miRTarBase - #MIRT726348 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TCF3   
Synonyms AGM8, E2A, E47, ITF1, TCF-3, VDIR, bHLHb21
Description transcription factor 3
Transcript NM_003200   
Other Transcripts NM_001136139   
Expression
Putative miRNA Targets on TCF3
3'UTR of TCF3
(miRNA target sites are highlighted)
>TCF3|NM_003200|3'UTR
   1 AAGGTATGCCTCCGTGGGACGAGCCACCCGCTTTCAGCCCTGTGCTCTGGCCCCAGAACGGCCACTCGAGACCCCGGGCT
  81 TCATCCACATCCACACCTCACACACCTGTTGTCAGCATCGAGCCAACACCAACCTGACAAGGTTCGGAGTGATGGGGGCG
 161 GCCAAGGTGACACTGGGTCCAGGAGCTCCCTGGGGCCCTGGCCTACCACTCACTGGCCTCGCTCCCCCTGTCCCCGAATC
 241 TCAGCCACCGTGTCACTCTGTGACCTGTCCCATGGATCCTGAAACTGCATCTTGGCCCTGTTGCCTGGGCTGACAGGAGC
 321 ATTTTTTTTTTTTCCAGTAAACAAAACCTGAAAGCAAGCAACAAAACATACACTTTGTCAGAGAAGAAAAAAATGCCTTA
 401 ACTATAAAAAGCGGAGAAATGGAAACATATCACTCAAGGGGGATGCTGTGGAAACCTGGCTTATTCTTCTAAAGCCACCA
 481 GCAAATTGTGCCTAAGCGAAATATTTTTTTTAAGGAAAATAAAAACATTAGTTACAAGATTTTTTTTTTCTTAATGTAGA
 561 TGAAAATTAGCAAGGATGCTGCCTTTGGTCTCTGGTTTTTTTAAGCTTTTTTTGCATATGTTTTGTAAGCAACAAATTTT
 641 TTTGTATAAAAGTCCCGTGTCTCTCGCTATTTCTGCTGCTGTTCCTAGACTGAGCATTGCATTTCTTGATCAACCAGATG
 721 ATTAAACGTTGTATTAAAAAGACCCCGTGTAAACCTGAGCCCCCCCGTCCCCCCCCCCCCCCGGAAGCCACTGCACACAG
 801 ACAGAACGGGGACAGGCGGCGGGTCTTTTGTTTTTTTGATGTTGGGGGTTCTCTTGGTTTTGTCATGTGGAAAGTGATGC
 881 GTGGGCGTTCCCTGATGAAGGCACCTTGGGGCTTCCCTGCCGCATCCTCTCCCCTCAGGAAGGGGACTGACCTGGGCTTG
 961 GGGGAAGGGACGTCAGCAAGGTGGCTCTGACCCTCCCAGGTGACTCTGCCAAGCAGCTGTGGCCCCCAGGGCTACCCTAC
1041 ACAACGCCCTCCCCAGGCCCCCCTAAGCTGCTCTCCCTTGGAACCTGCACAGCTCTCTGAAATGGGGCATTTTGTTGGGA
1121 CCAGTGACCCCTGGCATGGGGACCACACCCTGGAGCCCGGTGCTGGGGACCTCCTGGACACCCTGTCCTTCACTCCTTTG
1201 CCCCAGGGACCCAGGCTCATGCTCTGAACTCTGGCTGAGAGGATGCTGCTCAGGAGCCAGCACAGGACACCCCCCACCCC
1281 ACCCCACCATGTCCCCATTACACCAGAGGGCCATCGTGACGTAGACAGGATGCCAGGGGCCTGGCCAGCCTCCCCCAATG
1361 CTGGGGAGCATCCCTGGGCCTGGGGCCACACCTGCTGCCCTCCCTCTGTGTGGTCCAAGGGCAAGAGTGGCTGGAGCCGG
1441 GGGACTGTGCTGGTCTGAGCCCCACGAAGGCCTTGGGCTGTGCGTCCGACCCTGCTGCAGAACCAGCAGGGTGTCCCCTC
1521 GGGCCCATCTGTGTCCCATGTCCCAGCACCCAGGCCTCTCTCCAGGTCTCCTTTTCTGGTCTTTTGCCATGAGGGTAACC
1601 AGCTCTTCCCAGCTGGCTGGGGACTGTCTTGGGTTTAAAACTGCAAGTCTCCTACCCTGGGATCCCATCCAGTTCCACAC
1681 GAACTAGGGCAGTGGTCACTGTGGCACCCAGGTGTGGGCCTGGCTAGCTGGGGGCCTTCATGTGCCCTTCATGCCCCTCC
1761 CTGCATTGAGGCCTTGTGGACCCCTGGGCTGGCTGTGTTCATCCCCGCTGCAGGTCGGGCGTCTCCCCCCGTGCCACTCC
1841 TGAGACTCCCACCGTTACCCCCAGGAGATCCTGGACTGCCTGACTCCCCTCCCCAGACTGGCTTGGGAGCCTGGGCCCCA
1921 TGGTAGATGCAAGGGAAACCTCAAGGCCAGCTCAATGCCTGGTATCTGCCCCCAGTCCAGGCCAGGCGGAGGGGAGGGGC
2001 TGTCCGGCTGCCTCTCCCTTCTCGGTGGCTTCCCCTACGCCCTGGGAGTTTGATCTCTTAAGGGAACTTGCCTCTCCCTC
2081 TTGTTTTGCTCCTGGCCCTGCCCCTAGGTCTGGGTGGGCAGTGGCCCCATAGCCTCTGGAACTGTGCGTTCTGCATAGAA
2161 TTCAAACGAGATTCACCCAGCGCGAGGAGGAAGAAACAGCAGTTCCTGGGAACCACAATTATGGGGGGTGGGGGGTGTGA
2241 TCTGAGTGCCTCAAGATGGTTTTCAAAAAAATTTTTTTAAAGAAAATAATTGTATACGTGTCAACACAGCTGGCTGGATG
2321 ATTGGGACTTTAAAACGACCCTCTTTCAGGTGGATTCAGAGACCTGTCCTGTATATAACAGCACTGTAGCAATAAACGTG
2401 ACATTTTATAACGATGCCCTGCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               :|:||| | ||||||| 
Target 5' ctctcGCTATT-TCTGCTGCTg 3'
661 - 681 156.00 -13.70
2
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            | ::|::  | | ||||||| 
Target 5' ctCTGGCTGAGAGGATGCTGCTc 3'
1229 - 1251 144.00 -10.30
3
miRNA  3' gugUUUGGUAAUAC--ACGACGau 5'
             |||::|  | |  ||||||  
Target 5' tgaAAATTAGCAAGGATGCTGCct 3'
561 - 584 133.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30466825 12 COSMIC
COSN26998122 13 COSMIC
COSN9349249 21 COSMIC
COSN26553249 39 COSMIC
COSN30458170 63 COSMIC
COSN30163024 70 COSMIC
COSN31501034 74 COSMIC
COSN26574258 76 COSMIC
COSN30460567 106 COSMIC
COSN30136331 120 COSMIC
COSN30142972 150 COSMIC
COSN31770223 245 COSMIC
COSN1211591 322 COSMIC
COSN28706126 372 COSMIC
COSN26584504 386 COSMIC
COSN31540812 528 COSMIC
COSN31536166 579 COSMIC
COSN31522507 631 COSMIC
COSN29045389 769 COSMIC
COSN31770222 779 COSMIC
COSN16691768 904 COSMIC
COSN8256717 1626 COSMIC
COSN16405886 2068 COSMIC
COSN31770221 2100 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1334137461 9 dbSNP
rs576112105 10 dbSNP
rs564430460 13 dbSNP
rs760923384 14 dbSNP
rs1266111688 16 dbSNP
rs375466601 19 dbSNP
rs545747342 20 dbSNP
rs200553102 21 dbSNP
rs1481960097 23 dbSNP
rs371171520 24 dbSNP
rs774091578 25 dbSNP
rs1298995319 27 dbSNP
rs373836221 29 dbSNP
rs749046324 30 dbSNP
rs936352672 31 dbSNP
rs777743385 33 dbSNP
rs755797183 39 dbSNP
rs1310213971 40 dbSNP
rs747854184 44 dbSNP
rs201737116 47 dbSNP
rs369485070 50 dbSNP
rs1161695699 53 dbSNP
rs41275836 59 dbSNP
rs574234503 60 dbSNP
rs932433689 67 dbSNP
rs560197162 68 dbSNP
rs1313650183 74 dbSNP
rs748072696 75 dbSNP
rs986964780 76 dbSNP
rs1188679614 79 dbSNP
rs1260201350 82 dbSNP
rs954177159 84 dbSNP
rs921354157 93 dbSNP
rs976428141 98 dbSNP
rs1203187949 104 dbSNP
rs1485450288 106 dbSNP
rs1348548410 108 dbSNP
rs1268495388 114 dbSNP
rs1229922256 117 dbSNP
rs974164661 119 dbSNP
rs965017850 123 dbSNP
rs1415558788 128 dbSNP
rs1292135706 129 dbSNP
rs1015626274 132 dbSNP
rs1004212642 138 dbSNP
rs1342804590 139 dbSNP
rs538454165 142 dbSNP
rs1294116315 145 dbSNP
rs1382121026 146 dbSNP
rs1303762740 156 dbSNP
rs1015641593 159 dbSNP
rs1381685499 159 dbSNP
rs1287883325 160 dbSNP
rs982737246 165 dbSNP
rs1329861773 177 dbSNP
rs1230165731 180 dbSNP
rs952718558 198 dbSNP
rs1026846670 202 dbSNP
rs1210615776 205 dbSNP
rs894955369 206 dbSNP
rs570921323 208 dbSNP
rs1479490165 209 dbSNP
rs1393940739 213 dbSNP
rs1055295435 218 dbSNP
rs758364279 220 dbSNP
rs1473257910 224 dbSNP
rs1371384766 226 dbSNP
rs1190987447 227 dbSNP
rs1414382269 230 dbSNP
rs1427866718 230 dbSNP
rs1177323914 232 dbSNP
rs1361259123 234 dbSNP
rs552721889 235 dbSNP
rs903581184 236 dbSNP
rs1042078354 238 dbSNP
rs1210287858 240 dbSNP
rs534522485 242 dbSNP
rs1344289387 245 dbSNP
rs894601309 249 dbSNP
rs1305492395 250 dbSNP
rs912822747 250 dbSNP
rs1357891239 258 dbSNP
rs1274861102 259 dbSNP
rs1267889732 265 dbSNP
rs1035776790 266 dbSNP
rs1366488403 267 dbSNP
rs1196716987 270 dbSNP
rs1267542054 272 dbSNP
rs1051250084 278 dbSNP
rs1192219730 281 dbSNP
rs1300276429 294 dbSNP
rs1002921821 296 dbSNP
rs932841951 297 dbSNP
rs1439114567 307 dbSNP
rs1370564747 308 dbSNP
rs1168234056 317 dbSNP
rs865821344 319 dbSNP
rs1326889834 321 dbSNP
rs1371452591 331 dbSNP
rs1407264146 332 dbSNP
rs567165713 333 dbSNP
rs1227447206 334 dbSNP
rs1359642547 334 dbSNP
rs1491046899 334 dbSNP
rs554439572 334 dbSNP
rs780522047 334 dbSNP
rs368335619 336 dbSNP
rs962866015 336 dbSNP
rs1219791424 347 dbSNP
rs1343932596 347 dbSNP
rs750177008 350 dbSNP
rs1451624464 352 dbSNP
rs1390667178 361 dbSNP
rs1190299357 364 dbSNP
rs1042088823 365 dbSNP
rs982787327 369 dbSNP
rs1252110185 370 dbSNP
rs1391160993 371 dbSNP
rs1451560066 380 dbSNP
rs971345726 382 dbSNP
rs1199206958 383 dbSNP
rs186170105 387 dbSNP
rs1325571277 394 dbSNP
rs1343415889 395 dbSNP
rs893367529 397 dbSNP
rs1298153255 400 dbSNP
rs1194672047 402 dbSNP
rs1243341695 404 dbSNP
rs1283193177 407 dbSNP
rs1050588963 411 dbSNP
rs530072617 412 dbSNP
rs923402931 413 dbSNP
rs1040780559 416 dbSNP
rs1052894 425 dbSNP
rs141181374 427 dbSNP
rs1033541232 431 dbSNP
rs1249046084 431 dbSNP
rs1001106042 432 dbSNP
rs1185726920 433 dbSNP
rs1368153981 436 dbSNP
rs903636579 441 dbSNP
rs1165133578 443 dbSNP
rs943760755 443 dbSNP
rs1277339353 444 dbSNP
rs1020628319 446 dbSNP
rs1009190783 447 dbSNP
rs1232714859 456 dbSNP
rs550771312 466 dbSNP
rs140391605 467 dbSNP
rs890771285 469 dbSNP
rs564163163 476 dbSNP
rs1450140294 478 dbSNP
rs1333226934 485 dbSNP
rs1340756280 488 dbSNP
rs1246524579 492 dbSNP
rs908225712 497 dbSNP
rs1327796005 498 dbSNP
rs982841154 501 dbSNP
rs1228341988 503 dbSNP
rs1275808550 504 dbSNP
rs952694329 511 dbSNP
rs1199145473 512 dbSNP
rs1255890577 512 dbSNP
rs1443281393 521 dbSNP
rs1189800126 523 dbSNP
rs1249732348 525 dbSNP
rs1438950453 529 dbSNP
rs1472280121 529 dbSNP
rs1159863035 532 dbSNP
rs1414148197 533 dbSNP
rs1334135017 540 dbSNP
rs1171851924 549 dbSNP
rs202169014 550 dbSNP
rs932949050 550 dbSNP
rs1326385889 551 dbSNP
rs747372909 551 dbSNP
rs900066745 555 dbSNP
rs1409947153 558 dbSNP
rs919833743 559 dbSNP
rs1038567473 561 dbSNP
rs14990 566 dbSNP
rs1352924209 568 dbSNP
rs1231705143 584 dbSNP
rs1255776544 586 dbSNP
rs774321207 589 dbSNP
rs1391987753 592 dbSNP
rs543300335 594 dbSNP
rs1035491825 595 dbSNP
rs950044539 599 dbSNP
rs917283894 606 dbSNP
rs1254060208 608 dbSNP
rs545113733 610 dbSNP
rs959356293 611 dbSNP
rs1432776646 614 dbSNP
rs560006396 616 dbSNP
rs1369612435 618 dbSNP
rs1172883575 619 dbSNP
rs1429982119 620 dbSNP
rs1020315423 627 dbSNP
rs576598773 634 dbSNP
rs1309390183 635 dbSNP
rs979297808 644 dbSNP
rs1252951557 646 dbSNP
rs541427065 649 dbSNP
rs1301129621 652 dbSNP
rs574067381 655 dbSNP
rs761733370 656 dbSNP
rs1020681005 657 dbSNP
rs183693242 661 dbSNP
rs996351427 663 dbSNP
rs1483127494 665 dbSNP
rs1276877788 666 dbSNP
rs756899284 666 dbSNP
rs753529494 667 dbSNP
rs1209196000 669 dbSNP
rs890865021 673 dbSNP
rs1029309794 675 dbSNP
rs370923080 675 dbSNP
rs1186503384 676 dbSNP
rs1485624325 679 dbSNP
rs1040501069 684 dbSNP
rs900089038 689 dbSNP
rs1279800757 692 dbSNP
rs1347636372 693 dbSNP
rs1456936335 695 dbSNP
rs529580309 697 dbSNP
rs774683531 700 dbSNP
rs1348837853 701 dbSNP
rs943829901 705 dbSNP
rs1318962354 706 dbSNP
rs147178681 709 dbSNP
rs1229212085 712 dbSNP
rs1229435413 713 dbSNP
rs576847972 718 dbSNP
rs1300041957 725 dbSNP
rs536905674 727 dbSNP
rs930974702 728 dbSNP
rs919556273 731 dbSNP
rs1489461068 732 dbSNP
rs536168663 733 dbSNP
rs991414931 734 dbSNP
rs1412870737 738 dbSNP
rs1047247917 741 dbSNP
rs950136713 743 dbSNP
rs958591139 746 dbSNP
rs1334610047 747 dbSNP
rs1411239530 750 dbSNP
rs1046706036 756 dbSNP
rs1415916113 757 dbSNP
rs1405500026 758 dbSNP
rs1164936922 760 dbSNP
rs781366349 764 dbSNP
rs1463484075 765 dbSNP
rs917334730 766 dbSNP
rs1395665155 767 dbSNP
rs1436325337 767 dbSNP
rs949341600 767 dbSNP
rs895163459 768 dbSNP
rs1226522629 769 dbSNP
rs1329744464 769 dbSNP
rs146828335 769 dbSNP
rs1482763929 770 dbSNP
rs991541097 771 dbSNP
rs926564049 772 dbSNP
rs913768837 773 dbSNP
rs1465744425 774 dbSNP
rs987918157 774 dbSNP
rs1029332747 775 dbSNP
rs955166213 775 dbSNP
rs757615232 776 dbSNP
rs1445677033 777 dbSNP
rs1283996933 778 dbSNP
rs1209656367 779 dbSNP
rs928478054 780 dbSNP
rs1377555504 781 dbSNP
rs1428054157 781 dbSNP
rs981670150 782 dbSNP
rs1207282248 783 dbSNP
rs1305339874 783 dbSNP
rs1366779204 783 dbSNP
rs1371175881 783 dbSNP
rs1399797434 783 dbSNP
rs1444317024 783 dbSNP
rs758559871 783 dbSNP
rs764169598 783 dbSNP
rs996526255 783 dbSNP
rs1232710766 784 dbSNP
rs1245525566 784 dbSNP
rs1378382550 791 dbSNP
rs967523681 796 dbSNP
rs1284764425 798 dbSNP
rs1020786299 799 dbSNP
rs1447896703 801 dbSNP
rs1168138087 802 dbSNP
rs1390895784 803 dbSNP
rs1055180055 805 dbSNP
rs1343284989 806 dbSNP
rs1011623043 807 dbSNP
rs1321643224 808 dbSNP
rs560567099 811 dbSNP
rs534380177 813 dbSNP
rs957609349 817 dbSNP
rs1457455893 818 dbSNP
rs567177975 820 dbSNP
rs540808416 821 dbSNP
rs1227240349 826 dbSNP
rs555257314 829 dbSNP
rs1162197023 830 dbSNP
rs902090425 830 dbSNP
rs1340999944 834 dbSNP
rs1019103900 837 dbSNP
rs1422779066 838 dbSNP
rs1005457938 842 dbSNP
rs887337980 848 dbSNP
rs886568403 851 dbSNP
rs1047299708 859 dbSNP
rs1188288062 862 dbSNP
rs755529533 866 dbSNP
rs1184180558 867 dbSNP
rs1474703315 874 dbSNP
rs536670064 880 dbSNP
rs375181763 881 dbSNP
rs1386223680 885 dbSNP
rs1434144876 886 dbSNP
rs371338820 887 dbSNP
rs937376951 890 dbSNP
rs80101129 897 dbSNP
rs1271455305 898 dbSNP
rs1043052166 906 dbSNP
rs532528681 910 dbSNP
rs937271989 916 dbSNP
rs1275639441 918 dbSNP
rs1327667904 920 dbSNP
rs946661452 921 dbSNP
rs137923871 922 dbSNP
rs1185616489 929 dbSNP
rs987941075 931 dbSNP
rs1292110078 934 dbSNP
rs955168038 941 dbSNP
rs1409728149 949 dbSNP
rs1230018217 951 dbSNP
rs551994289 952 dbSNP
rs981338744 955 dbSNP
rs922392150 960 dbSNP
rs1359708618 964 dbSNP
rs527443516 968 dbSNP
rs1296607940 971 dbSNP
rs192319002 972 dbSNP
rs373732931 976 dbSNP
rs1017034751 980 dbSNP
rs113708250 988 dbSNP
rs957429243 989 dbSNP
rs562371279 992 dbSNP
rs1228245000 998 dbSNP
rs372695366 1004 dbSNP
rs368643738 1005 dbSNP
rs951642417 1006 dbSNP
rs1278237694 1009 dbSNP
rs1486108720 1022 dbSNP
rs544189594 1024 dbSNP
rs576904084 1028 dbSNP
rs1014435667 1029 dbSNP
rs895963717 1031 dbSNP
rs113714582 1034 dbSNP
rs1365349906 1035 dbSNP
rs1189640037 1037 dbSNP
rs1171751520 1039 dbSNP
rs536220136 1045 dbSNP
rs1002056825 1049 dbSNP
rs1305642886 1052 dbSNP
rs1369335437 1053 dbSNP
rs1251492896 1055 dbSNP
rs763074707 1056 dbSNP
rs1005100205 1058 dbSNP
rs1488922138 1062 dbSNP
rs1043492206 1064 dbSNP
rs558579070 1064 dbSNP
rs1348955781 1065 dbSNP
rs1202447227 1069 dbSNP
rs1305729943 1075 dbSNP
rs1273889524 1077 dbSNP
rs540830503 1083 dbSNP
rs573450123 1084 dbSNP
rs1027797343 1085 dbSNP
rs1229013012 1094 dbSNP
rs1344131966 1095 dbSNP
rs1395382403 1103 dbSNP
rs1455315276 1104 dbSNP
rs555320454 1119 dbSNP
rs1300964816 1122 dbSNP
rs1462086602 1127 dbSNP
rs774839101 1128 dbSNP
rs1399333609 1129 dbSNP
rs367750491 1130 dbSNP
rs913821453 1131 dbSNP
rs565716345 1134 dbSNP
rs936990341 1135 dbSNP
rs933836641 1141 dbSNP
rs1295633349 1149 dbSNP
rs3746112 1150 dbSNP
rs1253141363 1155 dbSNP
rs942483348 1157 dbSNP
rs909623196 1158 dbSNP
rs186541271 1159 dbSNP
rs950989045 1160 dbSNP
rs945957554 1162 dbSNP
rs1247081948 1163 dbSNP
rs1025921308 1164 dbSNP
rs913075698 1167 dbSNP
rs763249492 1171 dbSNP
rs1366136409 1173 dbSNP
rs111671568 1174 dbSNP
rs1395717335 1185 dbSNP
rs1443626713 1188 dbSNP
rs922016227 1195 dbSNP
rs1001709441 1197 dbSNP
rs974758953 1200 dbSNP
rs1382921991 1201 dbSNP
rs904642035 1210 dbSNP
rs966023629 1211 dbSNP
rs1244013270 1215 dbSNP
rs1010209654 1221 dbSNP
rs1336826918 1222 dbSNP
rs1427482339 1225 dbSNP
rs1267254919 1226 dbSNP
rs773522811 1237 dbSNP
rs571660271 1249 dbSNP
rs1252618836 1250 dbSNP
rs933933372 1261 dbSNP
rs1188011820 1262 dbSNP
rs1483962028 1268 dbSNP
rs1277929829 1270 dbSNP
rs1232205642 1273 dbSNP
rs1157398858 1275 dbSNP
rs1344914168 1277 dbSNP
rs748113552 1280 dbSNP
rs1303022211 1281 dbSNP
rs1377209297 1282 dbSNP
rs1414296200 1284 dbSNP
rs546660179 1285 dbSNP
rs1028268619 1286 dbSNP
rs994998778 1287 dbSNP
rs962493358 1288 dbSNP
rs765193208 1289 dbSNP
rs1226429844 1290 dbSNP
rs1308097328 1293 dbSNP
rs942514247 1297 dbSNP
rs909626935 1304 dbSNP
rs1253924462 1310 dbSNP
rs1482713903 1311 dbSNP
rs983849540 1312 dbSNP
rs1034104356 1313 dbSNP
rs1001251349 1315 dbSNP
rs929641458 1320 dbSNP
rs1180585613 1324 dbSNP
rs906881903 1326 dbSNP
rs1302668998 1330 dbSNP
rs1420091997 1330 dbSNP
rs1466831840 1333 dbSNP
rs1379700453 1334 dbSNP
rs1313565273 1336 dbSNP
rs753915951 1336 dbSNP
rs8103100 1344 dbSNP
rs1407946978 1347 dbSNP
rs1278844742 1349 dbSNP
rs1373911929 1350 dbSNP
rs1412807570 1352 dbSNP
rs1010594274 1354 dbSNP
rs781757987 1355 dbSNP
rs1281908840 1358 dbSNP
rs1481769923 1362 dbSNP
rs566361922 1369 dbSNP
rs112875117 1370 dbSNP
rs1232834022 1377 dbSNP
rs1473549497 1378 dbSNP
rs935837948 1386 dbSNP
rs1423499761 1388 dbSNP
rs921733513 1389 dbSNP
rs980687475 1392 dbSNP
rs771173443 1402 dbSNP
rs1039106692 1404 dbSNP
rs1427937196 1406 dbSNP
rs1328204175 1407 dbSNP
rs968888792 1409 dbSNP
rs116242524 1411 dbSNP
rs1010302957 1413 dbSNP
rs1369953111 1414 dbSNP
rs1213286510 1421 dbSNP
rs1327974828 1422 dbSNP
rs1305221904 1429 dbSNP
rs771892907 1432 dbSNP
rs1160758670 1435 dbSNP
rs1288438270 1436 dbSNP
rs891860630 1438 dbSNP
rs747427808 1439 dbSNP
rs1312682247 1440 dbSNP
rs951071704 1443 dbSNP
rs1397113765 1444 dbSNP
rs370851297 1447 dbSNP
rs920855648 1455 dbSNP
rs1404870660 1457 dbSNP
rs997464068 1460 dbSNP
rs190052389 1465 dbSNP
rs959536264 1466 dbSNP
rs1255149110 1467 dbSNP
rs534186755 1477 dbSNP
rs1161488889 1478 dbSNP
rs562791104 1483 dbSNP
rs1001303624 1484 dbSNP
rs888258889 1487 dbSNP
rs573332902 1488 dbSNP
rs1393590928 1491 dbSNP
rs1461789549 1496 dbSNP
rs1327601792 1498 dbSNP
rs1362588299 1503 dbSNP
rs1367936581 1507 dbSNP
rs1429586162 1508 dbSNP
rs1186836365 1518 dbSNP
rs757091605 1520 dbSNP
rs543870658 1521 dbSNP
rs1186370674 1526 dbSNP
rs891415162 1541 dbSNP
rs1334710791 1543 dbSNP
rs1054306917 1547 dbSNP
rs1000038362 1554 dbSNP
rs900361192 1555 dbSNP
rs185592038 1559 dbSNP
rs938329306 1560 dbSNP
rs1353727156 1563 dbSNP
rs1264332987 1567 dbSNP
rs532082543 1568 dbSNP
rs564996501 1571 dbSNP
rs1417098132 1573 dbSNP
rs1461835682 1574 dbSNP
rs980350124 1578 dbSNP
rs1038822432 1589 dbSNP
rs1318531813 1590 dbSNP
rs944819464 1598 dbSNP
rs1445200742 1603 dbSNP
rs1293916362 1604 dbSNP
rs911975501 1610 dbSNP
rs1048234194 1616 dbSNP
rs1366350539 1617 dbSNP
rs929326775 1617 dbSNP
rs920559966 1619 dbSNP
rs540299245 1630 dbSNP
rs973665139 1632 dbSNP
rs938221856 1633 dbSNP
rs572960422 1643 dbSNP
rs1249770489 1644 dbSNP
rs1285249306 1647 dbSNP
rs988936154 1655 dbSNP
rs956158496 1656 dbSNP
rs1475528135 1657 dbSNP
rs1189951565 1674 dbSNP
rs982264541 1678 dbSNP
rs971593789 1680 dbSNP
rs1024060885 1681 dbSNP
rs1409722538 1685 dbSNP
rs988932181 1687 dbSNP
rs955744872 1688 dbSNP
rs1311815236 1690 dbSNP
rs1032615322 1697 dbSNP
rs749103451 1700 dbSNP
rs561496107 1707 dbSNP
rs900412029 1716 dbSNP
rs1017427348 1718 dbSNP
rs1448700787 1720 dbSNP
rs1248402711 1724 dbSNP
rs1238799851 1725 dbSNP
rs1190170443 1728 dbSNP
rs1232354219 1729 dbSNP
rs755794219 1731 dbSNP
rs890247930 1732 dbSNP
rs1266055662 1735 dbSNP
rs1209872706 1737 dbSNP
rs1047817944 1739 dbSNP
rs964718687 1747 dbSNP
rs929353696 1753 dbSNP
rs752088590 1754 dbSNP
rs543241041 1755 dbSNP
rs575889938 1756 dbSNP
rs888344170 1757 dbSNP
rs1395273635 1761 dbSNP
rs899184126 1762 dbSNP
rs1434598602 1766 dbSNP
rs1048300396 1771 dbSNP
rs993996115 1773 dbSNP
rs1391318685 1780 dbSNP
rs896916384 1780 dbSNP
rs1056865703 1781 dbSNP
rs1324323704 1784 dbSNP
rs1037688069 1788 dbSNP
rs1394400066 1793 dbSNP
rs1236602375 1801 dbSNP
rs1249619946 1805 dbSNP
rs1338740259 1807 dbSNP
rs76820530 1816 dbSNP
rs538660191 1817 dbSNP
rs926858824 1820 dbSNP
rs1170171132 1821 dbSNP
rs1476852627 1824 dbSNP
rs1253257986 1825 dbSNP
rs577934428 1828 dbSNP
rs1190483747 1829 dbSNP
rs982320333 1830 dbSNP
rs1461966822 1831 dbSNP
rs947699754 1831 dbSNP
rs1403034620 1839 dbSNP
rs1460224006 1845 dbSNP
rs1325580688 1846 dbSNP
rs1372003205 1848 dbSNP
rs949587536 1849 dbSNP
rs1452871989 1854 dbSNP
rs755532654 1856 dbSNP
rs914028193 1858 dbSNP
rs1228200641 1860 dbSNP
rs1205149007 1863 dbSNP
rs1332519301 1864 dbSNP
rs374868920 1864 dbSNP
rs988946227 1865 dbSNP
rs1469582572 1873 dbSNP
rs577683162 1884 dbSNP
rs1217794094 1885 dbSNP
rs1032667228 1886 dbSNP
rs557406314 1888 dbSNP
rs370154030 1889 dbSNP
rs956168281 1890 dbSNP
rs978388820 1891 dbSNP
rs1344611965 1895 dbSNP
rs913121582 1905 dbSNP
rs1395652299 1910 dbSNP
rs964639692 1912 dbSNP
rs1275719552 1913 dbSNP
rs1287299502 1915 dbSNP
rs976165100 1916 dbSNP
rs1235657339 1917 dbSNP
rs1348767530 1918 dbSNP
rs987366057 1920 dbSNP
rs965144170 1921 dbSNP
rs1017628936 1929 dbSNP
rs567417124 1931 dbSNP
rs1336639100 1933 dbSNP
rs1213336338 1934 dbSNP
rs1009198269 1939 dbSNP
rs890310749 1940 dbSNP
rs1371042227 1941 dbSNP
rs1309645577 1943 dbSNP
rs1026870806 1944 dbSNP
rs1026543811 1945 dbSNP
rs72618599 1946 dbSNP
rs899236375 1947 dbSNP
rs536404733 1948 dbSNP
rs937996388 1950 dbSNP
rs1425952049 1952 dbSNP
rs1157309378 1953 dbSNP
rs181274027 1956 dbSNP
rs941415402 1956 dbSNP
rs905159028 1957 dbSNP
rs1046655762 1962 dbSNP
rs949644567 1963 dbSNP
rs905604318 1964 dbSNP
rs1478799449 1966 dbSNP
rs1409150322 1970 dbSNP
rs550821675 1973 dbSNP
rs1305941820 1974 dbSNP
rs531853135 1975 dbSNP
rs914095428 1976 dbSNP
rs1053018771 1978 dbSNP
rs1277633574 1987 dbSNP
rs532030020 1988 dbSNP
rs763374680 1989 dbSNP
rs1258848445 1999 dbSNP
rs1484489288 2001 dbSNP
rs1208616348 2003 dbSNP
rs773633934 2004 dbSNP
rs964357671 2005 dbSNP
rs879844727 2006 dbSNP
rs910191654 2012 dbSNP
rs1393460649 2017 dbSNP
rs987425328 2023 dbSNP
rs1174276976 2032 dbSNP
rs934843661 2033 dbSNP
rs112793810 2034 dbSNP
rs954769503 2036 dbSNP
rs1052918 2037 dbSNP
rs549439126 2038 dbSNP
rs943506959 2038 dbSNP
rs143589450 2039 dbSNP
rs1352389308 2041 dbSNP
rs1314529426 2042 dbSNP
rs1203009302 2043 dbSNP
rs1281253403 2043 dbSNP
rs1445723943 2048 dbSNP
rs1481183567 2051 dbSNP
rs1180849150 2052 dbSNP
rs1251386310 2055 dbSNP
rs1453938249 2060 dbSNP
rs1339713872 2063 dbSNP
rs1353413233 2066 dbSNP
rs951989380 2067 dbSNP
rs1016364342 2071 dbSNP
rs1334499921 2072 dbSNP
rs527644879 2073 dbSNP
rs1169612975 2074 dbSNP
rs905212039 2076 dbSNP
rs1046809046 2077 dbSNP
rs767530206 2078 dbSNP
rs892701152 2089 dbSNP
rs41275834 2090 dbSNP
rs1472722225 2091 dbSNP
rs936846351 2098 dbSNP
rs925422604 2102 dbSNP
rs1213435505 2104 dbSNP
rs1189998791 2106 dbSNP
rs1042803266 2107 dbSNP
rs905619938 2112 dbSNP
rs542863373 2129 dbSNP
rs1267794618 2132 dbSNP
rs759447852 2133 dbSNP
rs1474484638 2134 dbSNP
rs1209560198 2139 dbSNP
rs1023096381 2147 dbSNP
rs1420150574 2148 dbSNP
rs1478761443 2151 dbSNP
rs545052874 2153 dbSNP
rs1162604607 2154 dbSNP
rs1393434581 2155 dbSNP
rs1461678541 2157 dbSNP
rs575746424 2158 dbSNP
rs1325154777 2162 dbSNP
rs987530027 2165 dbSNP
rs868286785 2167 dbSNP
rs1331391173 2171 dbSNP
rs774223768 2172 dbSNP
rs759550545 2178 dbSNP
rs1341749879 2179 dbSNP
rs919166605 2180 dbSNP
rs770886833 2181 dbSNP
rs1445435640 2182 dbSNP
rs188025273 2182 dbSNP
rs200468115 2183 dbSNP
rs902091591 2183 dbSNP
rs1016081878 2184 dbSNP
rs1355474647 2185 dbSNP
rs1399749753 2185 dbSNP
rs1284599281 2187 dbSNP
rs1318475123 2187 dbSNP
rs562682379 2193 dbSNP
rs1040582574 2195 dbSNP
rs943500823 2202 dbSNP
rs1454333878 2203 dbSNP
rs1355326453 2209 dbSNP
rs1362745666 2212 dbSNP
rs1449226775 2218 dbSNP
rs1319524829 2221 dbSNP
rs1286320596 2222 dbSNP
rs1002312504 2223 dbSNP
rs35004196 2223 dbSNP
rs969445905 2226 dbSNP
rs1355987662 2227 dbSNP
rs1025007424 2228 dbSNP
rs545718318 2230 dbSNP
rs577893859 2231 dbSNP
rs1014000144 2232 dbSNP
rs867946804 2234 dbSNP
rs1189438971 2236 dbSNP
rs1442867620 2236 dbSNP
rs1162005987 2241 dbSNP
rs1469353425 2253 dbSNP
rs1158844853 2256 dbSNP
rs1381732367 2263 dbSNP
rs1053126054 2264 dbSNP
rs11882971 2265 dbSNP
rs972055515 2269 dbSNP
rs1052954 2271 dbSNP
rs1039829918 2272 dbSNP
rs367769486 2272 dbSNP
rs1334323200 2273 dbSNP
rs543811590 2278 dbSNP
rs1310294706 2281 dbSNP
rs1379321495 2282 dbSNP
rs1232190506 2286 dbSNP
rs888855647 2290 dbSNP
rs1279700763 2291 dbSNP
rs149325184 2292 dbSNP
rs1202084767 2293 dbSNP
rs1270671755 2294 dbSNP
rs932987938 2295 dbSNP
rs1437044269 2296 dbSNP
rs1178963275 2297 dbSNP
rs374144001 2298 dbSNP
rs1247793927 2300 dbSNP
rs971993296 2310 dbSNP
rs529273234 2312 dbSNP
rs1174864826 2320 dbSNP
rs941907493 2322 dbSNP
rs1394907063 2326 dbSNP
rs1465446410 2331 dbSNP
rs1332386501 2334 dbSNP
rs909072542 2336 dbSNP
rs1438964248 2339 dbSNP
rs1302831187 2341 dbSNP
rs1220881962 2343 dbSNP
rs1235462582 2347 dbSNP
rs1321071435 2348 dbSNP
rs1338599467 2350 dbSNP
rs1199039465 2354 dbSNP
rs1259744096 2357 dbSNP
rs1466899848 2364 dbSNP
rs1290568929 2367 dbSNP
rs998470372 2368 dbSNP
rs1434426514 2373 dbSNP
rs902102809 2373 dbSNP
rs576183556 2375 dbSNP
rs747897526 2379 dbSNP
rs1171905773 2384 dbSNP
rs1402879051 2385 dbSNP
rs1339890064 2387 dbSNP
rs969499622 2388 dbSNP
rs1007747345 2392 dbSNP
rs1363582350 2397 dbSNP
rs889256805 2398 dbSNP
rs1279907200 2406 dbSNP
rs1332459301 2407 dbSNP
rs1232406772 2408 dbSNP
rs1025481895 2409 dbSNP
rs536077547 2412 dbSNP
rs3181015 2415 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.706 8.4e-5 -0.560 2.7e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.725 1.5e-4 -0.847 1.2e-6 20 Click to see details
GSE19536 Breast cancer -0.268 3.5e-3 -0.246 6.8e-3 100 Click to see details
GSE19783 ER- ER- breast cancer -0.232 2.0e-2 -0.183 5.3e-2 79 Click to see details
GSE21032 Prostate cancer -0.222 2.2e-2 -0.152 8.5e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.448 2.4e-2 -0.505 1.2e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.403 2.5e-2 0.374 3.6e-2 24 Click to see details
GSE21687 Ependynoma primary tumors -0.207 5.0e-2 -0.203 5.4e-2 64 Click to see details
GSE28260 Renal cortex and medulla 0.349 1.2e-1 0.242 2.1e-1 13 Click to see details
GSE17498 Multiple myeloma 0.164 1.6e-1 0.165 1.5e-1 40 Click to see details
GSE32688 Pancreatic cancer 0.179 1.6e-1 0.037 4.2e-1 32 Click to see details
GSE17306 Multiple myeloma -0.123 2.0e-1 -0.122 2.0e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.041 3.5e-1 0.015 4.4e-1 90 Click to see details
GSE38226 Liver fibrosis 0.083 3.6e-1 0.132 2.8e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.063 3.8e-1 0.064 3.8e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.056 4.0e-1 -0.066 3.8e-1 25 Click to see details
GSE21849 B cell lymphoma 0.037 4.2e-1 0.253 9.3e-2 29 Click to see details
GSE19350 CNS germ cell tumors -0.027 4.7e-1 -0.315 1.6e-1 12 Click to see details
GSE28544 Breast cancer 0.016 4.7e-1 0.138 2.6e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.003 5.0e-1 -0.274 1.5e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.003 5.0e-1 -0.274 1.5e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.505 0 0.481 0 32 Click to see details
THCA 0.279 0.02 0.367 0 59 Click to see details
BLCA 0.456 0.03 0.441 0.03 18 Click to see details
ESCA 0.57 0.03 0.518 0.05 11 Click to see details
BRCA -0.187 0.04 -0.212 0.03 84 Click to see details
PAAD 0.865 0.07 0.200 0.4 4 Click to see details
LUSC -0.234 0.08 -0.178 0.14 38 Click to see details
PRAD 0.194 0.09 0.173 0.11 50 Click to see details
LIHC 0.183 0.1 0.249 0.04 49 Click to see details
KIRP -0.227 0.11 -0.199 0.14 32 Click to see details
PCPG 0.941 0.11 1.000 0.5 3 Click to see details
COAD 0.485 0.11 0.643 0.04 8 Click to see details
UCEC -0.269 0.13 -0.188 0.22 19 Click to see details
CESC -0.882 0.16 -1.000 0.5 3 Click to see details
LUAD 0.274 0.19 0.280 0.19 12 Click to see details
CHOL 0.326 0.2 0.350 0.18 9 Click to see details
KIRC -0.096 0.22 -0.057 0.32 68 Click to see details
KICH 0.133 0.26 0.073 0.36 25 Click to see details
HNSC 0.084 0.3 0.127 0.21 42 Click to see details
HNSC 0.084 0.3 0.127 0.21 42 Click to see details
HNSC 0.084 0.3 0.127 0.21 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*