miRTarBase - #MIRT720153 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PPIP5K2   
Synonyms CFAP160, HISPPD1, IP7K2, VIP2
Description diphosphoinositol pentakisphosphate kinase 2
Transcript NM_015216   
Expression
Putative miRNA Targets on PPIP5K2
3'UTR of PPIP5K2
(miRNA target sites are highlighted)
>PPIP5K2|NM_015216|3'UTR
   1 AATCTTAGCAGAAGCTGGAACTTTTTATACTTATAAAAATAGTATGTTCTTATGTTTCTCCTTATGCATTTATGTGTTCA
  81 CTTAAAAATGTTTTTAAATCTAAGGTTTTCTTTGTTTATGTTCAGGTAAGGAACTGTTGTCATGATCTGGAAATGTTTAA
 161 AACAATGTTTGTTAGCATTCTGTGAGCAGCAAAACTTATAGTGATAAAAATCGATTGTTGTTAATATGATGTTTACCATG
 241 TGCACATAGTAATGAAAAGGAACATAAAAGCCCAGCAGGCTCGTACCAAAGTCACAGCAGTAATGCTATGTACTGCAGAG
 321 TCTGATGAGCTGGCCTTTGTGCACACTTTTATTTTCATGGGATTGCATCTTAGCTGTTAAAACTTCTAGATTGAAATTTG
 401 ACAGCCAGGGTTACATATTGGGGACTTTTAAAGTGTCTTTCCAAAGAGATTTCATTAACCGTTTAGATTAGAATATCTTT
 481 CCCAATTGTTACAGTGACATATATGCTGCAATATTTAACAACTGGAGTATTAGCCACATGGGTTATTTTTTCAATCTGTG
 561 TTTTGAATTTTTTTATTGTGTGTTATTTAAAATATTACATATGCAGCTGGGAGAACTACACCTTTGTGCACATAGATTTA
 641 TATATTAATTTGTAGAAAATATTTTCTTTATATATTTCCTTACCATACAAGGTGCCTTGTTCATCAGGAAAACTTTTGTT
 721 TTGTATTTTGACAAGAAAGGCACCTTCAGAGTTTCTTTTTAAGTATAGTTGACAAGTGTATAAATGTTACACTTACTTTC
 801 AGAGTTCTTTTTAGATCTAAAGAAGTCAGTTCAAAAATGGAAATCAACAATGTTAGGAGAAATCTGAATTCTGTTAAGTT
 881 AGTAAGTATTATGTATAGCATCTGTTTTTAACCATTTCCATTCTTATCCCTAGTGTATCAGTTGATCACACTAAGAAAGC
 961 TTAAAGATTGAGCATTTGAAATAAATGCTCTTTATAAATGATTAGATTTTTGAAGGGATATTGAAATCATTGCGCTGTGA
1041 TTTCATCTGTGATGTGAAAAATCAATTTATTATCCTTGGTGCTTTCCCCCCCACCAATGCACAAATAATTGTGAACAGCT
1121 TGAAATGACTTAAACTGTAATCCAAATGGGACAATCTGATAAGAATTTCATGCATTGGTAGTTAAATAACTTAAATTGCT
1201 AAAGCTTTAGCTTGAAATTTATGTTTAGAAAAACTATTGATTTCCCATGGTATGAATATAACTATTGTAATTCTTCAAAT
1281 GAGACTCTTCTCACCTTAAATAGTCATATATTAATTAACTTATAGGAAATAAGCATACTATATGTTAGCTGTTTTAAAAG
1361 GTACCAGATGTAAGAGTCATAAATATATGCAATTAAAGAAGTTCATAGATTTCACATGAATGTAAATGTGTTATATGGAG
1441 ACATGTCTTGTAAACAGTTGAATGTATGTAAGTTTTCTGTTTGTGAAAATGTAGTTAATGTACTCACTGTGGAGGTCATA
1521 AGGAAGCTACTTTTTTTTTAAAGTGGAACCTAATTAAAATATTTCCAGAATCAAAGAGACTTAAATGGTAAATTTTTAAA
1601 ATTTTCTTATCTCTTACTTTTTAGTTTTCAAAGTAGAAAAAATCAGGAATTTTTTTATTAACTAGTACTTACATATTAAA
1681 TAAAATTTATTATTGGCTATATACATAGCAATATATTACTTTCCAAACTAGAAAGTACAGTACAACTAACTTTTTCCATT
1761 GTTATGCAAGAACTATTACTTTCCTGTAGTCACCAAACTCAGTAGTATTGCTCTGTAGACTAGACACTCTATTTGTAAAA
1841 ATCTTAGAATCACTTTCCAAAACAAATAAAAAGTCTACTGTATCAGAGCAAAATGTTATAGTTATCACTGTTTAGTGGCA
1921 GTTTGACTGAAGCATCTGTTTCTCACTTGATTCTGTCCTGAGAAGATGTGGGATTTTTTGGTTTTAAATACTAGAAGATA
2001 TTTCTTCTTAGAGCCCAGTCCTCCATCCCAAAGAGGTGAACTAGCCCAGCATGAAGAATTGTCTAGTCACCCTGAGATAT
2081 TAATCTTCATAATGTATTATTCAGTTCCTTCACCCTTAAAAGCCATATAATAGGCTCAGACCTAACTTAGCCCTTGAAGT
2161 CTAGTGCTGGCAGATTCTGCTGCCCTGGTTTAAATGAGTTACGTAGTCCATTCTCAAATACTAGCAAATTTGGGGGGCGT
2241 GGTACAGCAATTTTGGGTGAAGAAAAGTGTGCTGAACACCTTATGTCAGTGATAGACAAGATATAGAGGCTGAAGGGAAT
2321 ACAGTAAAGTAACAAAAACATGTGGCAGTGTGCTTAGCATAAACATAGAGCACAAAGGCAATAGATGGAAATTATGAGAG
2401 AAAAGTTAAAGTTCTTCAAGAAATATCCAATTAAAACTCACTAGCCAAGGAAAAAGTTTCTGTTTTCACCCGGATTTCTT
2481 TTTGGGTTGACTCTGTCTGACCTAAATGTCCACTGTTAACTAGTGCCATGCCAGTTTGAACCAAGATTTCACATTTTTGT
2561 TTTGTATTCATACTTTGGTAGAAATTTCTCAGTCTTTGTGTATTTATAAGAATTTGCTTTACACATAGTGTACAGTGTTT
2641 ATTAACTTTACATCATTTTATCCTTGCCTTACTATCTGGACAGTGTAGACTGCCTATATTCTTAGTTGGGGTTGGGATCT
2721 CTTCTCTTAGAGTGGCCCAGCAGTTTTAGCCCCTCTCTAATTCTCTTTTCCTGTGTTGGGAGATATCAAAACAACAGAAT
2801 TCTTGCCAGTGGGAACATTTTTCTTTTTTAGACAAGGTCTCATTCTGTCACCCCAGCTGGAGTGCAGTGGCACAGTCTTA
2881 ATTCACTACAGCCTTGAACTCCTGGGCTCAAGAAATCTTTCTGCTTCAGCCTCCTAAATAGCTGGTACTATAGGTGCGTG
2961 CCACCACACCCAGCTCATGGGAATAATTTTTACACTCCTTCAGAAGGAGTCATTTGTGATTGGAGTCCACATAGAAACAG
3041 GTTTCCCTCTGTACATAATCGTAGGTACCAAAATATTACTGTGTAAAGTGTTGTTTATATAGGTCAATTTTTGTGGAAGA
3121 TCTAATTTCTATTTTCAGAGAACAGAGCACATTAAAAAATCTATTTAGTATTGTGTACTATATAATCTATGTGAATTATA
3201 GCTCCTTAACTAAATATATTACTGAGTTTTTTTTTTAATACTGTAAGTTCTAGGGTACATGTGCACAATGTGCAGGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGGUAAUACACGACGau 5'
            ||: : || ||| ||||||  
Target 5' taCAGTGACA-TATATGCTGCaa 3'
490 - 511 135.00 -11.80
2
miRNA  3' guGUUUGGUAA--UACACGACGAu 5'
            :||| :|||  || ||| ||| 
Target 5' ttTAAAATATTACATATGCAGCTg 3'
586 - 609 134.00 -6.20
3
miRNA  3' guGUUUGGUAAUA--CACGACGAu 5'
            ||| ::|||||   || |||| 
Target 5' atCAATTTATTATCCTTGGTGCTt 3'
1061 - 1084 134.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30180537 9 COSMIC
COSN30153708 19 COSMIC
COSN14868629 45 COSMIC
COSN22439036 77 COSMIC
COSN31587819 81 COSMIC
COSN30606678 89 COSMIC
COSN30711761 92 COSMIC
COSN30136454 111 COSMIC
COSN30110631 191 COSMIC
COSN30135522 214 COSMIC
COSN30512192 266 COSMIC
COSN31539296 499 COSMIC
COSN30544724 568 COSMIC
COSN28202159 603 COSMIC
COSN26555067 607 COSMIC
COSN28781845 627 COSMIC
COSN7647121 743 COSMIC
COSN26387893 1024 COSMIC
COSN20482129 1172 COSMIC
COSN14790233 1418 COSMIC
COSN31547434 1441 COSMIC
COSN31579748 1515 COSMIC
COSN31540466 1540 COSMIC
COSN7852387 1559 COSMIC
COSN15806525 1922 COSMIC
COSN6852888 2389 COSMIC
COSN2055522 2409 COSMIC
COSN14736815 2867 COSMIC
COSN29198936 2876 COSMIC
COSN14833271 3032 COSMIC
COSN19568216 3868 COSMIC
COSN2055523 3986 COSMIC
COSN6852889 4139 COSMIC
COSN7852388 4143 COSMIC
COSN2055524 4206 COSMIC
COSN29221728 4780 COSMIC
COSN2055525 4867 COSMIC
COSN22925671 5266 COSMIC
COSN6852890 5331 COSMIC
COSN5066065 5334 COSMIC
COSN6852891 5382 COSMIC
COSN2055526 5435 COSMIC
COSN14781097 5959 COSMIC
COSN23186773 5960 COSMIC
COSN2055527 6005 COSMIC
COSN7852389 6092 COSMIC
COSN27603103 6398 COSMIC
COSN20551934 6457 COSMIC
COSN14752037 6544 COSMIC
COSN10039235 6817 COSMIC
COSN22797037 6821 COSMIC
COSN19323791 7086 COSMIC
COSN14785326 7829 COSMIC
COSN23239037 8145 COSMIC
COSN14788967 8359 COSMIC
COSN25693416 8661 COSMIC
COSN19096758 8758 COSMIC
COSN7852390 8875 COSMIC
COSN16458579 9668 COSMIC
COSN30217074 9767 COSMIC
COSN14795229 9860 COSMIC
COSN14791419 9968 COSMIC
COSN22111772 10611 COSMIC
COSN16762600 10862 COSMIC
COSN30379966 10938 COSMIC
rs116234738 23 GWAS
rs28061 6544 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782307779 5 dbSNP
rs1240794416 15 dbSNP
rs1182444648 17 dbSNP
rs782746450 21 dbSNP
rs1240593191 22 dbSNP
rs116234738 23 dbSNP
rs1339182043 29 dbSNP
rs964719907 30 dbSNP
rs782816534 31 dbSNP
rs1266238850 35 dbSNP
rs1247332110 38 dbSNP
rs781873551 39 dbSNP
rs1357366152 43 dbSNP
rs28025 45 dbSNP
rs201129870 46 dbSNP
rs573110967 54 dbSNP
rs1377490792 61 dbSNP
rs1330852537 63 dbSNP
rs1389434950 68 dbSNP
rs1395574284 69 dbSNP
rs1293743861 74 dbSNP
rs1426086506 84 dbSNP
rs1383014325 88 dbSNP
rs1162322197 89 dbSNP
rs373398415 97 dbSNP
rs115606785 106 dbSNP
rs1366023940 106 dbSNP
rs1180348242 112 dbSNP
rs955352482 114 dbSNP
rs987027329 121 dbSNP
rs1437597533 122 dbSNP
rs924473204 126 dbSNP
rs1225193313 134 dbSNP
rs1489904769 136 dbSNP
rs1291349034 139 dbSNP
rs782684171 151 dbSNP
rs541231271 155 dbSNP
rs1281193013 161 dbSNP
rs1236870644 162 dbSNP
rs564335470 163 dbSNP
rs1301642443 164 dbSNP
rs989873687 167 dbSNP
rs1406564440 172 dbSNP
rs138371974 180 dbSNP
rs1302189910 191 dbSNP
rs78345585 196 dbSNP
rs1044105479 200 dbSNP
rs1386572745 201 dbSNP
rs928871712 202 dbSNP
rs1470015217 203 dbSNP
rs79900077 211 dbSNP
rs563564129 213 dbSNP
rs184280703 214 dbSNP
rs1048342689 215 dbSNP
rs549179730 216 dbSNP
rs190395224 224 dbSNP
rs528620450 237 dbSNP
rs1037797851 238 dbSNP
rs1349801331 240 dbSNP
rs1263710181 247 dbSNP
rs1225084025 251 dbSNP
rs1343459799 254 dbSNP
rs1282226013 260 dbSNP
rs900628488 261 dbSNP
rs996572881 265 dbSNP
rs1327836342 270 dbSNP
rs879949528 290 dbSNP
rs773091934 301 dbSNP
rs1399640846 307 dbSNP
rs1403488452 309 dbSNP
rs746757979 320 dbSNP
rs1030362872 326 dbSNP
rs1179262578 335 dbSNP
rs1429102425 342 dbSNP
rs1194656368 368 dbSNP
rs1476478516 372 dbSNP
rs891016895 377 dbSNP
rs1192509617 380 dbSNP
rs192415891 385 dbSNP
rs1008163166 392 dbSNP
rs1263654497 394 dbSNP
rs551598828 403 dbSNP
rs868936723 412 dbSNP
rs1205546281 415 dbSNP
rs75011365 416 dbSNP
rs12332086 419 dbSNP
rs1340980363 420 dbSNP
rs989821480 424 dbSNP
rs549736144 429 dbSNP
rs1339254903 441 dbSNP
rs1451188308 448 dbSNP
rs1406005092 455 dbSNP
rs535692155 461 dbSNP
rs574310863 462 dbSNP
rs928345138 471 dbSNP
rs1417595362 474 dbSNP
rs938909562 478 dbSNP
rs1167605757 484 dbSNP
rs1473158504 486 dbSNP
rs1245113257 488 dbSNP
rs983717176 491 dbSNP
rs1459881328 493 dbSNP
rs1242429067 495 dbSNP
rs535455573 503 dbSNP
rs1439295749 507 dbSNP
rs908008983 510 dbSNP
rs1213561926 512 dbSNP
rs1359536817 513 dbSNP
rs1316615722 524 dbSNP
rs1243114742 526 dbSNP
rs1382756133 530 dbSNP
rs1299206424 536 dbSNP
rs1444845241 543 dbSNP
rs555455672 551 dbSNP
rs1037906811 555 dbSNP
rs1406242378 558 dbSNP
rs1387299516 564 dbSNP
rs1161806008 577 dbSNP
rs1444052994 581 dbSNP
rs1384565673 590 dbSNP
rs900574563 597 dbSNP
rs1481499095 601 dbSNP
rs372871465 603 dbSNP
rs1203548117 609 dbSNP
rs782499136 612 dbSNP
rs1490426840 623 dbSNP
rs184583231 624 dbSNP
rs1219662796 633 dbSNP
rs1358048494 649 dbSNP
rs1308359199 661 dbSNP
rs1225910766 669 dbSNP
rs1371808525 679 dbSNP
rs1279399585 685 dbSNP
rs1405908736 686 dbSNP
rs558033551 714 dbSNP
rs1367732162 718 dbSNP
rs1301481251 722 dbSNP
rs1424120588 724 dbSNP
rs1361180560 727 dbSNP
rs1052174543 736 dbSNP
rs776486363 741 dbSNP
rs1420875516 752 dbSNP
rs114647946 766 dbSNP
rs543315133 768 dbSNP
rs1480620064 775 dbSNP
rs1270628247 778 dbSNP
rs1196767422 782 dbSNP
rs1490045659 791 dbSNP
rs1260875626 801 dbSNP
rs1031550669 808 dbSNP
rs1217295029 810 dbSNP
rs1315712897 820 dbSNP
rs1284143467 824 dbSNP
rs1224541688 828 dbSNP
rs1347717807 838 dbSNP
rs554589389 841 dbSNP
rs1404488887 847 dbSNP
rs1362911561 849 dbSNP
rs1290764767 858 dbSNP
rs1011359202 865 dbSNP
rs1021444670 876 dbSNP
rs1158272257 879 dbSNP
rs1470138001 881 dbSNP
rs574104348 889 dbSNP
rs1431073481 894 dbSNP
rs1197011843 897 dbSNP
rs146030344 899 dbSNP
rs1261969025 914 dbSNP
rs1187804275 915 dbSNP
rs1484584357 921 dbSNP
rs373047661 926 dbSNP
rs1035736424 934 dbSNP
rs1326106450 941 dbSNP
rs1261729862 942 dbSNP
rs959742472 946 dbSNP
rs543015895 953 dbSNP
rs1308348468 959 dbSNP
rs1297951058 968 dbSNP
rs983664623 975 dbSNP
rs1380632029 976 dbSNP
rs1361293917 984 dbSNP
rs782740875 987 dbSNP
rs908116326 989 dbSNP
rs114793374 991 dbSNP
rs1408195443 1001 dbSNP
rs1174059404 1020 dbSNP
rs1465333697 1027 dbSNP
rs1373322681 1029 dbSNP
rs533496455 1034 dbSNP
rs922140127 1035 dbSNP
rs1183662475 1037 dbSNP
rs563072358 1038 dbSNP
rs1241808362 1048 dbSNP
rs932029226 1050 dbSNP
rs545175079 1055 dbSNP
rs1481138409 1064 dbSNP
rs1253314279 1067 dbSNP
rs890410009 1070 dbSNP
rs935333681 1083 dbSNP
rs781961210 1086 dbSNP
rs553472501 1088 dbSNP
rs1248237519 1092 dbSNP
rs1334559977 1093 dbSNP
rs891703698 1093 dbSNP
rs531151576 1094 dbSNP
rs578222277 1095 dbSNP
rs1460208637 1098 dbSNP
rs1369540222 1106 dbSNP
rs189197424 1110 dbSNP
rs905709760 1112 dbSNP
rs1383950932 1145 dbSNP
rs1001659274 1149 dbSNP
rs1420057617 1153 dbSNP
rs1253195316 1164 dbSNP
rs1035447509 1170 dbSNP
rs782045204 1171 dbSNP
rs1224859593 1175 dbSNP
rs1357309843 1176 dbSNP
rs1312848923 1178 dbSNP
rs1004537977 1179 dbSNP
rs1243886377 1184 dbSNP
rs1014620856 1187 dbSNP
rs1308951726 1189 dbSNP
rs963599053 1197 dbSNP
rs782796861 1199 dbSNP
rs139835557 1205 dbSNP
rs922057996 1206 dbSNP
rs1363093470 1212 dbSNP
rs1162127320 1220 dbSNP
rs1454817545 1225 dbSNP
rs1366038205 1234 dbSNP
rs1180157214 1237 dbSNP
rs1472446434 1239 dbSNP
rs1269896394 1241 dbSNP
rs1201788485 1245 dbSNP
rs953572484 1249 dbSNP
rs782511766 1266 dbSNP
rs181525080 1267 dbSNP
rs1205773235 1279 dbSNP
rs980397439 1284 dbSNP
rs1262384408 1286 dbSNP
rs1236648325 1289 dbSNP
rs1349592302 1295 dbSNP
rs1283536895 1297 dbSNP
rs1406464901 1301 dbSNP
rs1343244167 1304 dbSNP
rs935449532 1319 dbSNP
rs1322361704 1323 dbSNP
rs1382269322 1325 dbSNP
rs1387814728 1337 dbSNP
rs1052370159 1339 dbSNP
rs141517487 1341 dbSNP
rs947278773 1345 dbSNP
rs565781075 1347 dbSNP
rs1457056930 1354 dbSNP
rs1430337121 1360 dbSNP
rs1042988291 1361 dbSNP
rs146222656 1372 dbSNP
rs1246319719 1388 dbSNP
rs1194038927 1389 dbSNP
rs1448766951 1402 dbSNP
rs8488 1418 dbSNP
rs1057387170 1423 dbSNP
rs895548697 1445 dbSNP
rs571323841 1453 dbSNP
rs17297682 1460 dbSNP
rs1225095673 1463 dbSNP
rs148435133 1467 dbSNP
rs1273838636 1486 dbSNP
rs1430852984 1501 dbSNP
rs963046619 1502 dbSNP
rs995046466 1519 dbSNP
rs1327616493 1529 dbSNP
rs1316851254 1530 dbSNP
rs1407457344 1531 dbSNP
rs1435092737 1531 dbSNP
rs1339158991 1540 dbSNP
rs1029241790 1550 dbSNP
rs953795266 1554 dbSNP
rs1468533905 1555 dbSNP
rs1424758264 1566 dbSNP
rs987645621 1581 dbSNP
rs1476437042 1582 dbSNP
rs1371479554 1586 dbSNP
rs1187993957 1593 dbSNP
rs751990333 1598 dbSNP
rs114247847 1599 dbSNP
rs1205368644 1607 dbSNP
rs7446037 1617 dbSNP
rs1277494931 1630 dbSNP
rs915208860 1631 dbSNP
rs1341032359 1633 dbSNP
rs1294839918 1637 dbSNP
rs1226996861 1650 dbSNP
rs1384233232 1663 dbSNP
rs1317722960 1683 dbSNP
rs77318576 1692 dbSNP
rs189819546 1700 dbSNP
rs180903482 1701 dbSNP
rs1411924967 1702 dbSNP
rs3776844 1704 dbSNP
rs529152043 1705 dbSNP
rs1168084586 1706 dbSNP
rs185899880 1712 dbSNP
rs1185285308 1713 dbSNP
rs1056942678 1714 dbSNP
rs544801070 1721 dbSNP
rs895664121 1739 dbSNP
rs1204941905 1744 dbSNP
rs940386703 1745 dbSNP
rs76618416 1749 dbSNP
rs1203844818 1751 dbSNP
rs34209638 1751 dbSNP
rs1359471538 1754 dbSNP
rs1317789696 1759 dbSNP
rs1227175482 1762 dbSNP
rs1379067011 1767 dbSNP
rs530473969 1768 dbSNP
rs1280560796 1772 dbSNP
rs756564058 1776 dbSNP
rs1348898857 1783 dbSNP
rs1307599001 1788 dbSNP
rs1425399574 1789 dbSNP
rs1367457691 1794 dbSNP
rs1161739580 1801 dbSNP
rs1403588571 1802 dbSNP
rs1412949278 1804 dbSNP
rs994502936 1826 dbSNP
rs1180928211 1830 dbSNP
rs1029107732 1832 dbSNP
rs780230235 1833 dbSNP
rs1293393159 1836 dbSNP
rs1218720800 1847 dbSNP
rs1321690489 1849 dbSNP
rs1285530080 1850 dbSNP
rs1225856955 1852 dbSNP
rs1327454723 1854 dbSNP
rs1287970811 1867 dbSNP
rs1405850266 1870 dbSNP
rs1347605510 1871 dbSNP
rs1291909952 1878 dbSNP
rs1435809021 1881 dbSNP
rs1349254126 1888 dbSNP
rs1159676905 1893 dbSNP
rs1402244183 1900 dbSNP
rs1409402264 1902 dbSNP
rs1158135386 1905 dbSNP
rs1480588980 1919 dbSNP
rs72768671 1936 dbSNP
rs1188985505 1945 dbSNP
rs114563406 1955 dbSNP
rs539257426 1956 dbSNP
rs1243213602 1958 dbSNP
rs1218479155 1980 dbSNP
rs1327699237 1986 dbSNP
rs113117658 1994 dbSNP
rs1224483132 1995 dbSNP
rs956877822 2008 dbSNP
rs1325974114 2028 dbSNP
rs1299414677 2030 dbSNP
rs1218740354 2033 dbSNP
rs1362675906 2036 dbSNP
rs1289376216 2049 dbSNP
rs1437265543 2051 dbSNP
rs551446905 2052 dbSNP
rs1319694270 2053 dbSNP
rs1470091586 2058 dbSNP
rs1379030319 2064 dbSNP
rs1173447877 2066 dbSNP
rs1432099367 2070 dbSNP
rs1419696866 2078 dbSNP
rs1187748913 2089 dbSNP
rs1463972470 2090 dbSNP
rs1247917203 2126 dbSNP
rs1204745345 2128 dbSNP
rs1462893313 2130 dbSNP
rs116466461 2140 dbSNP
rs1209597265 2146 dbSNP
rs1308293153 2147 dbSNP
rs192036235 2151 dbSNP
rs782359387 2153 dbSNP
rs968138203 2155 dbSNP
rs1226239606 2159 dbSNP
rs1362989797 2172 dbSNP
rs371380462 2173 dbSNP
rs1296725295 2175 dbSNP
rs1453120555 2187 dbSNP
rs781952293 2203 dbSNP
rs926635223 2204 dbSNP
rs1354729736 2205 dbSNP
rs1169978474 2219 dbSNP
rs1447088610 2222 dbSNP
rs937244351 2224 dbSNP
rs1390125368 2229 dbSNP
rs782197289 2234 dbSNP
rs917046604 2236 dbSNP
rs1254592782 2237 dbSNP
rs1200221122 2239 dbSNP
rs116028456 2240 dbSNP
rs1036227893 2244 dbSNP
rs1203142294 2263 dbSNP
rs1341476639 2289 dbSNP
rs551458919 2295 dbSNP
rs1273835377 2299 dbSNP
rs1246709203 2315 dbSNP
rs1342182969 2318 dbSNP
rs898900250 2325 dbSNP
rs1373645675 2340 dbSNP
rs1395204866 2340 dbSNP
rs1309417005 2351 dbSNP
rs930414641 2356 dbSNP
rs1369322604 2357 dbSNP
rs536175118 2366 dbSNP
rs879977531 2378 dbSNP
rs1050073045 2388 dbSNP
rs888795010 2390 dbSNP
rs1459948458 2394 dbSNP
rs1009118221 2401 dbSNP
rs1367205875 2403 dbSNP
rs1187324972 2426 dbSNP
rs1420002644 2431 dbSNP
rs1254266213 2445 dbSNP
rs1180203108 2447 dbSNP
rs1019159627 2448 dbSNP
rs892760559 2449 dbSNP
rs1269766016 2453 dbSNP
rs1224790215 2456 dbSNP
rs552863798 2457 dbSNP
rs1263562741 2458 dbSNP
rs1243822768 2461 dbSNP
rs782302764 2462 dbSNP
rs1317231255 2465 dbSNP
rs572875213 2473 dbSNP
rs538650397 2474 dbSNP
rs558743558 2475 dbSNP
rs1303281664 2483 dbSNP
rs1387970031 2485 dbSNP
rs151092745 2489 dbSNP
rs1163131168 2496 dbSNP
rs1454636005 2502 dbSNP
rs544478202 2509 dbSNP
rs1472416217 2511 dbSNP
rs1430205894 2515 dbSNP
rs1201133847 2517 dbSNP
rs1449887675 2529 dbSNP
rs1265198986 2531 dbSNP
rs1209095774 2536 dbSNP
rs1033650996 2542 dbSNP
rs1465286259 2546 dbSNP
rs960991924 2553 dbSNP
rs879959578 2554 dbSNP
rs1328089474 2565 dbSNP
rs992209964 2579 dbSNP
rs1234804796 2583 dbSNP
rs797026252 2586 dbSNP
rs917161028 2589 dbSNP
rs1328786609 2593 dbSNP
rs940615382 2595 dbSNP
rs971875512 2607 dbSNP
rs920447487 2611 dbSNP
rs1383328838 2628 dbSNP
rs930382341 2629 dbSNP
rs879963414 2633 dbSNP
rs1319014604 2641 dbSNP
rs1050609452 2649 dbSNP
rs1430269393 2650 dbSNP
rs910180567 2651 dbSNP
rs1477084075 2663 dbSNP
rs1377202353 2669 dbSNP
rs1193971944 2672 dbSNP
rs778947293 2675 dbSNP
rs1450059304 2678 dbSNP
rs1206617105 2683 dbSNP
rs1464229569 2687 dbSNP
rs1278901141 2690 dbSNP
rs77547874 2691 dbSNP
rs199552841 2701 dbSNP
rs138046637 2702 dbSNP
rs374663099 2702 dbSNP
rs1368011033 2703 dbSNP
rs32861 2703 dbSNP
rs1040050389 2707 dbSNP
rs111821235 2709 dbSNP
rs1434843046 2711 dbSNP
rs200424055 2729 dbSNP
rs79053354 2729 dbSNP
rs575018699 2731 dbSNP
rs1413035867 2732 dbSNP
rs1401737988 2740 dbSNP
rs1168606747 2751 dbSNP
rs1431655267 2752 dbSNP
rs1391966848 2755 dbSNP
rs1186526636 2757 dbSNP
rs1448791873 2762 dbSNP
rs78235495 2778 dbSNP
rs1189334497 2802 dbSNP
rs1440378770 2816 dbSNP
rs1277432316 2822 dbSNP
rs1205280555 2832 dbSNP
rs1343604600 2836 dbSNP
rs1273112186 2838 dbSNP
rs1380508115 2840 dbSNP
rs1043845687 2843 dbSNP
rs1286371481 2865 dbSNP
rs879986756 2865 dbSNP
rs183126457 2866 dbSNP
rs28062 2867 dbSNP
rs1329724024 2868 dbSNP
rs1431713999 2869 dbSNP
rs1168028358 2871 dbSNP
rs1368870457 2871 dbSNP
rs1034175139 2872 dbSNP
rs2033228 2877 dbSNP
rs1164817623 2881 dbSNP
rs1236545900 2892 dbSNP
rs1471658995 2892 dbSNP
rs1182364653 2893 dbSNP
rs1483827333 2904 dbSNP
rs1249058438 2907 dbSNP
rs1013576855 2913 dbSNP
rs1292594142 2916 dbSNP
rs1226980138 2919 dbSNP
rs1356009948 2922 dbSNP
rs1015624004 2924 dbSNP
rs367884382 2925 dbSNP
rs1348838099 2932 dbSNP
rs1307546174 2934 dbSNP
rs1350424276 2951 dbSNP
rs2033229 2953 dbSNP
rs781964803 2957 dbSNP
rs1412880172 2958 dbSNP
rs971989999 2959 dbSNP
rs530656936 2960 dbSNP
rs1409271599 2964 dbSNP
rs1180864059 2965 dbSNP
rs1488492341 2968 dbSNP
rs1248971551 2970 dbSNP
rs1220092303 2972 dbSNP
rs951975645 2978 dbSNP
rs986022798 2979 dbSNP
rs1451525547 2984 dbSNP
rs782091988 2995 dbSNP
rs1230594416 3006 dbSNP
rs1287912774 3008 dbSNP
rs1219898099 3016 dbSNP
rs1369731399 3020 dbSNP
rs1291849817 3021 dbSNP
rs1434284072 3026 dbSNP
rs1393613362 3027 dbSNP
rs1321023478 3030 dbSNP
rs26817 3032 dbSNP
rs1386025228 3045 dbSNP
rs1157874345 3052 dbSNP
rs1433406959 3053 dbSNP
rs1426732515 3056 dbSNP
rs781795023 3061 dbSNP
rs1478013858 3062 dbSNP
rs1211000027 3073 dbSNP
rs1463782660 3081 dbSNP
rs762316601 3086 dbSNP
rs768366499 3101 dbSNP
rs1267745659 3110 dbSNP
rs913582708 3116 dbSNP
rs1314147524 3121 dbSNP
rs1299341565 3124 dbSNP
rs1218689061 3148 dbSNP
rs1370197756 3152 dbSNP
rs1298181608 3154 dbSNP
rs567419922 3158 dbSNP
rs1437022774 3181 dbSNP
rs26816 3188 dbSNP
rs1288060156 3192 dbSNP
rs1466277588 3196 dbSNP
rs144628204 3197 dbSNP
rs374037456 3197 dbSNP
rs1173387295 3207 dbSNP
rs1433510095 3208 dbSNP
rs1190985562 3227 dbSNP
rs1391342973 3227 dbSNP
rs1448197645 3227 dbSNP
rs904142451 3227 dbSNP
rs1002773759 3228 dbSNP
rs1182777530 3229 dbSNP
rs1484382640 3237 dbSNP
rs1254442940 3238 dbSNP
rs782788692 3247 dbSNP
rs761550750 3251 dbSNP
rs1276862520 3254 dbSNP
rs781872918 3266 dbSNP
rs1013697770 3272 dbSNP
rs768049588 3277 dbSNP
rs1396357338 3284 dbSNP
rs1015576555 3286 dbSNP
rs546443318 3287 dbSNP
rs1413638508 3297 dbSNP
rs1370705250 3299 dbSNP
rs1169920641 3300 dbSNP
rs186202834 3306 dbSNP
rs1372973199 3309 dbSNP
rs1165965536 3313 dbSNP
rs1425872796 3314 dbSNP
rs993376867 3329 dbSNP
rs1181431594 3361 dbSNP
rs1483498396 3363 dbSNP
rs1203071504 3370 dbSNP
rs1027983833 3374 dbSNP
rs1250646933 3376 dbSNP
rs190680219 3377 dbSNP
rs1323223385 3378 dbSNP
rs1310303345 3379 dbSNP
rs986355977 3381 dbSNP
rs538639745 3390 dbSNP
rs1407410539 3394 dbSNP
rs1396441050 3396 dbSNP
rs558959661 3399 dbSNP
rs879950112 3402 dbSNP
rs112920338 3407 dbSNP
rs1459771737 3408 dbSNP
rs965738966 3412 dbSNP
rs111947655 3413 dbSNP
rs115226354 3420 dbSNP
rs1180140063 3425 dbSNP
rs1437261194 3426 dbSNP
rs1249741291 3431 dbSNP
rs1210432748 3437 dbSNP
rs575038221 3445 dbSNP
rs1263504428 3449 dbSNP
rs1212801767 3454 dbSNP
rs540836568 3456 dbSNP
rs1226056116 3459 dbSNP
rs1334589634 3461 dbSNP
rs1301354537 3468 dbSNP
rs945040384 3470 dbSNP
rs540086517 3471 dbSNP
rs925511598 3472 dbSNP
rs1325687277 3478 dbSNP
rs34813651 3484 dbSNP
rs386690654 3491 dbSNP
rs577656441 3492 dbSNP
rs544655952 3493 dbSNP
rs1469817001 3496 dbSNP
rs761283797 3498 dbSNP
rs1434874820 3502 dbSNP
rs1251014435 3509 dbSNP
rs564929108 3514 dbSNP
rs530439145 3522 dbSNP
rs1212859600 3525 dbSNP
rs1465134862 3536 dbSNP
rs1269630406 3539 dbSNP
rs782616955 3540 dbSNP
rs1234730959 3545 dbSNP
rs200483370 3545 dbSNP
rs182854640 3548 dbSNP
rs897283956 3552 dbSNP
rs995500017 3560 dbSNP
rs1303244562 3561 dbSNP
rs1027016456 3563 dbSNP
rs1367881110 3570 dbSNP
rs1318946382 3572 dbSNP
rs887673238 3573 dbSNP
rs578212946 3574 dbSNP
rs1403140983 3576 dbSNP
rs1174416260 3581 dbSNP
rs1464562900 3582 dbSNP
rs753965336 3588 dbSNP
rs1017821153 3590 dbSNP
rs1449998623 3601 dbSNP
rs1249720923 3605 dbSNP
rs560823596 3606 dbSNP
rs529798318 3610 dbSNP
rs1256363803 3627 dbSNP
rs1201689823 3629 dbSNP
rs975926492 3631 dbSNP
rs1345038590 3632 dbSNP
rs1278993057 3640 dbSNP
rs1229863952 3641 dbSNP
rs1020651409 3660 dbSNP
rs1344904673 3663 dbSNP
rs966459869 3672 dbSNP
rs546431336 3673 dbSNP
rs924988050 3679 dbSNP
rs1394368114 3680 dbSNP
rs566427224 3689 dbSNP
rs938235792 3693 dbSNP
rs991097105 3694 dbSNP
rs1169285472 3702 dbSNP
rs1430378015 3707 dbSNP
rs375312475 3709 dbSNP
rs918041660 3710 dbSNP
rs1165962693 3713 dbSNP
rs1474927376 3715 dbSNP
rs1237704505 3716 dbSNP
rs141574201 3718 dbSNP
rs569201854 3727 dbSNP
rs1256254582 3730 dbSNP
rs1205210891 3734 dbSNP
rs897231688 3735 dbSNP
rs1484339555 3738 dbSNP
rs1271437331 3751 dbSNP
rs931409885 3771 dbSNP
rs1048851224 3780 dbSNP
rs1231749164 3781 dbSNP
rs1355034821 3791 dbSNP
rs1308748254 3795 dbSNP
rs1411685055 3799 dbSNP
rs1372347309 3805 dbSNP
rs147041859 3811 dbSNP
rs1409300074 3816 dbSNP
rs566869843 3820 dbSNP
rs555004680 3821 dbSNP
rs1414335784 3822 dbSNP
rs754948414 3827 dbSNP
rs115723897 3829 dbSNP
rs1474046537 3830 dbSNP
rs901801074 3832 dbSNP
rs997288942 3834 dbSNP
rs1020764445 3836 dbSNP
rs966408778 3849 dbSNP
rs979216012 3857 dbSNP
rs1204516325 3859 dbSNP
rs1452680156 3869 dbSNP
rs147657777 3870 dbSNP
rs188016914 3886 dbSNP
rs1289160255 3887 dbSNP
rs990934131 3901 dbSNP
rs918166153 3902 dbSNP
rs1279023062 3910 dbSNP
rs1441456046 3926 dbSNP
rs970997859 3930 dbSNP
rs577595737 3932 dbSNP
rs972879039 3937 dbSNP
rs1327701411 3941 dbSNP
rs1459629074 3952 dbSNP
rs1393291945 3953 dbSNP
rs1159353554 3954 dbSNP
rs1473365116 3959 dbSNP
rs1405235749 3982 dbSNP
rs1176100199 3984 dbSNP
rs1478665864 4008 dbSNP
rs782215236 4009 dbSNP
rs1192161291 4012 dbSNP
rs782453655 4015 dbSNP
rs782285961 4017 dbSNP
rs1048475258 4020 dbSNP
rs1315330025 4021 dbSNP
rs1283706225 4024 dbSNP
rs546442677 4027 dbSNP
rs1219850538 4032 dbSNP
rs192820657 4033 dbSNP
rs1305457912 4034 dbSNP
rs1438443917 4038 dbSNP
rs114106871 4042 dbSNP
rs901747030 4043 dbSNP
rs1320962376 4047 dbSNP
rs149166818 4049 dbSNP
rs1343041314 4061 dbSNP
rs1157762603 4063 dbSNP
rs1042172967 4069 dbSNP
rs115751037 4096 dbSNP
rs1172392531 4106 dbSNP
rs1454212727 4107 dbSNP
rs529787769 4116 dbSNP
rs1485035529 4122 dbSNP
rs1241691010 4123 dbSNP
rs369312519 4126 dbSNP
rs1032092563 4130 dbSNP
rs1232065807 4139 dbSNP
rs143264078 4154 dbSNP
rs1347029369 4168 dbSNP
rs1298114889 4175 dbSNP
rs77810252 4181 dbSNP
rs1287858780 4182 dbSNP
rs532193266 4184 dbSNP
rs1376810375 4195 dbSNP
rs1011902772 4201 dbSNP
rs10045864 4213 dbSNP
rs1434687813 4233 dbSNP
rs1391286796 4234 dbSNP
rs539965857 4244 dbSNP
rs1427045680 4245 dbSNP
rs1419074861 4247 dbSNP
rs1182726147 4249 dbSNP
rs972993628 4259 dbSNP
rs918718051 4263 dbSNP
rs781940131 4266 dbSNP
rs984729316 4268 dbSNP
rs1210213233 4271 dbSNP
rs1485321557 4272 dbSNP
rs1275196678 4279 dbSNP
rs1229346651 4281 dbSNP
rs1305620870 4283 dbSNP
rs911296951 4289 dbSNP
rs1294570603 4299 dbSNP
rs942800981 4301 dbSNP
rs1356943913 4302 dbSNP
rs1310583076 4306 dbSNP
rs1413580768 4308 dbSNP
rs1040997867 4311 dbSNP
rs1300344831 4318 dbSNP
rs1460912481 4330 dbSNP
rs922616945 4333 dbSNP
rs1165899560 4353 dbSNP
rs933203086 4359 dbSNP
rs1187338916 4360 dbSNP
rs1472920862 4370 dbSNP
rs561695816 4376 dbSNP
rs1197544444 4378 dbSNP
rs531719154 4379 dbSNP
rs1221982023 4397 dbSNP
rs1336527304 4400 dbSNP
rs1291000768 4413 dbSNP
rs1232150891 4417 dbSNP
rs1350642943 4427 dbSNP
rs1308499495 4431 dbSNP
rs1000698908 4433 dbSNP
rs782229943 4437 dbSNP
rs1294520194 4443 dbSNP
rs1463298438 4445 dbSNP
rs1392559862 4456 dbSNP
rs375246887 4457 dbSNP
rs548338584 4460 dbSNP
rs1054058242 4461 dbSNP
rs568542386 4467 dbSNP
rs113196106 4471 dbSNP
rs182644767 4480 dbSNP
rs906200213 4482 dbSNP
rs1249678748 4488 dbSNP
rs993871812 4532 dbSNP
rs554322057 4533 dbSNP
rs1469592531 4535 dbSNP
rs1212743183 4536 dbSNP
rs576516649 4538 dbSNP
rs1236201446 4540 dbSNP
rs782779306 4544 dbSNP
rs1302514116 4548 dbSNP
rs1443744983 4556 dbSNP
rs1369318331 4559 dbSNP
rs546008232 4577 dbSNP
rs1436143678 4593 dbSNP
rs1387367553 4596 dbSNP
rs1156923333 4597 dbSNP
rs148046954 4600 dbSNP
rs1363165183 4606 dbSNP
rs1174253572 4614 dbSNP
rs1018874267 4619 dbSNP
rs1250958633 4621 dbSNP
rs375619468 4648 dbSNP
rs868911524 4650 dbSNP
rs80203988 4651 dbSNP
rs1263341968 4657 dbSNP
rs1202869707 4659 dbSNP
rs1349413958 4660 dbSNP
rs1280404688 4664 dbSNP
rs369919281 4666 dbSNP
rs922567966 4667 dbSNP
rs1303172491 4672 dbSNP
rs1229538111 4673 dbSNP
rs1328443096 4684 dbSNP
rs1316414129 4686 dbSNP
rs769788575 4690 dbSNP
rs1381855528 4691 dbSNP
rs141730707 4692 dbSNP
rs1436545074 4692 dbSNP
rs779793382 4692 dbSNP
rs977429306 4693 dbSNP
rs923869781 4694 dbSNP
rs1172804451 4698 dbSNP
rs748832461 4701 dbSNP
rs1053603094 4703 dbSNP
rs187729952 4715 dbSNP
rs894985852 4716 dbSNP
rs1257654024 4721 dbSNP
rs1212357869 4741 dbSNP
rs947752418 4747 dbSNP
rs1484991673 4749 dbSNP
rs768115614 4750 dbSNP
rs1280177175 4753 dbSNP
rs1046176532 4754 dbSNP
rs906314210 4766 dbSNP
rs1341998232 4768 dbSNP
rs562539464 4793 dbSNP
rs1227027056 4798 dbSNP
rs1341259084 4799 dbSNP
rs993820916 4800 dbSNP
rs1295230983 4804 dbSNP
rs544193418 4808 dbSNP
rs1312128723 4811 dbSNP
rs1410452431 4814 dbSNP
rs1398427767 4816 dbSNP
rs1165910110 4820 dbSNP
rs888678713 4821 dbSNP
rs1474896937 4824 dbSNP
rs1418067484 4825 dbSNP
rs1189466032 4831 dbSNP
rs1473903441 4834 dbSNP
rs1256193392 4835 dbSNP
rs1205896525 4837 dbSNP
rs1440034439 4840 dbSNP
rs1271371209 4865 dbSNP
rs1195549230 4873 dbSNP
rs1335752464 4876 dbSNP
rs1231535731 4885 dbSNP
rs1354975348 4887 dbSNP
rs554173661 4888 dbSNP
rs1006226935 4890 dbSNP
rs574181114 4891 dbSNP
rs562490703 4894 dbSNP
rs1337418529 4896 dbSNP
rs1326628707 4906 dbSNP
rs1409093873 4916 dbSNP
rs191356107 4923 dbSNP
rs964561742 4925 dbSNP
rs185017750 4933 dbSNP
rs369513676 4935 dbSNP
rs976929956 4936 dbSNP
rs1416595639 4939 dbSNP
rs1177246522 4948 dbSNP
rs559839430 4956 dbSNP
rs532291035 4957 dbSNP
rs967467085 4960 dbSNP
rs1181559830 4966 dbSNP
rs782711742 4967 dbSNP
rs551197334 4968 dbSNP
rs1212109430 4970 dbSNP
rs545717004 4976 dbSNP
rs1334403526 4988 dbSNP
rs1285083014 4989 dbSNP
rs1225488289 4993 dbSNP
rs1352764886 5006 dbSNP
rs1277628778 5014 dbSNP
rs1445944811 5017 dbSNP
rs989812340 5018 dbSNP
rs1371527509 5024 dbSNP
rs1327650251 5026 dbSNP
rs114528539 5031 dbSNP
rs1393230571 5041 dbSNP
rs947860351 5047 dbSNP
rs1159228159 5057 dbSNP
rs1401882987 5064 dbSNP
rs1046291624 5074 dbSNP
rs79006501 5075 dbSNP
rs113779221 5079 dbSNP
rs1455074547 5088 dbSNP
rs1255330113 5092 dbSNP
rs34134685 5093 dbSNP
rs1046697145 5095 dbSNP
rs1468221148 5112 dbSNP
rs548585220 5132 dbSNP
rs782659961 5135 dbSNP
rs1005761657 5137 dbSNP
rs1040359701 5139 dbSNP
rs370123478 5146 dbSNP
rs998298610 5157 dbSNP
rs1348470609 5158 dbSNP
rs1029811344 5169 dbSNP
rs967412941 5173 dbSNP
rs1366488993 5181 dbSNP
rs998908972 5193 dbSNP
rs1032980454 5209 dbSNP
rs1432456314 5214 dbSNP
rs1342987244 5215 dbSNP
rs1435918259 5224 dbSNP
rs1397373963 5239 dbSNP
rs1172176816 5248 dbSNP
rs771818707 5256 dbSNP
rs576326869 5257 dbSNP
rs1420660546 5258 dbSNP
rs1188561989 5264 dbSNP
rs991538130 5276 dbSNP
rs1211642009 5285 dbSNP
rs1485972831 5286 dbSNP
rs1282312021 5290 dbSNP
rs1208474078 5291 dbSNP
rs1311459624 5306 dbSNP
rs916470022 5309 dbSNP
rs969316740 5333 dbSNP
rs981917791 5340 dbSNP
rs11744885 5341 dbSNP
rs929675767 5342 dbSNP
rs1277044326 5346 dbSNP
rs1414803812 5351 dbSNP
rs1377803327 5353 dbSNP
rs1311662287 5381 dbSNP
rs1465965550 5384 dbSNP
rs1355526351 5390 dbSNP
rs527707292 5393 dbSNP
rs1172943555 5395 dbSNP
rs1047252789 5398 dbSNP
rs1426998804 5401 dbSNP
rs1423129182 5406 dbSNP
rs1188765790 5414 dbSNP
rs1476191220 5416 dbSNP
rs547864580 5417 dbSNP
rs1185791557 5429 dbSNP
rs570967394 5435 dbSNP
rs1251714307 5441 dbSNP
rs909670521 5446 dbSNP
rs527759444 5450 dbSNP
rs782617340 5469 dbSNP
rs1233514882 5479 dbSNP
rs1356876269 5481 dbSNP
rs941017451 5487 dbSNP
rs1039401651 5491 dbSNP
rs1374644403 5502 dbSNP
rs1300293423 5503 dbSNP
rs1460736815 5509 dbSNP
rs1399845973 5511 dbSNP
rs1166013335 5513 dbSNP
rs1463200063 5515 dbSNP
rs1415835439 5520 dbSNP
rs189462518 5522 dbSNP
rs760891385 5524 dbSNP
rs1251082538 5525 dbSNP
rs782315611 5544 dbSNP
rs77193773 5545 dbSNP
rs1479573580 5552 dbSNP
rs1237324518 5563 dbSNP
rs1213981751 5573 dbSNP
rs903369568 5582 dbSNP
rs1336446528 5587 dbSNP
rs998912559 5588 dbSNP
rs192323198 5594 dbSNP
rs754371045 5596 dbSNP
rs957505119 5597 dbSNP
rs1318066871 5613 dbSNP
rs535808135 5617 dbSNP
rs1390167542 5620 dbSNP
rs185129727 5626 dbSNP
rs1376704496 5627 dbSNP
rs1326971352 5630 dbSNP
rs782282936 5636 dbSNP
rs1162751697 5638 dbSNP
rs1454313592 5643 dbSNP
rs567614057 5647 dbSNP
rs982030908 5648 dbSNP
rs1437722452 5655 dbSNP
rs1379495002 5665 dbSNP
rs927741619 5676 dbSNP
rs1469556282 5678 dbSNP
rs574069484 5682 dbSNP
rs982672070 5687 dbSNP
rs1208732097 5713 dbSNP
rs909612377 5718 dbSNP
rs1485949379 5722 dbSNP
rs782392996 5730 dbSNP
rs1261960652 5737 dbSNP
rs1237590202 5740 dbSNP
rs1353579002 5744 dbSNP
rs1304670187 5746 dbSNP
rs1236877567 5750 dbSNP
rs781985739 5754 dbSNP
rs920942850 5760 dbSNP
rs934211622 5767 dbSNP
rs1323217074 5768 dbSNP
rs1382975712 5771 dbSNP
rs1051289567 5772 dbSNP
rs782098001 5778 dbSNP
rs1387292776 5797 dbSNP
rs782338296 5801 dbSNP
rs1417815755 5802 dbSNP
rs1379554203 5812 dbSNP
rs1174048089 5815 dbSNP
rs1455371043 5816 dbSNP
rs1375720032 5824 dbSNP
rs544389849 5825 dbSNP
rs1197801811 5828 dbSNP
rs1428724547 5830 dbSNP
rs533550212 5833 dbSNP
rs903485279 5842 dbSNP
rs934810461 5844 dbSNP
rs1213775330 5853 dbSNP
rs373582779 5854 dbSNP
rs893186160 5859 dbSNP
rs1274603510 5862 dbSNP
rs1228478649 5865 dbSNP
rs553438132 5875 dbSNP
rs1013015775 5877 dbSNP
rs10068312 5878 dbSNP
rs1293546364 5883 dbSNP
rs1399422753 5893 dbSNP
rs1359833895 5895 dbSNP
rs376622352 5910 dbSNP
rs562573897 5913 dbSNP
rs1002911891 5916 dbSNP
rs1171749026 5927 dbSNP
rs1462206877 5928 dbSNP
rs1034925967 5937 dbSNP
rs146326886 5943 dbSNP
rs555023075 5943 dbSNP
rs1491110138 5944 dbSNP
rs576200408 5944 dbSNP
rs115969144 5945 dbSNP
rs1278395182 5946 dbSNP
rs181177221 5947 dbSNP
rs1256326498 5948 dbSNP
rs1218246635 5949 dbSNP
rs1356244326 5958 dbSNP
rs201408397 5959 dbSNP
rs26815 5959 dbSNP
rs1338590035 5964 dbSNP
rs1333288815 5968 dbSNP
rs1391701404 5973 dbSNP
rs1398359922 5974 dbSNP
rs975197561 5984 dbSNP
rs1168167139 5987 dbSNP
rs1464757213 5989 dbSNP
rs920890618 5993 dbSNP
rs933656883 6007 dbSNP
rs752746134 6008 dbSNP
rs369013903 6009 dbSNP
rs986457565 6012 dbSNP
rs1237351079 6018 dbSNP
rs924846871 6024 dbSNP
rs576559971 6037 dbSNP
rs1236722064 6059 dbSNP
rs1439990421 6059 dbSNP
rs1198311027 6067 dbSNP
rs934946987 6086 dbSNP
rs1055003201 6087 dbSNP
rs80146286 6088 dbSNP
rs1354183982 6096 dbSNP
rs948772867 6101 dbSNP
rs1442816701 6113 dbSNP
rs1378899584 6114 dbSNP
rs782810084 6123 dbSNP
rs1044495049 6128 dbSNP
rs781882133 6133 dbSNP
rs1445617633 6138 dbSNP
rs138748316 6140 dbSNP
rs1002862849 6142 dbSNP
rs1394699942 6145 dbSNP
rs1327345090 6157 dbSNP
rs1026343774 6165 dbSNP
rs1403027496 6169 dbSNP
rs1412443175 6174 dbSNP
rs1159715087 6175 dbSNP
rs1471431674 6196 dbSNP
rs782128689 6197 dbSNP
rs1378900631 6198 dbSNP
rs1004149289 6208 dbSNP
rs1178371645 6226 dbSNP
rs1469092386 6262 dbSNP
rs1017145450 6270 dbSNP
rs1219472009 6274 dbSNP
rs1451165414 6278 dbSNP
rs962577703 6284 dbSNP
rs1285016227 6295 dbSNP
rs1224310188 6296 dbSNP
rs111824831 6298 dbSNP
rs975256874 6316 dbSNP
rs1306831471 6320 dbSNP
rs1239086037 6321 dbSNP
rs1028022456 6328 dbSNP
rs1276320339 6335 dbSNP
rs1433841238 6336 dbSNP
rs1348848313 6344 dbSNP
rs955146856 6345 dbSNP
rs1402984849 6348 dbSNP
rs1359133490 6352 dbSNP
rs986405458 6354 dbSNP
rs1454929224 6361 dbSNP
rs533294536 6376 dbSNP
rs1477804383 6380 dbSNP
rs394586 6383 dbSNP
rs1217977762 6384 dbSNP
rs417960 6384 dbSNP
rs184412160 6388 dbSNP
rs990417537 6389 dbSNP
rs1215800238 6390 dbSNP
rs914845197 6394 dbSNP
rs1303110722 6395 dbSNP
rs139595058 6396 dbSNP
rs367726017 6396 dbSNP
rs782181214 6396 dbSNP
rs78222407 6405 dbSNP
rs868951814 6415 dbSNP
rs1366424675 6422 dbSNP
rs948905476 6428 dbSNP
rs1270294902 6432 dbSNP
rs1401238385 6436 dbSNP
rs1044611808 6450 dbSNP
rs77332853 6462 dbSNP
rs1174349419 6463 dbSNP
rs1414141268 6463 dbSNP
rs34142985 6463 dbSNP
rs1420416991 6468 dbSNP
rs1476919157 6468 dbSNP
rs570117256 6469 dbSNP
rs1192920745 6475 dbSNP
rs535676673 6478 dbSNP
rs1257577721 6479 dbSNP
rs1207700087 6485 dbSNP
rs1311264152 6488 dbSNP
rs1273189380 6489 dbSNP
rs1220083400 6502 dbSNP
rs1315579746 6503 dbSNP
rs1276982300 6508 dbSNP
rs1415971730 6510 dbSNP
rs928687383 6514 dbSNP
rs1381911296 6516 dbSNP
rs188291535 6523 dbSNP
rs1447667004 6527 dbSNP
rs1355472544 6528 dbSNP
rs537229721 6530 dbSNP
rs566045281 6541 dbSNP
rs544427870 6543 dbSNP
rs28061 6544 dbSNP
rs779892685 6546 dbSNP
rs1423062460 6558 dbSNP
rs1165702659 6566 dbSNP
rs1047734770 6570 dbSNP
rs1258112157 6572 dbSNP
rs180766975 6578 dbSNP
rs1482844601 6583 dbSNP
rs1233232602 6584 dbSNP
rs1200184907 6585 dbSNP
rs1315637133 6593 dbSNP
rs1256894679 6602 dbSNP
rs554371013 6603 dbSNP
rs572700004 6606 dbSNP
rs1324031082 6607 dbSNP
rs1311287407 6609 dbSNP
rs1228235970 6611 dbSNP
rs1038287991 6614 dbSNP
rs1333754325 6615 dbSNP
rs1444886530 6624 dbSNP
rs898441478 6630 dbSNP
rs1326680135 6632 dbSNP
rs996622816 6634 dbSNP
rs1366795238 6637 dbSNP
rs1162669764 6639 dbSNP
rs1423141423 6640 dbSNP
rs1380716322 6646 dbSNP
rs1180222840 6655 dbSNP
rs1456180917 6657 dbSNP
rs539125076 6659 dbSNP
rs1213922462 6664 dbSNP
rs540275026 6668 dbSNP
rs1263139448 6671 dbSNP
rs1221533913 6672 dbSNP
rs1318009205 6677 dbSNP
rs1007939642 6678 dbSNP
rs1031711745 6681 dbSNP
rs1311952364 6683 dbSNP
rs1238361541 6687 dbSNP
rs1376444922 6689 dbSNP
rs1304530490 6694 dbSNP
rs1388729724 6695 dbSNP
rs1388731834 6696 dbSNP
rs1292971286 6700 dbSNP
rs1457364251 6701 dbSNP
rs1966572 6709 dbSNP
rs1160240171 6710 dbSNP
rs782567768 6718 dbSNP
rs186420822 6725 dbSNP
rs1379434617 6734 dbSNP
rs1199186609 6735 dbSNP
rs1434515113 6738 dbSNP
rs1264696018 6746 dbSNP
rs1208681069 6747 dbSNP
rs561954314 6750 dbSNP
rs572416999 6751 dbSNP
rs541416210 6752 dbSNP
rs1353512770 6753 dbSNP
rs914815277 6755 dbSNP
rs1235735439 6756 dbSNP
rs1329510609 6759 dbSNP
rs564359491 6760 dbSNP
rs1382782849 6762 dbSNP
rs1342442667 6764 dbSNP
rs533380588 6774 dbSNP
rs1417760139 6779 dbSNP
rs1359706946 6782 dbSNP
rs1172908590 6786 dbSNP
rs1467283833 6788 dbSNP
rs781907811 6789 dbSNP
rs928803367 6798 dbSNP
rs1197559810 6808 dbSNP
rs1264692021 6811 dbSNP
rs1192188237 6818 dbSNP
rs1488233394 6820 dbSNP
rs1257328274 6823 dbSNP
rs938716925 6824 dbSNP
rs541770721 6828 dbSNP
rs782542635 6843 dbSNP
rs1343141591 6847 dbSNP
rs1047846020 6848 dbSNP
rs782654611 6861 dbSNP
rs1320152879 6875 dbSNP
rs1276347982 6878 dbSNP
rs543526924 6897 dbSNP
rs1398101903 6904 dbSNP
rs563810562 6910 dbSNP
rs1397495341 6911 dbSNP
rs1038138427 6913 dbSNP
rs747621540 6914 dbSNP
rs1399791881 6919 dbSNP
rs898387705 6923 dbSNP
rs782249674 6924 dbSNP
rs1049514940 6925 dbSNP
rs890959031 6931 dbSNP
rs782360725 6934 dbSNP
rs1477788076 6941 dbSNP
rs1369484143 6951 dbSNP
rs1190217082 6953 dbSNP
rs190729940 6958 dbSNP
rs1255874225 6959 dbSNP
rs782342258 6960 dbSNP
rs1031411317 6976 dbSNP
rs1459226310 6982 dbSNP
rs1256264590 6984 dbSNP
rs956011654 6986 dbSNP
rs1218032105 6998 dbSNP
rs1338677649 7016 dbSNP
rs549209821 7019 dbSNP
rs566008141 7026 dbSNP
rs1011221210 7033 dbSNP
rs1021728323 7036 dbSNP
rs772933652 7040 dbSNP
rs970269946 7049 dbSNP
rs1447104632 7050 dbSNP
rs980358969 7056 dbSNP
rs1328691829 7065 dbSNP
rs1464708218 7067 dbSNP
rs1413869935 7068 dbSNP
rs1165555232 7070 dbSNP
rs1179596760 7077 dbSNP
rs1441793479 7077 dbSNP
rs781963202 7077 dbSNP
rs528791171 7080 dbSNP
rs1198247408 7082 dbSNP
rs1452320282 7086 dbSNP
rs1211610691 7089 dbSNP
rs960195055 7094 dbSNP
rs1314123860 7106 dbSNP
rs552065348 7110 dbSNP
rs1378826478 7118 dbSNP
rs1306698394 7125 dbSNP
rs1440997962 7134 dbSNP
rs181560686 7140 dbSNP
rs17155151 7142 dbSNP
rs973399032 7143 dbSNP
rs555945345 7144 dbSNP
rs932528690 7145 dbSNP
rs1049629205 7156 dbSNP
rs116796820 7162 dbSNP
rs1421979053 7163 dbSNP
rs943860374 7164 dbSNP
rs1378840850 7167 dbSNP
rs1178316473 7174 dbSNP
rs1478463225 7180 dbSNP
rs1248564708 7189 dbSNP
rs1196790127 7195 dbSNP
rs1449795176 7205 dbSNP
rs543895244 7206 dbSNP
rs1291030419 7209 dbSNP
rs1217226394 7212 dbSNP
rs1355643377 7215 dbSNP
rs797039733 7218 dbSNP
rs1222881438 7221 dbSNP
rs529560884 7228 dbSNP
rs891521232 7229 dbSNP
rs1433594517 7235 dbSNP
rs1011755980 7237 dbSNP
rs1422042844 7237 dbSNP
rs562427429 7253 dbSNP
rs1158380310 7256 dbSNP
rs186855494 7260 dbSNP
rs1171028989 7266 dbSNP
rs1477771441 7266 dbSNP
rs1263967262 7270 dbSNP
rs1001243087 7279 dbSNP
rs1489207213 7288 dbSNP
rs572356574 7300 dbSNP
rs1214735212 7307 dbSNP
rs17363592 7312 dbSNP
rs1280382462 7315 dbSNP
rs960309172 7317 dbSNP
rs1322279519 7318 dbSNP
rs777034684 7327 dbSNP
rs1278248631 7330 dbSNP
rs558034697 7331 dbSNP
rs1339031910 7336 dbSNP
rs983622061 7348 dbSNP
rs1288673312 7351 dbSNP
rs782387190 7357 dbSNP
rs1361243490 7360 dbSNP
rs1332495383 7361 dbSNP
rs1469451697 7364 dbSNP
rs1424463051 7373 dbSNP
rs1172844615 7382 dbSNP
rs1478769429 7385 dbSNP
rs1421305706 7391 dbSNP
rs1185857636 7393 dbSNP
rs149485017 7398 dbSNP
rs1238966264 7410 dbSNP
rs1207640924 7415 dbSNP
rs543812728 7417 dbSNP
rs973897201 7422 dbSNP
rs1460572895 7426 dbSNP
rs760004986 7431 dbSNP
rs1258173346 7438 dbSNP
rs922056992 7441 dbSNP
rs563612887 7445 dbSNP
rs1315525367 7452 dbSNP
rs1295565772 7453 dbSNP
rs868911698 7457 dbSNP
rs987460728 7469 dbSNP
rs1301421326 7471 dbSNP
rs1452219705 7476 dbSNP
rs1401229274 7482 dbSNP
rs1333450137 7486 dbSNP
rs1464198441 7488 dbSNP
rs1353999813 7489 dbSNP
rs1169714447 7511 dbSNP
rs1424294316 7516 dbSNP
rs912459614 7517 dbSNP
rs943969680 7521 dbSNP
rs1181476363 7535 dbSNP
rs1443648533 7537 dbSNP
rs1238341321 7540 dbSNP
rs1200122607 7541 dbSNP
rs549529672 7543 dbSNP
rs891631253 7545 dbSNP
rs1250231283 7547 dbSNP
rs947118778 7563 dbSNP
rs1311046424 7567 dbSNP
rs781981801 7582 dbSNP
rs1378104333 7586 dbSNP
rs1311811938 7598 dbSNP
rs1444812057 7600 dbSNP
rs1372748130 7601 dbSNP
rs1294149063 7603 dbSNP
rs905647209 7610 dbSNP
rs78954226 7621 dbSNP
rs1161453116 7622 dbSNP
rs1035381098 7628 dbSNP
rs1380655184 7630 dbSNP
rs1180163669 7632 dbSNP
rs1416894284 7635 dbSNP
rs1249235884 7640 dbSNP
rs896048645 7642 dbSNP
rs1489755710 7643 dbSNP
rs376115237 7645 dbSNP
rs1264269773 7654 dbSNP
rs1222382471 7658 dbSNP
rs765696377 7660 dbSNP
rs1288561914 7675 dbSNP
rs1238287206 7686 dbSNP
rs1335351346 7699 dbSNP
rs559482119 7713 dbSNP
rs1302094691 7717 dbSNP
rs1005552582 7721 dbSNP
rs782719848 7729 dbSNP
rs963875056 7730 dbSNP
rs1301267408 7732 dbSNP
rs1404222634 7762 dbSNP
rs1160179432 7769 dbSNP
rs1360960935 7769 dbSNP
rs34331627 7769 dbSNP
rs973631353 7770 dbSNP
rs1362791042 7780 dbSNP
rs1176326306 7783 dbSNP
rs1434456913 7793 dbSNP
rs1266125604 7795 dbSNP
rs1199381868 7800 dbSNP
rs868970556 7814 dbSNP
rs1488880855 7816 dbSNP
rs1029020374 7819 dbSNP
rs1265823969 7825 dbSNP
rs26262 7829 dbSNP
rs551760813 7831 dbSNP
rs113202131 7838 dbSNP
rs1256881987 7845 dbSNP
rs1235661357 7859 dbSNP
rs1310556772 7862 dbSNP
rs1282674637 7863 dbSNP
rs1222845040 7868 dbSNP
rs1340987637 7870 dbSNP
rs1299810661 7875 dbSNP
rs559870191 7878 dbSNP
rs965290836 7891 dbSNP
rs989138207 7902 dbSNP
rs913187531 7906 dbSNP
rs571925288 7911 dbSNP
rs1303119165 7913 dbSNP
rs1467235165 7915 dbSNP
rs782164748 7928 dbSNP
rs1175025180 7945 dbSNP
rs1478444659 7949 dbSNP
rs1426332309 7956 dbSNP
rs532775782 7961 dbSNP
rs1446847144 7983 dbSNP
rs947202908 7984 dbSNP
rs782812013 7990 dbSNP
rs1262602021 7991 dbSNP
rs1460107671 7991 dbSNP
rs1219256933 7998 dbSNP
rs1280080426 7998 dbSNP
rs1320088471 7998 dbSNP
rs549776986 7999 dbSNP
rs569764028 8007 dbSNP
rs1397441360 8012 dbSNP
rs1403373630 8015 dbSNP
rs370845054 8030 dbSNP
rs1335506631 8032 dbSNP
rs1465753886 8033 dbSNP
rs1401832100 8040 dbSNP
rs1166700975 8043 dbSNP
rs527506080 8053 dbSNP
rs74323163 8054 dbSNP
rs1369427743 8055 dbSNP
rs782508128 8070 dbSNP
rs1189977440 8074 dbSNP
rs191234689 8081 dbSNP
rs1443014031 8084 dbSNP
rs1242837489 8100 dbSNP
rs1199491130 8104 dbSNP
rs1056782189 8105 dbSNP
rs895472723 8108 dbSNP
rs1459182667 8110 dbSNP
rs1270934975 8112 dbSNP
rs1194039673 8116 dbSNP
rs1338613773 8122 dbSNP
rs1004589868 8125 dbSNP
rs1247818070 8129 dbSNP
rs1037011401 8135 dbSNP
rs1380307947 8143 dbSNP
rs1314002697 8150 dbSNP
rs1447038730 8159 dbSNP
rs1378509845 8162 dbSNP
rs1326222176 8164 dbSNP
rs1409906940 8165 dbSNP
rs899443135 8166 dbSNP
rs1165502806 8168 dbSNP
rs1423192289 8170 dbSNP
rs782810637 8180 dbSNP
rs1179540565 8184 dbSNP
rs1441735214 8187 dbSNP
rs1231275085 8189 dbSNP
rs995394991 8194 dbSNP
rs1181106088 8202 dbSNP
rs565832131 8213 dbSNP
rs1268057823 8220 dbSNP
rs1437170510 8220 dbSNP
rs143946220 8227 dbSNP
rs557731803 8234 dbSNP
rs1290704100 8237 dbSNP
rs577899722 8240 dbSNP
rs1352318989 8241 dbSNP
rs1277267673 8249 dbSNP
rs1440923426 8251 dbSNP
rs1331164716 8256 dbSNP
rs567703644 8260 dbSNP
rs782559818 8265 dbSNP
rs1365379425 8268 dbSNP
rs34934684 8268 dbSNP
rs956918698 8272 dbSNP
rs1421769918 8273 dbSNP
rs988193609 8278 dbSNP
rs1478431947 8282 dbSNP
rs782286343 8283 dbSNP
rs968689640 8285 dbSNP
rs531705866 8287 dbSNP
rs1201559615 8288 dbSNP
rs17155154 8298 dbSNP
rs1267928699 8305 dbSNP
rs183395657 8306 dbSNP
rs937033114 8309 dbSNP
rs1281775646 8311 dbSNP
rs1222825281 8320 dbSNP
rs550230431 8321 dbSNP
rs148779323 8327 dbSNP
rs917038012 8331 dbSNP
rs940337549 8334 dbSNP
rs1036051828 8343 dbSNP
rs1299195897 8350 dbSNP
rs899387954 8354 dbSNP
rs995062256 8356 dbSNP
rs144801340 8358 dbSNP
rs26261 8359 dbSNP
rs1427397572 8361 dbSNP
rs757485080 8367 dbSNP
rs1009060173 8377 dbSNP
rs1019439162 8391 dbSNP
rs539418561 8394 dbSNP
rs1428591767 8398 dbSNP
rs766134973 8402 dbSNP
rs1194278441 8407 dbSNP
rs545618130 8412 dbSNP
rs1476297735 8414 dbSNP
rs1240112089 8422 dbSNP
rs148770531 8426 dbSNP
rs17155157 8446 dbSNP
rs1442590798 8449 dbSNP
rs1264474956 8450 dbSNP
rs2216580 8464 dbSNP
rs1201162776 8474 dbSNP
rs1322214023 8474 dbSNP
rs782310736 8480 dbSNP
rs1279454367 8494 dbSNP
rs1216811202 8498 dbSNP
rs187886636 8500 dbSNP
rs978676441 8509 dbSNP
rs1034305430 8510 dbSNP
rs958517997 8514 dbSNP
rs992687862 8525 dbSNP
rs1334960830 8527 dbSNP
rs1469404339 8530 dbSNP
rs1401093194 8539 dbSNP
rs549502047 8542 dbSNP
rs1430195322 8545 dbSNP
rs1417156076 8548 dbSNP
rs1185658661 8552 dbSNP
rs573138821 8556 dbSNP
rs781948114 8557 dbSNP
rs563233714 8565 dbSNP
rs1472925055 8569 dbSNP
rs1244667770 8574 dbSNP
rs78425523 8591 dbSNP