see details
KIRP -0.336 0.03 -0.306 0.04 32 Click to see details
CHOL -0.562 0.06 -0.467 0.1 9 Click to see details
HNSC 0.241 0.06 0.241 0.06 42 Click to see details
THCA -0.192 0.07 -0.248 0.03 59 Click to see details
BRCA -0.16 0.07 -0.185 0.05 84 Click to see details
UCEC 0.309 0.1 0.344 0.07 19 Click to see details
ESCA 0.379 0.13 0.336 0.16 11 Click to see details
KIRC 0.138 0.13 0.139 0.13 68 Click to see details
COAD -0.274 0.26 -0.619 0.05 8 Click to see details
LUSC 0.088 0.3 0.152 0.18 38 Click to see details
PCPG -0.584 0.3 -0.500 0.33 3 Click to see details
PAAD 0.384 0.31 0.600 0.2 4 Click to see details
CESC 0.424 0.36 0.500 0.33 3 Click to see details
LIHC 0.024 0.43 -0.051 0.36 49 Click to see details
KICH 0.015 0.47 0.118 0.29 25 Click to see details
LUAD -0.022 0.47 -0.035 0.46 12 Click to see details
LUAD -0.022 0.47 -0.035 0.46 12 Click to see details
LUAD -0.022 0.47 -0.035 0.46 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1