miRTarBase - #MIRT726372 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TBC1D14   
Synonyms -
Description TBC1 domain family member 14
Transcript NM_001113361   
Other Transcripts NM_001113363 , NM_020773   
Expression
Putative miRNA Targets on TBC1D14
3'UTR of TBC1D14
(miRNA target sites are highlighted)
>TBC1D14|NM_001113361|3'UTR
   1 GGCTGCAGCGGGAATTCGCACTCGGCACCAATCAGAGCCCCATGCCGCGGCCCCTCTGTTGTTTCAGACTGACACCCGGG
  81 CAGCCGAGAAGAACAGACGCTCTTTAAGTTTGATTCCTAACACTGGAGTTGGCCTTAAACAAAACAAACACAAAAACTTT
 161 TAAAGAATTAAACCAAGGCTTAGCCTTAAGCAGCTCAGTGGAAGGATGAGCTGCTGCGGACCACAGCCAGCCACTGCATC
 241 TGCTGCACAGTTGAACGATGGGCAGTGGCTCACCCCCACTCCTTTATTTCAGCAAAAGCTAATTAAATTGTAATGTTTCT
 321 ATGTCAACTACTGGGAAGTATGTTACAGTCTTAGCCAGGATGCATGAGAGATGTTATTTGGGAGACTTGAGATGCTTTGG
 401 CTGATATTTACATGTTTTCGATAAGAAAGGGATCGCTGATTGAGTTATTGAGATAGTTTTTCCAGAGCTGGAGGTCACGT
 481 TTCTAAAACTCACCTACGAAAGATAGCATTAAAGGAACAGGGGCTCTCTGAGGATGGCCACTGATGTGTGTTTGTGGATA
 561 CCTGGGCATCGACCCAGCCTGCAGGTGAGCTCTGGGCCATGTTGCCTTGACACAGTCACAGTGTAGAGGCTGCAGGTGCA
 641 CACGTGGGCTCCAGTGGGACTGCGCTCTGGGAGACTGCTCCCTGGCATCGGTCCTGCGGAGGTGGAAAGTTCGAGAGGAG
 721 GAGCTATTTGCGAGGAAGCCCTGTGGCAATAGAGATAGGCTTAAAAGCGGAGAGAACACAGAGTGGAATCAGCCCCCTGT
 801 AAGTAAAAGGGTAGAGAAAGAGATGTGTGGCTGGGCCCTCTCCCACCTGCCTGTTCAGTGGAGGCCAGGGCAGCAGCCCA
 881 GAACAGCACATGTGGGGGAGGTGGCCCCTTGTGCCAGCAGTGGCTCCTCTCTGCCTTTGAGCCCTGCACAGCTGGACCCA
 961 TCCTAAGTGCCAGTGAGTCCCTCACACATTTGACTTTAGAACGTGTGCTTCATGACCCGTTGTACAGACGGAGGAGCGAG
1041 CAACACACGTCTAACAGCCTAGACAATCTCGTCAGATGCTCATACTGGACCATCAGCCTCCCCATTTTAGCTGACTTTCC
1121 CAGGGTCGTTGGCAAATTTTTTGTTCTGTCTTTTCCTTGACTAATTGTAGAACTTTGTGTGAGGACTTTGGTTATCCAAA
1201 ATCACAGAAATGAACCGTTTTGCAGCTGCGCAGTCTAAAGGGCAGGCCAGTGTCTGGAAGCAGGGCCCACGTGGCGGTCC
1281 GCTGGCAGGCTGGTCCTGGGGAGCATTCTGCGGACCCGGTCACGGGCTTGGTTAGTCATGCGTACATGTGTGCCTTGGGG
1361 TGCTCTGCACTCCACGGCCCTTCTCAGCCACACTTCCCACCCCAGGGGGTGCCCCCAGGCTGATCTCATTTCTGATGTTG
1441 AGGGCTGTTTGGCTCTGTCTGTATAGCTTGTAACAGGAGCCTTGGGCTAGGGGCTGGGGAAGGAAAGCCGAGCTGGCATT
1521 CGTTCTCTGGACTTTTTATGCCTGCCATACCCGCTAATGCTCCTCGAGGTGCAGGAGCAGGTTGCTGAGCCAGTGGCTGC
1601 CCCGTGCCCTCCTTCCCAGCACTATCATGTGTCACGTTTCCCGGACTCTGCCCCTACATCTCAGCTGAATCTCCAGGGAG
1681 GCTGCAGAGCATCGTGGAGACCACTTTCTGCCTCGGCCTTTAAATGCTGACTCACCTCCTCTCGGAGGAGGCGTCCTGTC
1761 TTCACGGGGGGGTCCCGGTGGCCTCCAGACGTAGCCATTTCCTGACATCAAGATGTTGAATGTAATCTGGTCTGAGCTGG
1841 GCCTGTGGGAGGGGCCGCCTGAGGCCTGTGCGCTGTTGTCCTCGCAGATGTACTTATTTTTGTTCATGTTACGGGCGTTC
1921 CGTTCCTTAAAGATGTATATATTTTCTTACTGTACATAAAGATGTTCCTTAAGTCGTACAGAAGGTGGCGCGGCAAAGGG
2001 CCTCGTGCAGTGTGTTCAGATTGCCCCTGGGGATCTTCTGTGTCTTCAGCGCCCAGCCCTGCGTGTTCCTGGTGAAGCAG
2081 TTTCACATCAGTCTCTCCAGATAGCACTACGATGTATTCCGCTTCTGAACAGGATCCCATGCCAGTGTGGAACACCTTCC
2161 CAATCTTAGTTCAGAAGTGGCTTGTATGACCTGTTCAGGGGTCACATGAGGTCTCGCCAGTTTCCTGGGTCCTCTTCAGA
2241 GGCCAGAAAGTTCTAAGTTCTGAGTCCCCGGCCAGGGTCCCTTAACACCTCGGCACAGAGGCTGTTGGCAAGTGTAGAGG
2321 CTGCCTCTGTGTGTGGTTTAAGTAAACTGGAAATGAGACATTGACGTGCTGCTCCTCCAGAGGTCTGCACACTCCACTTC
2401 ACATGCCGTTGACTCTCACAGTCTAAGACTTCAGGGCCGGGACCTTTGTCCAGCCTGCACAGTAGAGTGAGGCTGCCTCT
2481 CCCGCCAGGCATTGGGATCCCATTTAGAAACGGCATTCACTTCAGAAGGTACTTTTTAACTGCTCAGTTTTTGACTATTT
2561 TAAATAGTTTGCTGAAAACTCCTGATAACACTTGCTACATATCATGTTTTAATTGCTTGTACAGTTAACCTTTAATTTTA
2641 TTTAGTAAAGTGTATCAAAGTAGGACTTTTTTGAATTGTAAATAGGTGGTTTTATTAAATAAAAGTCAATGTAAAATTGT
2721 TACTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAA-UACACGACGAu 5'
            ::|: |||| | |||||||| 
Target 5' aaTGAGACATTGACGTGCTGCTc 3'
2352 - 2374 164.00 -14.60
2
miRNA  3' guGUUUGGUAA--UACACGACGau 5'
            | |:||| |  || ||||||  
Target 5' agCCAGCCACTGCATCTGCTGCac 3'
225 - 248 142.00 -10.80
3
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             :||  || |  ||||||  
Target 5' gtgGAAGGATGAGCTGCTGCgg 3'
198 - 219 131.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM353292 1 COSMIC
COSN26997920 10 COSMIC
COSN30682572 19 COSMIC
COSN30131027 24 COSMIC
COSN26563880 25 COSMIC
COSN30185264 39 COSMIC
COSN30459218 47 COSMIC
COSN30601227 99 COSMIC
COSN30500019 100 COSMIC
COSN20074974 101 COSMIC
COSN31560198 158 COSMIC
COSN30176838 258 COSMIC
COSN27688640 627 COSMIC
COSN29095149 765 COSMIC
COSN24643245 1031 COSMIC
COSN20091015 1064 COSMIC
COSN31555990 1676 COSMIC
COSN16131283 1709 COSMIC
COSN31536901 1733 COSMIC
COSN31563234 1773 COSMIC
COSN8491292 1773 COSMIC
COSN22575137 1777 COSMIC
COSN9051453 1792 COSMIC
COSN7503643 1990 COSMIC
COSN21541679 2005 COSMIC
COSN31778353 2064 COSMIC
COSN29301785 2271 COSMIC
COSN18723745 2366 COSMIC
COSN26553109 2620 COSMIC
rs12119 1553 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs891331370 1 dbSNP
rs1462108457 7 dbSNP
rs1470209409 8 dbSNP
rs200523908 10 dbSNP
rs767446186 11 dbSNP
rs773183464 17 dbSNP
rs200166472 18 dbSNP
rs372743499 19 dbSNP
rs375508435 20 dbSNP
rs1156310554 21 dbSNP
rs765531947 22 dbSNP
rs753039766 24 dbSNP
rs371452023 25 dbSNP
rs781313129 25 dbSNP
rs376126969 27 dbSNP
rs758860538 29 dbSNP
rs202139939 30 dbSNP
rs1435143231 32 dbSNP
rs1392899971 46 dbSNP
rs374769038 47 dbSNP
rs755727782 48 dbSNP
rs779708480 49 dbSNP
rs745938969 50 dbSNP
rs747973914 51 dbSNP
rs903985454 55 dbSNP
rs1388812512 57 dbSNP
rs1188029116 59 dbSNP
rs11546450 62 dbSNP
rs1015168848 65 dbSNP
rs1167993295 75 dbSNP
rs1371578122 76 dbSNP
rs1256423647 77 dbSNP
rs773299834 78 dbSNP
rs1031255435 79 dbSNP
rs960607115 86 dbSNP
rs531579392 87 dbSNP
rs1228498854 90 dbSNP
rs759423045 92 dbSNP
rs1327748269 97 dbSNP
rs550125715 99 dbSNP
rs1023610871 100 dbSNP
rs1379403898 102 dbSNP
rs1303822909 103 dbSNP
rs1303083188 111 dbSNP
rs1436916912 115 dbSNP
rs1353132842 117 dbSNP
rs1239313140 121 dbSNP
rs969810962 123 dbSNP
rs1384297597 127 dbSNP
rs1430950295 133 dbSNP
rs1293826413 146 dbSNP
rs1374920345 148 dbSNP
rs1306598124 152 dbSNP
rs984860658 153 dbSNP
rs1257080835 166 dbSNP
rs916515777 176 dbSNP
rs1189829467 178 dbSNP
rs947694488 184 dbSNP
rs909324319 194 dbSNP
rs1250791429 195 dbSNP
rs1205851953 208 dbSNP
rs979073967 209 dbSNP
rs925015703 213 dbSNP
rs192326868 214 dbSNP
rs935071668 218 dbSNP
rs1052223062 219 dbSNP
rs538735567 220 dbSNP
rs1349091646 221 dbSNP
rs1411028042 232 dbSNP
rs944245410 234 dbSNP
rs1039957402 238 dbSNP
rs34039051 254 dbSNP
rs900100281 257 dbSNP
rs547531116 258 dbSNP
rs888748962 262 dbSNP
rs995473854 264 dbSNP
rs1026991208 266 dbSNP
rs565886760 278 dbSNP
rs1439523863 280 dbSNP
rs1265119110 283 dbSNP
rs1208738244 308 dbSNP
rs201189255 311 dbSNP
rs184287284 313 dbSNP
rs1274504702 315 dbSNP
rs1004697772 320 dbSNP
rs902971347 322 dbSNP
rs1288164830 323 dbSNP
rs1240163586 325 dbSNP
rs752139072 328 dbSNP
rs1031201857 329 dbSNP
rs1361765033 331 dbSNP
rs896666744 349 dbSNP
rs1327978177 354 dbSNP
rs1013820912 359 dbSNP
rs1411454172 362 dbSNP
rs1159660270 374 dbSNP
rs1455775077 378 dbSNP
rs1375863630 390 dbSNP
rs1024308232 392 dbSNP
rs1287534815 405 dbSNP
rs1361679798 408 dbSNP
rs1396320905 411 dbSNP
rs755739445 415 dbSNP
rs370999578 420 dbSNP
rs777540508 421 dbSNP
rs1013385119 422 dbSNP
rs1206108060 428 dbSNP
rs1353208147 431 dbSNP
rs1023472409 435 dbSNP
rs969278408 436 dbSNP
rs145053214 439 dbSNP
rs979355350 443 dbSNP
rs1388195461 449 dbSNP
rs923085467 455 dbSNP
rs924931017 457 dbSNP
rs1399874965 459 dbSNP
rs1171757633 465 dbSNP
rs956424981 465 dbSNP
rs775540382 467 dbSNP
rs1396768446 469 dbSNP
rs1186153838 473 dbSNP
rs985978277 480 dbSNP
rs1248267569 484 dbSNP
rs563617426 491 dbSNP
rs755897328 491 dbSNP
rs1440313101 492 dbSNP
rs947069938 494 dbSNP
rs1205267063 498 dbSNP
rs1043138962 499 dbSNP
rs1226279994 500 dbSNP
rs988280587 503 dbSNP
rs1433216769 504 dbSNP
rs1245222544 505 dbSNP
rs1333298592 519 dbSNP
rs1435054494 519 dbSNP
rs1442964283 520 dbSNP
rs576654313 526 dbSNP
rs753429565 527 dbSNP
rs149116991 530 dbSNP
rs556116123 545 dbSNP
rs577761001 553 dbSNP
rs1419668516 555 dbSNP
rs768923140 571 dbSNP
rs921477893 572 dbSNP
rs896614497 586 dbSNP
rs780545110 588 dbSNP
rs1486165004 602 dbSNP
rs545077763 614 dbSNP
rs1260042775 619 dbSNP
rs747539723 623 dbSNP
rs1339055089 628 dbSNP
rs61746321 631 dbSNP
rs1273855358 632 dbSNP
rs1004236026 637 dbSNP
rs1057455430 641 dbSNP
rs895908641 643 dbSNP
rs781425744 644 dbSNP
rs1023421371 645 dbSNP
rs1006211458 655 dbSNP
rs1415178797 660 dbSNP
rs748200758 661 dbSNP
rs1000722168 662 dbSNP
rs1032281435 664 dbSNP
rs572236922 665 dbSNP
rs1354995899 675 dbSNP
rs769745698 679 dbSNP
rs962037628 682 dbSNP
rs867146165 683 dbSNP
rs1403035623 687 dbSNP
rs1165280280 689 dbSNP
rs993504779 690 dbSNP
rs1420536035 697 dbSNP
rs143105662 698 dbSNP
rs986406767 699 dbSNP
rs912267425 701 dbSNP
rs1312651980 703 dbSNP
rs1449874550 707 dbSNP
rs910451923 712 dbSNP
rs749437163 713 dbSNP
rs560952263 714 dbSNP
rs1460186478 720 dbSNP
rs1373979893 721 dbSNP
rs867916940 731 dbSNP
rs975200497 732 dbSNP
rs770760120 733 dbSNP
rs774095920 736 dbSNP
rs1481662508 738 dbSNP
rs1325967983 740 dbSNP
rs531617201 756 dbSNP
rs921425338 757 dbSNP
rs934315517 759 dbSNP
rs931498469 763 dbSNP
rs1056867409 769 dbSNP
rs1049098500 770 dbSNP
rs1409364530 771 dbSNP
rs917043605 773 dbSNP
rs908806736 775 dbSNP
rs1477320263 776 dbSNP
rs1252508369 781 dbSNP
rs549846045 796 dbSNP
rs1214354002 797 dbSNP
rs1470009363 805 dbSNP
rs3756255 806 dbSNP
rs1481029553 809 dbSNP
rs1317366625 811 dbSNP
rs1308863218 812 dbSNP
rs1179085341 813 dbSNP
rs151198055 814 dbSNP
rs768133370 817 dbSNP
rs1469022733 823 dbSNP
rs1329118557 825 dbSNP
rs1386013967 831 dbSNP
rs895858552 832 dbSNP
rs1006860791 839 dbSNP
rs948797052 843 dbSNP
rs993494832 845 dbSNP
rs547443755 847 dbSNP
rs1044486231 850 dbSNP
rs140363072 855 dbSNP
rs1194351003 857 dbSNP
rs954815779 859 dbSNP
rs1246259453 862 dbSNP
rs1186206837 868 dbSNP
rs1000675050 869 dbSNP
rs1486302934 877 dbSNP
rs1032647063 885 dbSNP
rs775393905 886 dbSNP
rs1017824443 888 dbSNP
rs1347091440 892 dbSNP
rs1280886524 894 dbSNP
rs536377887 895 dbSNP
rs760300548 897 dbSNP
rs548749972 898 dbSNP
rs965076507 901 dbSNP
rs975146205 919 dbSNP
rs1273993147 923 dbSNP
rs1446194268 924 dbSNP
rs1028100497 930 dbSNP
rs1157365501 934 dbSNP
rs952827036 936 dbSNP
rs189647525 943 dbSNP
rs1232347043 954 dbSNP
rs145052431 964 dbSNP
rs1202210974 965 dbSNP
rs1179914882 970 dbSNP
rs940282379 973 dbSNP
rs368402900 979 dbSNP
rs561406206 979 dbSNP
rs543432555 988 dbSNP
rs1168803093 1006 dbSNP
rs1421242237 1019 dbSNP
rs1339952614 1020 dbSNP
rs1250312857 1027 dbSNP
rs917232636 1030 dbSNP
rs1308904010 1031 dbSNP
rs1310049999 1035 dbSNP
rs979894884 1038 dbSNP
rs192858604 1039 dbSNP
rs577672449 1048 dbSNP
rs926746400 1049 dbSNP
rs753578238 1050 dbSNP
rs756808966 1052 dbSNP
rs377079761 1054 dbSNP
rs1369204648 1056 dbSNP
rs948743583 1060 dbSNP
rs1044433474 1062 dbSNP
rs538655133 1067 dbSNP
rs1375009124 1068 dbSNP
rs936470531 1072 dbSNP
rs1431234320 1080 dbSNP
rs898121366 1083 dbSNP
rs57033890 1085 dbSNP
rs1418372305 1097 dbSNP
rs1189767476 1098 dbSNP
rs1249656066 1100 dbSNP
rs892334945 1100 dbSNP
rs1195874083 1102 dbSNP
rs1481365618 1103 dbSNP
rs1272457800 1111 dbSNP
rs1360255897 1116 dbSNP
rs1009479617 1126 dbSNP
rs766879773 1128 dbSNP
rs890468853 1129 dbSNP
rs1334525066 1131 dbSNP
rs1290244300 1132 dbSNP
rs900821557 1140 dbSNP
rs1398802801 1143 dbSNP
rs1490317352 1144 dbSNP
rs1194389954 1150 dbSNP
rs1244168181 1151 dbSNP
rs1461162194 1155 dbSNP
rs1395447809 1170 dbSNP
rs996527249 1171 dbSNP
rs138890333 1177 dbSNP
rs1185567702 1190 dbSNP
rs1385397909 1191 dbSNP
rs1420781820 1192 dbSNP
rs1426015952 1194 dbSNP
rs1161079209 1195 dbSNP
rs1364919418 1197 dbSNP
rs1401188005 1198 dbSNP
rs1215946419 1212 dbSNP
rs1320101821 1216 dbSNP
rs952442433 1217 dbSNP
rs542390771 1218 dbSNP
rs1015753855 1220 dbSNP
rs961871228 1221 dbSNP
rs1301386861 1224 dbSNP
rs1031576031 1230 dbSNP
rs993074190 1231 dbSNP
rs1372003085 1238 dbSNP
rs955971277 1243 dbSNP
rs992758505 1248 dbSNP
rs1384033234 1249 dbSNP
rs1383731522 1251 dbSNP
rs1455309482 1266 dbSNP
rs1375812780 1270 dbSNP
rs1192481339 1271 dbSNP
rs917515485 1272 dbSNP
rs948696069 1276 dbSNP
rs183901255 1277 dbSNP
rs942192318 1280 dbSNP
rs1206226166 1281 dbSNP
rs926002121 1283 dbSNP
rs1278726953 1287 dbSNP
rs936098935 1288 dbSNP
rs1445639883 1291 dbSNP
rs1348760454 1301 dbSNP
rs1053647515 1303 dbSNP
rs929530702 1312 dbSNP
rs755554985 1313 dbSNP
rs945226815 1314 dbSNP
rs1318751704 1316 dbSNP
rs1051982900 1317 dbSNP
rs76249423 1318 dbSNP
rs1446041649 1319 dbSNP
rs1435249055 1323 dbSNP
rs1396412770 1324 dbSNP
rs1166141789 1325 dbSNP
rs1474897719 1336 dbSNP
rs1181262135 1340 dbSNP
rs1194368150 1341 dbSNP
rs901097761 1342 dbSNP
rs1210854083 1343 dbSNP
rs996475085 1346 dbSNP
rs1282600864 1347 dbSNP
rs781778027 1353 dbSNP
rs1338995170 1354 dbSNP
rs753458083 1356 dbSNP
rs1049420651 1362 dbSNP
rs904631823 1363 dbSNP
rs1000425248 1364 dbSNP
rs888142832 1369 dbSNP
rs1312025169 1373 dbSNP
rs141940298 1375 dbSNP
rs1377156503 1376 dbSNP
rs1405619956 1376 dbSNP
rs1015782205 1384 dbSNP
rs1337101286 1390 dbSNP
rs1014141276 1397 dbSNP
rs961541436 1399 dbSNP
rs1169342413 1400 dbSNP
rs181538600 1400 dbSNP
rs1474007358 1403 dbSNP
rs1408765726 1408 dbSNP
rs1024236921 1409 dbSNP
rs1187628970 1410 dbSNP
rs970121407 1418 dbSNP
rs532345666 1421 dbSNP
rs541007973 1426 dbSNP
rs1014387057 1428 dbSNP
rs573837909 1434 dbSNP
rs1334858546 1437 dbSNP
rs1437384626 1440 dbSNP
rs979832811 1441 dbSNP
rs1339941759 1445 dbSNP
rs1024480371 1448 dbSNP
rs1332918905 1449 dbSNP
rs1281793147 1454 dbSNP
rs559357770 1458 dbSNP
rs1349101092 1466 dbSNP
rs970288870 1470 dbSNP
rs1357307567 1471 dbSNP
rs1277636072 1481 dbSNP
rs1228199958 1489 dbSNP
rs980361364 1490 dbSNP
rs925949873 1492 dbSNP
rs879182279 1493 dbSNP
rs1462415992 1496 dbSNP
rs1201370733 1500 dbSNP
rs957630567 1510 dbSNP
rs186450885 1511 dbSNP
rs1475700852 1514 dbSNP
rs972468825 1522 dbSNP
rs1176045270 1523 dbSNP
rs1470055249 1524 dbSNP
rs1233566022 1531 dbSNP
rs548441399 1536 dbSNP
rs1180547127 1542 dbSNP
rs919402585 1543 dbSNP
rs150407165 1545 dbSNP
rs987647785 1546 dbSNP
rs1336741260 1547 dbSNP
rs1176946935 1551 dbSNP
rs1373914525 1552 dbSNP
rs912179191 1552 dbSNP
rs12119 1553 dbSNP
rs1040902132 1554 dbSNP
rs752536811 1555 dbSNP
rs1444740357 1566 dbSNP
rs552870758 1567 dbSNP
rs571182357 1586 dbSNP
rs932547084 1588 dbSNP
rs749557543 1590 dbSNP
rs1014131481 1600 dbSNP
rs888099857 1604 dbSNP
rs1005645964 1605 dbSNP
rs1036751749 1616 dbSNP
rs1409728542 1619 dbSNP
rs535366140 1621 dbSNP
rs372376317 1623 dbSNP
rs3839182 1623 dbSNP
rs565131268 1623 dbSNP
rs1001594004 1625 dbSNP
rs1016570096 1627 dbSNP
rs747644864 1627 dbSNP
rs879667714 1636 dbSNP
rs771077301 1637 dbSNP
rs993838606 1640 dbSNP
rs553787029 1643 dbSNP
rs970236346 1644 dbSNP
rs1287511845 1645 dbSNP
rs774149218 1646 dbSNP
rs1001729388 1654 dbSNP
rs1247775565 1655 dbSNP
rs987636252 1657 dbSNP
rs1174293430 1658 dbSNP
rs1200050330 1663 dbSNP
rs1417561628 1666 dbSNP
rs1185717140 1668 dbSNP
rs1033703978 1672 dbSNP
rs957371123 1681 dbSNP
rs565579445 1694 dbSNP
rs138312525 1695 dbSNP
rs1234729174 1697 dbSNP
rs1305405253 1701 dbSNP
rs966523210 1702 dbSNP
rs976197318 1705 dbSNP
rs922415437 1709 dbSNP
rs1214778654 1712 dbSNP
rs1462662436 1713 dbSNP
rs745724503 1716 dbSNP
rs1413500863 1729 dbSNP
rs1375335405 1731 dbSNP
rs1313567823 1735 dbSNP
rs932494734 1736 dbSNP
rs985349436 1738 dbSNP
rs1170095241 1739 dbSNP
rs1352825998 1739 dbSNP
rs909800693 1744 dbSNP
rs1425569404 1745 dbSNP
rs554367634 1753 dbSNP
rs913359887 1754 dbSNP
rs941000898 1757 dbSNP
rs1258055771 1761 dbSNP
rs1201686354 1765 dbSNP
rs1037109302 1766 dbSNP
rs1045597020 1766 dbSNP
rs879862958 1766 dbSNP
rs905704043 1767 dbSNP
rs1231775193 1769 dbSNP
rs1001434286 1772 dbSNP
rs1300975538 1773 dbSNP
rs61741019 1777 dbSNP
rs543265985 1778 dbSNP
rs1045488148 1787 dbSNP
rs1249178939 1790 dbSNP
rs898127471 1791 dbSNP
rs906023640 1792 dbSNP
rs1418286636 1799 dbSNP
rs1222510392 1802 dbSNP
rs1255153806 1803 dbSNP
rs558360879 1805 dbSNP
rs993827303 1810 dbSNP
rs1189615637 1814 dbSNP
rs1001675601 1822 dbSNP
rs1249241794 1828 dbSNP
rs1033237815 1833 dbSNP
rs893387340 1837 dbSNP
rs1177238463 1838 dbSNP
rs1010526160 1842 dbSNP
rs1270820972 1850 dbSNP
rs1212668815 1851 dbSNP
rs1334687805 1855 dbSNP
rs375441353 1857 dbSNP
rs1190449892 1858 dbSNP
rs966063604 1861 dbSNP
rs1429398588 1869 dbSNP
rs1342659658 1872 dbSNP
rs976144890 1873 dbSNP
rs1447522299 1875 dbSNP
rs1388485247 1881 dbSNP
rs540971000 1884 dbSNP
rs1164244907 1885 dbSNP
rs1019090508 1889 dbSNP
rs1394990868 1894 dbSNP
rs775539426 1898 dbSNP
rs1451587896 1903 dbSNP
rs965249685 1906 dbSNP
rs3188939 1910 dbSNP
rs1293367353 1911 dbSNP
rs1386123150 1912 dbSNP
rs530045259 1914 dbSNP
rs909763574 1915 dbSNP
rs1268521919 1916 dbSNP
rs370798992 1917 dbSNP
rs972711754 1918 dbSNP
rs373668964 1922 dbSNP
rs1356025816 1923 dbSNP
rs1301295433 1925 dbSNP
rs1440500008 1934 dbSNP
rs949746181 1938 dbSNP
rs1331864014 1942 dbSNP
rs950082620 1947 dbSNP
rs1316493372 1951 dbSNP
rs1380257763 1955 dbSNP
rs981949772 1956 dbSNP
rs529832500 1957 dbSNP
rs1220726923 1959 dbSNP
rs905634497 1968 dbSNP
rs937477464 1970 dbSNP
rs1055028404 1976 dbSNP
rs1486728243 1977 dbSNP
rs1378935060 1982 dbSNP
rs1454469443 1982 dbSNP
rs1201479205 1986 dbSNP
rs1203102580 1990 dbSNP
rs893337375 1991 dbSNP
rs180912950 1992 dbSNP
rs1010892098 1993 dbSNP
rs1184335993 1995 dbSNP
rs775961452 1999 dbSNP
rs1387146710 2002 dbSNP
rs1278306937 2003 dbSNP
rs901819231 2005 dbSNP
rs761530894 2006 dbSNP
rs1276892685 2010 dbSNP
rs1225513560 2011 dbSNP
rs1325682241 2012 dbSNP
rs1278584483 2015 dbSNP
rs531107153 2018 dbSNP
rs74612261 2020 dbSNP
rs1287443703 2028 dbSNP
rs929625401 2031 dbSNP
rs1387502613 2034 dbSNP
rs1372913259 2036 dbSNP
rs1452888683 2039 dbSNP
rs984934235 2041 dbSNP
rs149641350 2042 dbSNP
rs1210784864 2049 dbSNP
rs962605610 2050 dbSNP
rs1007939275 2051 dbSNP
rs1280789766 2052 dbSNP
rs543534278 2053 dbSNP
rs528785720 2057 dbSNP
rs144318157 2063 dbSNP
rs565622549 2064 dbSNP
rs1353497832 2069 dbSNP
rs1033249274 2070 dbSNP
rs957639876 2072 dbSNP
rs989074773 2073 dbSNP
rs1326251117 2082 dbSNP
rs548489069 2088 dbSNP
rs1020272089 2098 dbSNP
rs971388238 2099 dbSNP
rs375463469 2100 dbSNP
rs1400518211 2102 dbSNP
rs1464658459 2108 dbSNP
rs569609200 2111 dbSNP
rs927007811 2112 dbSNP
rs937077678 2114 dbSNP
rs764924612 2121 dbSNP
rs1473400609 2125 dbSNP
rs117476244 2132 dbSNP
rs946251972 2133 dbSNP
rs1251908715 2140 dbSNP
rs1258890698 2144 dbSNP
rs1200743637 2146 dbSNP
rs866728043 2156 dbSNP
rs554613666 2160 dbSNP
rs1272275532 2163 dbSNP
rs185963361 2164 dbSNP
rs1358315371 2170 dbSNP
rs745983103 2173 dbSNP
rs959754258 2185 dbSNP
rs1376983112 2187 dbSNP
rs1333034120 2188 dbSNP
rs1438225491 2190 dbSNP
rs997477649 2191 dbSNP
rs1411676119 2198 dbSNP
rs992601726 2203 dbSNP
rs1178149290 2204 dbSNP
rs1357015816 2205 dbSNP
rs1164460969 2207 dbSNP
rs1416505320 2216 dbSNP
rs929872648 2216 dbSNP
rs1050416084 2217 dbSNP
rs1375498522 2220 dbSNP
rs1046969250 2228 dbSNP
rs1238858878 2232 dbSNP
rs889157260 2245 dbSNP
rs190683996 2247 dbSNP
rs1006706948 2248 dbSNP
rs1221973024 2251 dbSNP
rs943736424 2256 dbSNP
rs1282143627 2257 dbSNP
rs1324000404 2261 dbSNP
rs1310788036 2264 dbSNP
rs1016375340 2270 dbSNP
rs1293313843 2271 dbSNP
rs1437560276 2281 dbSNP
rs544710610 2286 dbSNP
rs1310622407 2292 dbSNP
rs140913672 2293 dbSNP
rs182790170 2300 dbSNP
rs1381050441 2301 dbSNP
rs755456035 2302 dbSNP
rs996347746 2304 dbSNP
rs534559929 2308 dbSNP
rs1481941200 2309 dbSNP
rs1489381770 2310 dbSNP
rs1180644970 2314 dbSNP
rs1025482652 2315 dbSNP
rs1010451406 2321 dbSNP
rs1480976414 2324 dbSNP
rs767959416 2330 dbSNP
rs1346721111 2341 dbSNP
rs1456923958 2342 dbSNP
rs1301612274 2344 dbSNP
rs1370229461 2344 dbSNP
rs971378126 2348 dbSNP
rs971291822 2366 dbSNP
rs981357451 2367 dbSNP
rs926946730 2370 dbSNP
rs1300117996 2371 dbSNP
rs559942111 2374 dbSNP
rs974204232 2384 dbSNP
rs919721732 2392 dbSNP
rs1307350996 2395 dbSNP
rs990282009 2398 dbSNP
rs537893135 2399 dbSNP
rs914339388 2401 dbSNP
rs982656028 2408 dbSNP
rs753293340 2409 dbSNP
rs766359522 2413 dbSNP
rs1265175876 2421 dbSNP
rs1208622925 2422 dbSNP
rs556099354 2422 dbSNP
rs1365815317 2424 dbSNP
rs1256043339 2430 dbSNP
rs1218852890 2431 dbSNP
rs1211861040 2433 dbSNP
rs1041909302 2437 dbSNP
rs553001321 2439 dbSNP
rs923471309 2440 dbSNP
rs1280726825 2441 dbSNP
rs1413444785 2445 dbSNP
rs1378605037 2453 dbSNP
rs933553626 2454 dbSNP
rs1050696126 2458 dbSNP
rs1309341340 2465 dbSNP
rs1352913475 2466 dbSNP
rs1203039737 2468 dbSNP
rs756527362 2469 dbSNP
rs185666483 2473 dbSNP
rs1425499100 2478 dbSNP
rs1274582182 2484 dbSNP
rs936393497 2487 dbSNP
rs1490645950 2492 dbSNP
rs1053534456 2493 dbSNP
rs777915904 2497 dbSNP
rs541881246 2512 dbSNP
rs143263641 2513 dbSNP
rs1010440065 2515 dbSNP
rs1243288195 2517 dbSNP
rs1006242553 2519 dbSNP
rs1038163081 2526 dbSNP
rs897918114 2529 dbSNP
rs1041989333 2530 dbSNP
rs1186744293 2532 dbSNP
rs1371261684 2535 dbSNP
rs1176159610 2540 dbSNP
rs907471969 2548 dbSNP
rs1002861645 2552 dbSNP
rs575633152 2558 dbSNP
rs1457371433 2564 dbSNP
rs1025430146 2565 dbSNP
rs1447152779 2579 dbSNP
rs373425730 2579 dbSNP
rs749272713 2586 dbSNP
rs1167370074 2590 dbSNP
rs190820723 2598 dbSNP
rs1178923991 2599 dbSNP
rs564666634 2600 dbSNP
rs1240453012 2602 dbSNP
rs1027061863 2603 dbSNP
rs1488448674 2604 dbSNP
rs116842713 2616 dbSNP
rs982605398 2625 dbSNP
rs1002725784 2630 dbSNP
rs1351650420 2631 dbSNP
rs1308595006 2636 dbSNP
rs1241179042 2642 dbSNP
rs1034247393 2645 dbSNP
rs912467789 2646 dbSNP
rs561812622 2651 dbSNP
rs989837397 2653 dbSNP
rs1391166404 2657 dbSNP
rs1021752667 2658 dbSNP
rs965647280 2659 dbSNP
rs1349087446 2677 dbSNP
rs975375655 2686 dbSNP
rs80293990 2687 dbSNP
rs1392815835 2693 dbSNP
rs1367562384 2699 dbSNP
rs977204865 2700 dbSNP
rs923422235 2708 dbSNP
rs936356813 2710 dbSNP
rs1433039251 2720 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.283 2.2e-3 0.214 1.6e-2 100 Click to see details
GSE19783 ER- ER- breast cancer 0.272 7.7e-3 0.242 1.6e-2 79 Click to see details
GSE21032 Prostate cancer 0.182 5.0e-2 0.183 4.9e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.335 5.1e-2 -0.239 1.2e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.305 7.9e-2 -0.246 1.3e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.303 9.7e-2 0.341 7.1e-2 20 Click to see details
GSE38226 Liver fibrosis 0.237 1.5e-1 0.087 3.5e-1 21 Click to see details
GSE28260 Renal cortex and medulla -0.288 1.7e-1 -0.253 2.0e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.248 1.8e-1 -0.315 1.2e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.177 2.0e-1 0.259 1.1e-1 25 Click to see details
GSE17306 Multiple myeloma 0.121 2.0e-1 0.188 9.8e-2 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.175 2.1e-1 -0.185 1.9e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.184 2.2e-1 -0.188 2.1e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.097 2.2e-1 -0.011 4.7e-1 64 Click to see details
GSE14794 Lymphoblastoid cells 0.075 2.4e-1 0.081 2.2e-1 90 Click to see details
GSE28544 Breast cancer 0.126 2.8e-1 0.450 1.4e-2 24 Click to see details
GSE32688 Pancreatic cancer 0.094 3.0e-1 0.096 3.0e-1 32 Click to see details
GSE21849 B cell lymphoma -0.093 3.2e-1 -0.107 2.9e-1 29 Click to see details
GSE19350 CNS germ cell tumors -0.069 4.2e-1 -0.308 1.7e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.069 4.2e-1 -0.308 1.7e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.281 0.02 -0.346 0 59 Click to see details
PRAD 0.302 0.02 0.221 0.06 50 Click to see details
PAAD 0.946 0.03 0.400 0.3 4 Click to see details
HNSC -0.281 0.04 -0.315 0.02 42 Click to see details
STAD 0.255 0.08 0.227 0.11 32 Click to see details
PCPG -0.906 0.14 -1.000 0.5 3 Click to see details
LIHC 0.148 0.16 0.179 0.11 49 Click to see details
ESCA -0.336 0.16 -0.436 0.09 11 Click to see details
CHOL -0.339 0.19 -0.350 0.18 9 Click to see details
KIRC -0.103 0.2 -0.032 0.4 68 Click to see details
CESC -0.789 0.21 -0.500 0.33 3 Click to see details
KIRP -0.077 0.34 0.060 0.37 32 Click to see details
LUAD -0.121 0.35 -0.168 0.3 12 Click to see details
UCEC 0.09 0.36 0.021 0.47 19 Click to see details
BLCA -0.083 0.37 -0.090 0.36 18 Click to see details
LUSC -0.045 0.39 -0.064 0.35 38 Click to see details
BRCA 0.019 0.43 -0.031 0.39 84 Click to see details
COAD 0.06 0.44 0.000 0.5 8 Click to see details
KICH 0.024 0.45 0.019 0.46 25 Click to see details
KICH 0.024 0.45 0.019 0.46 25 Click to see details
KICH 0.024 0.45 0.019 0.46 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*