miRTarBase - #MIRT714442 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARHGAP32   
Synonyms GC-GAP, GRIT, PX-RICS, RICS, p200RhoGAP, p250GAP
Description Rho GTPase activating protein 32
Transcript NM_001142685   
Other Transcripts NM_014715   
Expression
Putative miRNA Targets on ARHGAP32
3'UTR of ARHGAP32
(miRNA target sites are highlighted)
>ARHGAP32|NM_001142685|3'UTR
   1 GCCCTGCGAGCAATAGAGTTGAAGCAGCCTCTGCTGGACAGTGGACTGTTCTATTTTTTTCAATAACCAAAAAGATTAAA
  81 CAAAAAATACTATAAAACCCCTGACCACATTTAAAAAATGATAATAAAAGTAAACAAATCAGCATCTTTTTCCCCTTCCC
 161 TGCTTCATTACCCCCTCTTCCATCTATAGACTTTGTCATTTTTGTCTTTAGAAAAGATCTGAAGGATGGTAAAGCCCCGT
 241 GCTGAAACCCAGTAGAGAAACCTGTCTCAGGACACACTTGCCATCTAGGGCTAGCTTGAAAGAGCCTGAGGACTGCCTTT
 321 AACTGAATTTGAATTCAGCATTGTCCTTTCTTCTTAGTATTTGCTGCATAATTGAGAGCAGTTCACATCGATTTCCTGGT
 401 AGGCGTCTGCATTCCCTGTTGTGTTCCTGCTTCTCCTTCAGTAGCTGCACAACTTGCGCAGATCGACACACTGTTGTCAC
 481 TTCATTCTCCCCGTCTGAGAAGGATCTTGTGTTCAGTTAGAGTCGTGGAAAAATCCCTGATCCTTCAAGGTCAGTCAGAC
 561 AGTTGGCAACATTATAATTAAAAATAAGAAATTAAGACTTTAAATTAAACATTTGGTAGAGTCATCATAAAACACCAGAC
 641 CACTTAGACTCAGGCTGAACCATACTCTTTCTATTCTTATTTTTCATCCTTGTTCCTCACGGTTCAGTGAACAGGCTCAT
 721 ATCATGACAGAATGGACTTTTAAAAGTTAGTACTTAAGGAAACTTCTTTAGGTGGAAGAAAGTAAAGTTCTTATTGTCAG
 801 TGAACTTTATTAGCACCAGAAATCTCTATTGATGCTTTTAATGCATTGCCTGCCTTCAGGTTTTCTTCTTACCCCACCCC
 881 TCAATAAGATTTGGTGAATTGTAATTCTAGTAAAACATGTCATACCATTGGTTTTCCTAAATTATCAACTTTCTTTCATT
 961 AAAAAAAAAAAAAAAAAAAAAAGCCCAGCATGGTTTGACTGGATAGACACGCATAATTTATTATGAATATAAATTTCCAT
1041 GTTTGTTTCTGTTCCTAAACCAGAGTACGAGGTCCCTGGGAATTTAAGTAGCTACGCATTATCTATTATTAGACTGCAAG
1121 TTCCTGCAATAACTGCTTAGTTCACAGCCCCGTTTCACCAGTGGAGTTCTGGGCAGTTATTGCTGTCCTAAGGCATTACT
1201 GTCGTTTGCTTACTCTATACTTGTGTGGTCACAGTCTTCTTGTAATTACCATCTACACCAGCATTTCAGGTATAGCTCTT
1281 TATAACTCTGGAGACATGTAAAACATGTTTAACACCCACGAGTTTTGAAAGTTGCATTCCTTATTAGAGTAGGAACTCTC
1361 TAGCCCAACTCCATTCTATGTTCTCAGCTCCCTCCACCCCCCAAAATACATCAGACTAGCAAGGCAGTCCTATGTTTACA
1441 AAACGAGTTTAGATTGTCATTTCATTCCATAACTCTTAATAATACTCAAGTTTTATACATTCACGTATTTTAAATGCTCG
1521 GTCTGTAGAAGACACTAGGAGAATTGCATTCCAATTACTGGATGGTTGCTGCTCTGGCTTTTTAGAACTTGAAATTAATT
1601 TTTATTTAGAGCAAAGGAGGAAATCTTTTAAGAGGCTAAAATCATGCTGCTATTATTGCTGTGAAATTGTATAAAGATTA
1681 GGATTCATGCCAGTTTTTATTTTAAAAAATAATGTGCATTTTAAGGGTTTATATTTAGAAAAAAATAAAATGTTTCAAGA
1761 ACAACACATTGATATGTGGAAATATTCTATAAGGTTTTCTTTTGTTCCCTTAGAATTCATTGGAGGGATGCAGTAAAAAC
1841 TGTAGTAGAAACCTTGAAACACCCATATGTGAAAAGGTCTGTGGAAATTGAGGCCTCTACATTAAAAGTGCAGAACCAAC
1921 TGTTTTACAGTCAAAGTGCTAGGAAACCTGATAGGATACTTCCCTTTGGCACAAAAACACCCTGGGTGCTACATACAGGA
2001 GTATGACCTTTGGTGAATATGTGGCACTAATTTTTTTTACCTTAATCATATTCTTGTCAAGTAGGCAACCCATTGCCCCT
2081 TGGAGACCACACCAGCCCTGTAAGTTCTCACCAGCAGCATGGAGATTAGGAAGAGGGGCTGCTGTGACCAGGAGATACAC
2161 ACGGCTTTAAGTAACTGAGAGCCTAAAGAAAGTAACCCAGGGAGTCCGGTCCAGTTTTAATATTTGTGGATTTGTTGTCA
2241 CACACATTGTTTAGTCCTGAAACTAAAACCTATTTTATAAATAGTAGGGTTAATTCCTCGAAACAATTTCTTTATTAATA
2321 AATGTCCTGTGGGTTTAGAAATATCAGGTAAATATTTGAATACAGAATGATGATTGCAATTACTGTTACAAGCGTGAAAC
2401 ACAAACTTCAGATCAAATCTAGAGTTGCTTCATTTAATGCATGCTAGCAACAGCCTTAACTTTGGATTCAGTTATTTGAA
2481 ACACTTTTCCGGCATCTTTCCCTTTCTAATGTTGTGGGGTGGAAACCGGATGGCAAATCACTGTGAGCCGGATACCTCAG
2561 CACAGTCCACCTTGTGTGTGACTTCACAAATGGGGGACTTCACAAATGGGGTAACTGAATGTTATTACTTTCAAATTTTG
2641 ACATGGAGCATTATGATCAAGGAAATGGAGCTGCCTTATACATTAAACCCGTGATTTAATCCTATTGACATTTTCATAGC
2721 CATGCCTCCAGATTTTATCTTTTTGGCAAAATTCTGATTCCACAGTTTGGTCTGATTGAAATAAATATTCCCTGGACGTC
2801 TGGCTAAAAATTTTGCTAACAATCCCAGAGGTGCCATTTTCTTATTAATAAATTTCATTGGAGCCTTATTTCTTACTATA
2881 TTCAATTTCGTTTCAAACCTGCAAGTCCCTGGGATGGTCCCACGACTAGGGCCTGCACATTTCTTACAATGGCAAAGCAT
2961 TTTTTAAAATTTAGGGTCAGGTTGAAAAATTCTAGGACTAATTCTGTAGAGAGGAGGGACTGTTAACTAACGTGAGTGGG
3041 GACGGAGGAGTAGGTTACCACATTTGGAGCAGTAATAGATGCAAACGATGTAAATTTGAAATTTGCCCCTTTAGTTAAAG
3121 AAGGAGCCTGCAAAGTCCATTTCTCTGTTTTCAGCCCTGTCAGTCACCCATTTAGGATGTTGGCAAAGTACTGCTTGAGC
3201 AGAATGTGTAAGAAAGTAATAATGAAAGCAAAAGTATGTCAGACAGTTACTTCTTCCACATGGTTAGAGGCATGTGATTT
3281 TCAGCACTGTGTGTTACAGAAATGTCAGGAATGGTGTATTATAACGTGTGCAAGATAATGTCAGTGTGCACAGAGGGTCT
3361 TTTTTCCTTATCTGATTAGTACTGTTAATGTTCAAAGAATAAAAATGGTTTTACAGTTTAGATTCTGAGATAGCAAAACC
3441 TGATTTTTCAACCATGACCTGCATGAGAGAAGCATCCTAGGAAGTCTTAGATCATACTTTTGAGTTTTTAATTTTAATTT
3521 ATATAGTGTTTTTTTATGTCTTAATATTTTTGTGAACTGGTGTAAATTGTTAATGCATATAAGCTTGTGTATTTTTGTAA
3601 ATAGTTTTGTGATTTATTTCTTGCCCCATATGTAAATATTTAGAGTCTCATTTCTTGCAAACTTATTTGAAGCTGAGTTG
3681 TGGGTTTGGGTTTTGTTTGTTTCTTTGGTTGCAGGGTGGGGTGGGGGGTGGCAGGGGAGGGAGGAAGGGATTTTTGTACC
3761 TGGAGATGGAGATATCTTGTGGTTTAAAGCAAATGTCCCACTGAAAGTGATTCAAATATCAACAGAATTATTTCAGGTTA
3841 AAACAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAA--UAC--ACGACGAu 5'
            | ||::| |  |||  ||||||| 
Target 5' ttCCAATTACTGGATGGTTGCTGCTc 3'
1549 - 1574 156.00 -11.50
2
miRNA  3' gugUUUGGUAAUA-CACGACGAu 5'
             |::|:|  ||  ||||||| 
Target 5' aagAGGCTAAAATCATGCTGCTa 3'
1630 - 1652 151.00 -12.50
3
miRNA  3' guguuuGGUAAUACACGACGau 5'
                ::| ||| ||||||  
Target 5' ttcttcTTAGTATTTGCTGCat 3'
348 - 369 136.00 -7.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30538386 8 COSMIC
COSN27701847 76 COSMIC
COSN31562645 81 COSMIC
COSN1518937 254 COSMIC
COSN6992200 410 COSMIC
COSN31960716 525 COSMIC
COSN25725296 735 COSMIC
COSN17078619 940 COSMIC
COSN17433985 952 COSMIC
COSN27551107 960 COSMIC
COSN10080670 2326 COSMIC
COSN20719624 2571 COSMIC
COSN5899240 2785 COSMIC
COSN17076237 2798 COSMIC
COSN24485142 2886 COSMIC
COSN32062796 2890 COSMIC
COSN8737371 3140 COSMIC
COSN8215769 3341 COSMIC
COSN25748287 3385 COSMIC
COSN6992199 3462 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755899492 7 dbSNP
rs186982853 8 dbSNP
rs1400970057 10 dbSNP
rs1359238798 15 dbSNP
rs1360511824 16 dbSNP
rs929451439 17 dbSNP
rs1459006381 18 dbSNP
rs762591047 22 dbSNP
rs1246344517 24 dbSNP
rs777080992 24 dbSNP
rs1421727573 45 dbSNP
rs565104155 46 dbSNP
rs544847023 48 dbSNP
rs1194185116 51 dbSNP
rs759350055 53 dbSNP
rs898020571 74 dbSNP
rs1428495652 75 dbSNP
rs1312982242 77 dbSNP
rs1403777047 82 dbSNP
rs1032563813 83 dbSNP
rs1333167053 88 dbSNP
rs1326787848 92 dbSNP
rs573119460 94 dbSNP
rs910817540 96 dbSNP
rs1341399128 98 dbSNP
rs1461083449 98 dbSNP
rs1375500776 105 dbSNP
rs968390319 107 dbSNP
rs1234995350 119 dbSNP
rs1257804929 122 dbSNP
rs1482357498 129 dbSNP
rs1200077583 132 dbSNP
rs1023151848 134 dbSNP
rs1262712893 141 dbSNP
rs1175509495 142 dbSNP
rs985492630 142 dbSNP
rs774348714 144 dbSNP
rs762325546 145 dbSNP
rs976556112 146 dbSNP
rs1378854883 150 dbSNP
rs777007326 151 dbSNP
rs1020782331 154 dbSNP
rs559207645 155 dbSNP
rs1420606236 158 dbSNP
rs1385265914 161 dbSNP
rs1056884544 163 dbSNP
rs993254652 171 dbSNP
rs1175668409 177 dbSNP
rs897748919 186 dbSNP
rs1441541211 190 dbSNP
rs1480375785 194 dbSNP
rs1033603596 209 dbSNP
rs1350095924 219 dbSNP
rs1232630812 228 dbSNP
rs906563286 229 dbSNP
rs1207113214 233 dbSNP
rs1037600063 238 dbSNP
rs942038017 239 dbSNP
rs763019767 241 dbSNP
rs1193411430 242 dbSNP
rs368764980 251 dbSNP
rs1430914656 264 dbSNP
rs1240231965 265 dbSNP
rs1412132816 272 dbSNP
rs1458461935 276 dbSNP
rs1156589882 278 dbSNP
rs1037840839 290 dbSNP
rs933389893 294 dbSNP
rs1365442671 304 dbSNP
rs573299054 329 dbSNP
rs889350451 338 dbSNP
rs1352449842 343 dbSNP
rs73029226 346 dbSNP
rs1390452275 350 dbSNP
rs1264155541 356 dbSNP
rs769710637 356 dbSNP
rs536761579 359 dbSNP
rs956820969 371 dbSNP
rs922315033 374 dbSNP
rs1251908358 382 dbSNP
rs1473320555 387 dbSNP
rs976903618 389 dbSNP
rs945161871 390 dbSNP
rs1424136234 391 dbSNP
rs1166678447 397 dbSNP
rs925545063 399 dbSNP
rs1308630953 403 dbSNP
rs979681804 404 dbSNP
rs968811700 405 dbSNP
rs1022624132 409 dbSNP
rs1287888561 419 dbSNP
rs573884614 432 dbSNP
rs959787867 435 dbSNP
rs1159037438 436 dbSNP
rs1310994922 438 dbSNP
rs980737734 445 dbSNP
rs143310797 457 dbSNP
rs1179999747 458 dbSNP
rs189642143 461 dbSNP
rs1202450532 464 dbSNP
rs1472384184 465 dbSNP
rs1250548838 468 dbSNP
rs1258404867 471 dbSNP
rs1483359584 475 dbSNP
rs993506019 485 dbSNP
rs776648924 487 dbSNP
rs897634387 493 dbSNP
rs1169071989 495 dbSNP
rs1016623658 503 dbSNP
rs1190165164 509 dbSNP
rs7116001 510 dbSNP
rs1016378865 514 dbSNP
rs1006363229 515 dbSNP
rs1006118549 516 dbSNP
rs889316742 524 dbSNP
rs889155419 525 dbSNP
rs534886543 531 dbSNP
rs1365750186 533 dbSNP
rs566401915 536 dbSNP
rs1206218628 540 dbSNP
rs1215528077 541 dbSNP
rs1300398422 542 dbSNP
rs1353367855 548 dbSNP
rs997816451 550 dbSNP
rs900825841 559 dbSNP
rs1050442492 574 dbSNP
rs933275421 577 dbSNP
rs1040654147 586 dbSNP
rs1211782705 588 dbSNP
rs549693103 592 dbSNP
rs1482766132 597 dbSNP
rs913630070 598 dbSNP
rs1335091173 601 dbSNP
rs1447550456 603 dbSNP
rs1167962231 610 dbSNP
rs1425947872 618 dbSNP
rs768877437 641 dbSNP
rs1053497241 650 dbSNP
rs536106763 652 dbSNP
rs1294693972 654 dbSNP
rs80037921 657 dbSNP
rs1322941616 659 dbSNP
rs1363512822 665 dbSNP
rs1354236573 666 dbSNP
rs536874053 671 dbSNP
rs1052497644 676 dbSNP
rs567896335 680 dbSNP
rs1276020237 686 dbSNP
rs1367618783 692 dbSNP
rs981089941 695 dbSNP
rs970639129 700 dbSNP
rs1382596710 701 dbSNP
rs372969028 715 dbSNP
rs917830994 724 dbSNP
rs925464201 734 dbSNP
rs972037611 734 dbSNP
rs962054633 749 dbSNP
rs980129526 752 dbSNP
rs868632758 755 dbSNP
rs1424612660 761 dbSNP
rs1161733751 770 dbSNP
rs1457936555 770 dbSNP
rs1386894547 771 dbSNP
rs1457056994 781 dbSNP
rs186318204 785 dbSNP
rs1437924818 787 dbSNP
rs953667271 787 dbSNP
rs1272542587 790 dbSNP
rs1029195642 791 dbSNP
rs916782247 794 dbSNP
rs758881425 796 dbSNP
rs1194608383 809 dbSNP
rs1326730932 813 dbSNP
rs991116185 821 dbSNP
rs902053704 822 dbSNP
rs1449243338 828 dbSNP
rs1041970063 829 dbSNP
rs1296841332 831 dbSNP
rs1009159490 839 dbSNP
rs1184542567 843 dbSNP
rs892155487 847 dbSNP
rs1260186170 860 dbSNP
rs1208521406 876 dbSNP
rs1404095166 877 dbSNP
rs959675474 890 dbSNP
rs745543702 899 dbSNP
rs774236312 903 dbSNP
rs1409913719 904 dbSNP
rs971774594 908 dbSNP
rs1348266779 909 dbSNP
rs1237942856 925 dbSNP
rs961875660 928 dbSNP
rs1284540922 931 dbSNP
rs1358281287 932 dbSNP
rs114657864 952 dbSNP
rs1003475654 953 dbSNP
rs1270267869 957 dbSNP
rs1228887537 959 dbSNP
rs1324626970 960 dbSNP
rs1006585137 961 dbSNP
rs1176134890 961 dbSNP
rs1249825484 961 dbSNP
rs889048122 970 dbSNP
rs1317488700 977 dbSNP
rs1188593763 979 dbSNP
rs1370553370 980 dbSNP
rs1441402602 980 dbSNP
rs1029287727 981 dbSNP
rs997538302 982 dbSNP
rs1201195529 983 dbSNP
rs1309293161 983 dbSNP
rs1314240614 983 dbSNP
rs1334467391 983 dbSNP
rs1341981660 983 dbSNP
rs1342810096 983 dbSNP
rs1368212263 983 dbSNP
rs1390455243 983 dbSNP
rs35026265 983 dbSNP
rs770357827 983 dbSNP
rs771884064 983 dbSNP
rs901817640 983 dbSNP
rs1422543117 984 dbSNP
rs1441014349 984 dbSNP
rs1183390921 987 dbSNP
rs1052552320 991 dbSNP
rs1044867429 1002 dbSNP
rs949263494 1010 dbSNP
rs917815345 1011 dbSNP
rs972001526 1013 dbSNP
rs1172731853 1024 dbSNP
rs1413264882 1035 dbSNP
rs1168587549 1037 dbSNP
rs1335810267 1039 dbSNP
rs551586068 1041 dbSNP
rs1437181973 1042 dbSNP
rs1295337982 1045 dbSNP
rs1325865736 1048 dbSNP
rs904050561 1051 dbSNP
rs1043907057 1063 dbSNP
rs948179286 1068 dbSNP
rs7949524 1070 dbSNP
rs984864297 1073 dbSNP
rs1203321610 1074 dbSNP
rs992341036 1076 dbSNP
rs79276422 1078 dbSNP
rs75322426 1095 dbSNP
rs1255268349 1096 dbSNP
rs1427367875 1097 dbSNP
rs1198974993 1098 dbSNP
rs1378904681 1101 dbSNP
rs1467872303 1103 dbSNP
rs1175345977 1110 dbSNP
rs1389033112 1116 dbSNP
rs976253485 1119 dbSNP
rs529112427 1122 dbSNP
rs528865193 1127 dbSNP
rs966623652 1129 dbSNP
rs1303462234 1149 dbSNP
rs767268222 1151 dbSNP
rs1016394539 1152 dbSNP
rs892124446 1153 dbSNP
rs1331589075 1160 dbSNP
rs1207258965 1163 dbSNP
rs1031935278 1166 dbSNP
rs1273199564 1173 dbSNP
rs1000943393 1174 dbSNP
rs1212189563 1176 dbSNP
rs1268830953 1177 dbSNP
rs1479202843 1179 dbSNP
rs984644542 1180 dbSNP
rs953312051 1190 dbSNP
rs1028924337 1193 dbSNP
rs1045232474 1194 dbSNP
rs1156647871 1195 dbSNP
rs1363056533 1201 dbSNP
rs949237102 1203 dbSNP
rs896341211 1204 dbSNP
rs1388594955 1206 dbSNP
rs1404413737 1207 dbSNP
rs1308819550 1212 dbSNP
rs997423708 1217 dbSNP
rs1226846694 1222 dbSNP
rs1296832893 1224 dbSNP
rs1036276654 1228 dbSNP
rs1247608820 1233 dbSNP
rs140922633 1251 dbSNP
rs1030997968 1252 dbSNP
rs999490180 1253 dbSNP
rs1221122930 1256 dbSNP
rs867376283 1261 dbSNP
rs1251970598 1269 dbSNP
rs543024763 1270 dbSNP
rs754747733 1275 dbSNP
rs1175191118 1289 dbSNP
rs1044175042 1297 dbSNP
rs1406967918 1302 dbSNP
rs1424193208 1305 dbSNP
rs181980105 1319 dbSNP
rs1349539900 1323 dbSNP
rs909135868 1335 dbSNP
rs984768813 1336 dbSNP
rs1440284610 1341 dbSNP
rs1486599020 1343 dbSNP
rs1297877900 1344 dbSNP
rs931993275 1345 dbSNP
rs374115909 1348 dbSNP
rs1311146233 1355 dbSNP
rs976602729 1356 dbSNP
rs1229842915 1367 dbSNP
rs1274729504 1367 dbSNP
rs895290377 1368 dbSNP
rs966234384 1371 dbSNP
rs562266020 1395 dbSNP
rs541656180 1397 dbSNP
rs1183398315 1400 dbSNP
rs572678499 1401 dbSNP
rs751372969 1402 dbSNP
rs1408289045 1403 dbSNP
rs957580573 1423 dbSNP
rs1435876648 1425 dbSNP
rs928338148 1432 dbSNP
rs191880865 1444 dbSNP
rs940312961 1445 dbSNP
rs908981598 1446 dbSNP
rs1382597746 1452 dbSNP
rs1436451798 1458 dbSNP
rs1300468424 1459 dbSNP
rs1366663010 1464 dbSNP
rs1212321880 1473 dbSNP
rs144321278 1479 dbSNP
rs1023363385 1484 dbSNP
rs118093226 1486 dbSNP
rs1261017952 1487 dbSNP
rs1460750455 1493 dbSNP
rs1209214511 1495 dbSNP
rs1249819010 1504 dbSNP
rs556621979 1505 dbSNP
rs976038234 1508 dbSNP
rs887669504 1517 dbSNP
rs539433654 1519 dbSNP
rs1049461496 1525 dbSNP
rs1458101853 1531 dbSNP
rs772980861 1535 dbSNP
rs1349983358 1543 dbSNP
rs931987976 1545 dbSNP
rs1430699568 1553 dbSNP
rs765222651 1554 dbSNP
rs1367775644 1557 dbSNP
rs1218461579 1558 dbSNP
rs921966216 1563 dbSNP
rs1280987945 1569 dbSNP
rs1040452736 1574 dbSNP
rs1322481950 1574 dbSNP
rs1445180443 1576 dbSNP
rs570966799 1585 dbSNP
rs944759147 1590 dbSNP
rs1247355809 1597 dbSNP
rs547572954 1599 dbSNP
rs186574284 1603 dbSNP
rs1428899812 1604 dbSNP
rs968424084 1610 dbSNP
rs1022406343 1617 dbSNP
rs913323436 1620 dbSNP
rs1012727712 1625 dbSNP
rs988916746 1628 dbSNP
rs1400629369 1630 dbSNP
rs1324847849 1634 dbSNP
rs895356057 1640 dbSNP
rs1406248672 1652 dbSNP
rs1300854995 1658 dbSNP
rs369440691 1658 dbSNP
rs1209426046 1681 dbSNP
rs1281067930 1686 dbSNP
rs1056550414 1695 dbSNP
rs1348349732 1699 dbSNP
rs1003632843 1703 dbSNP
rs759435267 1703 dbSNP
rs1435356678 1704 dbSNP
rs897415711 1714 dbSNP
rs980787514 1714 dbSNP
rs1220377207 1716 dbSNP
rs181792465 1726 dbSNP
rs1483484594 1729 dbSNP
rs61912680 1736 dbSNP
rs1184689950 1737 dbSNP
rs1231517479 1741 dbSNP
rs1164273665 1746 dbSNP
rs1416627537 1746 dbSNP
rs1423351911 1746 dbSNP
rs1469959545 1746 dbSNP
rs1161102017 1747 dbSNP
rs1364487038 1750 dbSNP
rs1410042594 1750 dbSNP
rs1330496751 1751 dbSNP
rs1333703824 1752 dbSNP
rs1441251212 1755 dbSNP
rs529175140 1764 dbSNP
rs1013257619 1768 dbSNP
rs1361471722 1770 dbSNP
rs1243732291 1772 dbSNP
rs1291122099 1773 dbSNP
rs1343031534 1775 dbSNP
rs1197713697 1779 dbSNP
rs1271152285 1785 dbSNP
rs908858667 1786 dbSNP
rs1048830510 1810 dbSNP
rs931723388 1813 dbSNP
rs1239622213 1817 dbSNP
rs531821039 1820 dbSNP
rs1183576117 1844 dbSNP
rs1004690240 1847 dbSNP
rs761739945 1860 dbSNP
rs1468286452 1863 dbSNP
rs1393910886 1865 dbSNP
rs1409057345 1869 dbSNP
rs1334527428 1871 dbSNP
rs114222388 1873 dbSNP
rs1188073452 1876 dbSNP
rs1486346846 1884 dbSNP
rs1450335603 1901 dbSNP
rs1314310021 1905 dbSNP
rs1255374214 1908 dbSNP
rs1365935717 1919 dbSNP
rs923865581 1920 dbSNP
rs978401061 1922 dbSNP
rs1338948614 1924 dbSNP
rs768860935 1926 dbSNP
rs543441518 1927 dbSNP
rs532785848 1928 dbSNP
rs990954527 1941 dbSNP
rs747280800 1942 dbSNP
rs1428544151 1943 dbSNP
rs1194673296 1945 dbSNP
rs1370881813 1947 dbSNP
rs900424423 1962 dbSNP
rs1407947666 1974 dbSNP
rs189778660 1978 dbSNP
rs1335957712 1982 dbSNP
rs1035029255 1983 dbSNP
rs1003685404 1985 dbSNP
rs1293520175 1987 dbSNP
rs1287906795 1993 dbSNP
rs540776310 2001 dbSNP
rs1234164734 2020 dbSNP
rs1285436677 2028 dbSNP
rs1321812077 2030 dbSNP
rs1269219046 2039 dbSNP
rs913289193 2039 dbSNP
rs572134886 2041 dbSNP
rs775712788 2059 dbSNP
rs1259036278 2060 dbSNP
rs1415509764 2064 dbSNP
rs897301573 2066 dbSNP
rs926151750 2070 dbSNP
rs115747923 2071 dbSNP
rs772386890 2078 dbSNP
rs1447925476 2082 dbSNP
rs1346241785 2097 dbSNP
rs1412524047 2100 dbSNP
rs1006200678 2101 dbSNP
rs1287061601 2113 dbSNP
rs1399271789 2118 dbSNP
rs184083424 2119 dbSNP
rs887492410 2120 dbSNP
rs917511924 2122 dbSNP
rs746250499 2124 dbSNP
rs779228029 2127 dbSNP
rs1343853961 2135 dbSNP
rs1475932542 2140 dbSNP
rs1289367729 2141 dbSNP
rs1415006972 2144 dbSNP
rs1181279218 2153 dbSNP
rs1486154822 2155 dbSNP
rs1260653547 2157 dbSNP
rs1349284969 2161 dbSNP
rs1049199204 2162 dbSNP
rs1270469809 2163 dbSNP
rs1213407381 2175 dbSNP
rs1464237329 2177 dbSNP
rs180995027 2179 dbSNP
rs1198313449 2189 dbSNP
rs1250899709 2198 dbSNP
rs1267784815 2199 dbSNP
rs1234105187 2202 dbSNP
rs991801382 2207 dbSNP
rs111578409 2208 dbSNP
rs1014669356 2220 dbSNP
rs1004659010 2222 dbSNP
rs1363298227 2229 dbSNP
rs951852077 2237 dbSNP
rs1272393238 2239 dbSNP
rs1404548802 2239 dbSNP
rs747604565 2241 dbSNP
rs1433406180 2244 dbSNP
rs746584434 2253 dbSNP
rs1390058124 2262 dbSNP
rs1388340924 2270 dbSNP
rs867155362 2270 dbSNP
rs188157352 2272 dbSNP
rs1326242395 2275 dbSNP
rs1341572493 2276 dbSNP
rs1248851957 2288 dbSNP
rs1293305804 2288 dbSNP
rs900268845 2289 dbSNP
rs1356663023 2291 dbSNP
rs1040117275 2299 dbSNP
rs570762393 2300 dbSNP
rs1175247100 2306 dbSNP
rs1249611273 2313 dbSNP
rs1445166855 2314 dbSNP
rs1185400634 2316 dbSNP
rs923750902 2317 dbSNP
rs900392713 2318 dbSNP
rs554096421 2327 dbSNP
rs1356513909 2329 dbSNP
rs149277814 2331 dbSNP
rs1460701091 2332 dbSNP
rs1428538701 2333 dbSNP
rs1407384105 2342 dbSNP
rs1421600638 2355 dbSNP
rs552982502 2357 dbSNP
rs754659651 2362 dbSNP
rs915129198 2364 dbSNP
rs991231855 2370 dbSNP
rs1308864975 2386 dbSNP
rs1202092621 2388 dbSNP
rs1250541159 2389 dbSNP
rs891819535 2393 dbSNP
rs1205410029 2394 dbSNP
rs1241228341 2396 dbSNP
rs1444030767 2401 dbSNP
rs1187159619 2409 dbSNP
rs1253381036 2409 dbSNP
rs959343867 2413 dbSNP
rs1426955436 2417 dbSNP
rs1035081372 2419 dbSNP
rs751211495 2422 dbSNP
rs1471179712 2428 dbSNP
rs904615792 2429 dbSNP
rs961549383 2437 dbSNP
rs1220969804 2438 dbSNP
rs1016177270 2441 dbSNP
rs1005838494 2444 dbSNP
rs548796575 2445 dbSNP
rs1219665099 2454 dbSNP
rs1294410286 2456 dbSNP
rs185001684 2457 dbSNP
rs993109007 2464 dbSNP
rs1261075058 2479 dbSNP
rs1460791219 2487 dbSNP
rs1298445439 2490 dbSNP
rs867842489 2491 dbSNP
rs1186109041 2492 dbSNP
rs766163485 2496 dbSNP
rs1430276065 2501 dbSNP
rs1481570725 2502 dbSNP
rs1226825546 2509 dbSNP
rs569660463 2510 dbSNP
rs1174692985 2511 dbSNP
rs1028549394 2512 dbSNP
rs1304635896 2517 dbSNP
rs995854343 2518 dbSNP
rs572232755 2527 dbSNP
rs1040169751 2528 dbSNP
rs1346383817 2532 dbSNP
rs944435425 2549 dbSNP
rs902381547 2550 dbSNP
rs1345724467 2553 dbSNP
rs1406430928 2554 dbSNP
rs1276671623 2558 dbSNP
rs1344107343 2566 dbSNP
rs1224205276 2567 dbSNP
rs1042621865 2573 dbSNP
rs1027423329 2574 dbSNP
rs946531352 2587 dbSNP
rs1215131178 2591 dbSNP
rs964602138 2595 dbSNP
rs1490901333 2596 dbSNP
rs1355751903 2597 dbSNP
rs1166704014 2605 dbSNP
rs1268559006 2611 dbSNP
rs546318707 2612 dbSNP
rs1018797153 2616 dbSNP
rs1406450380 2618 dbSNP
rs1395551361 2620 dbSNP
rs1195291656 2625 dbSNP
rs1157494909 2628 dbSNP
rs1008806732 2635 dbSNP
rs891787367 2643 dbSNP
rs1300919415 2644 dbSNP
rs1330257353 2656 dbSNP
rs1380520117 2660 dbSNP
rs1281120882 2664 dbSNP
rs1265586521 2666 dbSNP
rs1031601581 2670 dbSNP
rs1000157116 2676 dbSNP
rs904583488 2678 dbSNP
rs138544165 2679 dbSNP
rs1220455206 2682 dbSNP
rs948888874 2687 dbSNP
rs1253146874 2689 dbSNP
rs915162366 2690 dbSNP
rs990724120 2691 dbSNP
rs938043591 2697 dbSNP
rs369039291 2701 dbSNP
rs1184811690 2704 dbSNP
rs982201867 2707 dbSNP
rs1445961972 2713 dbSNP
rs867183829 2716 dbSNP
rs961435603 2717 dbSNP
rs1389541388 2722 dbSNP
rs563938173 2726 dbSNP
rs1330637559 2728 dbSNP
rs375809472 2729 dbSNP
rs1445887250 2740 dbSNP
rs750248593 2743 dbSNP
rs930337985 2755 dbSNP
rs1385027574 2770 dbSNP
rs984711328 2772 dbSNP
rs193012438 2780 dbSNP
rs1300225260 2797 dbSNP
rs1391597603 2798 dbSNP
rs1340277339 2804 dbSNP
rs920324709 2812 dbSNP
rs527411011 2815 dbSNP
rs1029019526 2824 dbSNP
rs997081572 2825 dbSNP
rs1245537292 2826 dbSNP
rs371842949 2836 dbSNP
rs1408637562 2858 dbSNP
rs150110213 2869 dbSNP
rs1018765799 2870 dbSNP
rs1169300778 2875 dbSNP
rs1008534184 2886 dbSNP
rs761878390 2889 dbSNP
rs1376846909 2890 dbSNP
rs1408175385 2902 dbSNP
rs1450405436 2905 dbSNP
rs1333585287 2911 dbSNP
rs1031570329 2913 dbSNP
rs1175707748 2916 dbSNP
rs1268642007 2917 dbSNP
rs1317627379 2919 dbSNP
rs1042115399 2923 dbSNP
rs1265433850 2926 dbSNP
rs1460369798 2937 dbSNP
rs576708744 2939 dbSNP
rs750659563 2947 dbSNP
rs1254796872 2948 dbSNP
rs1447087672 2957 dbSNP
rs1194832816 2960 dbSNP
rs1054991668 2961 dbSNP
rs1260613457 2964 dbSNP
rs904553357 2965 dbSNP
rs1477317382 2966 dbSNP
rs937929160 2971 dbSNP
rs1176844548 2972 dbSNP
rs928004417 2985 dbSNP
rs1431246925 3006 dbSNP
rs1468154597 3008 dbSNP
rs1171938761 3022 dbSNP
rs1254179926 3024 dbSNP
rs1384027095 3025 dbSNP
rs1023453205 3027 dbSNP
rs1046391539 3028 dbSNP
rs34158315 3031 dbSNP
rs546189484 3032 dbSNP
rs1321875378 3042 dbSNP
rs908631205 3043 dbSNP
rs546239 3044 dbSNP
rs1343382194 3045 dbSNP
rs142395990 3050 dbSNP
rs1206357186 3057 dbSNP
rs760774301 3062 dbSNP
rs1318367576 3063 dbSNP
rs1286030704 3082 dbSNP
rs757556552 3086 dbSNP
rs1270703806 3088 dbSNP
rs975696064 3107 dbSNP
rs1048704025 3108 dbSNP
rs550502088 3110 dbSNP
rs5795654 3110 dbSNP
rs965625900 3122 dbSNP
rs755553233 3123 dbSNP
rs1360045918 3126 dbSNP
rs533914167 3128 dbSNP
rs1425476480 3147 dbSNP
rs1019838765 3157 dbSNP
rs185340595 3169 dbSNP
rs966374390 3170 dbSNP
rs1355518554 3171 dbSNP
rs1237608910 3176 dbSNP
rs1314733128 3180 dbSNP
rs775621067 3181 dbSNP
rs987244492 3183 dbSNP
rs1293532796 3184 dbSNP
rs1010638991 3186 dbSNP
rs955886737 3202 dbSNP
rs1487354884 3208 dbSNP
rs1289247567 3211 dbSNP
rs893671817 3213 dbSNP
rs1251055689 3215 dbSNP
rs1420792243 3220 dbSNP
rs1357095806 3223 dbSNP
rs1176713024 3230 dbSNP
rs554635968 3231 dbSNP
rs1445345432 3241 dbSNP
rs1165647750 3246 dbSNP
rs1455105069 3247 dbSNP
rs367897961 3247 dbSNP
rs1414502157 3250 dbSNP
rs1157171062 3251 dbSNP
rs1472331721 3253 dbSNP
rs1418646789 3256 dbSNP
rs1054877916 3259 dbSNP
rs1190301781 3263 dbSNP
rs1441195815 3272 dbSNP
rs1001961625 3276 dbSNP
rs969121682 3277 dbSNP
rs1375469434 3279 dbSNP
rs1246105819 3288 dbSNP
rs1206125025 3295 dbSNP
rs772351275 3298 dbSNP
rs906464822 3301 dbSNP
rs193154004 3302 dbSNP
rs1243687144 3313 dbSNP
rs1251614954 3325 dbSNP
rs569758389 3325 dbSNP
rs1035789514 3326 dbSNP
rs960087098 3326 dbSNP
rs1185467235 3331 dbSNP
rs1411806065 3337 dbSNP
rs887095377 3341 dbSNP
rs117176295 3344 dbSNP
rs1207698653 3351 dbSNP
rs1375075946 3357 dbSNP
rs539371954 3371 dbSNP
rs921313581 3392 dbSNP
rs1407448750 3394 dbSNP
rs975581616 3408 dbSNP
rs944164322 3412 dbSNP
rs79269735 3414 dbSNP
rs900089483 3415 dbSNP
rs1295886486 3426 dbSNP
rs187139985 3427 dbSNP
rs371936398 3430 dbSNP
rs1216540654 3435 dbSNP
rs527268013 3444 dbSNP
rs561812533 3453 dbSNP
rs1205552537 3455 dbSNP
rs989670860 3458 dbSNP
rs1482971374 3475 dbSNP
rs957821729 3490 dbSNP
rs911614559 3493 dbSNP
rs1476992724 3501 dbSNP
rs1296152886 3506 dbSNP
rs1430502229 3518 dbSNP
rs1033352598 3523 dbSNP
rs1002002760 3525 dbSNP
rs372253235 3529 dbSNP
rs906359783 3529 dbSNP
rs924488074 3536 dbSNP
rs934477750 3536 dbSNP
rs979079584 3536 dbSNP
rs968631050 3537 dbSNP
rs1318850161 3538 dbSNP
rs915831753 3539 dbSNP
rs1276457582 3542 dbSNP
rs1216563245 3543 dbSNP
rs1311630614 3543 dbSNP
rs1024869875 3550 dbSNP
rs1004129664 3554 dbSNP
rs1262609686 3559 dbSNP
rs1487423119 3562 dbSNP
rs991476653 3567 dbSNP
rs548310139 3571 dbSNP
rs1481640448 3582 dbSNP
rs1189934894 3588 dbSNP
rs1425051487 3589 dbSNP
rs1401833184 3597 dbSNP
rs1456910450 3601 dbSNP
rs1048393806 3602 dbSNP
rs531396287 3605 dbSNP
rs960056303 3608 dbSNP
rs1035758857 3620 dbSNP
rs2186656 3620 dbSNP
rs1297209795 3623 dbSNP
rs931273307 3624 dbSNP
rs1004337334 3625 dbSNP
rs1272909066 3626 dbSNP
rs1395409556 3628 dbSNP
rs1165086081 3631 dbSNP
rs562956624 3632 dbSNP
rs1368437975 3643 dbSNP
rs1351604478 3646 dbSNP
rs951517093 3649 dbSNP
rs1292805700 3650 dbSNP
rs899931742 3659 dbSNP
rs1194489391 3666 dbSNP
rs1039786524 3672 dbSNP
rs1470793292 3690 dbSNP
rs1179481081 3695 dbSNP
rs1437316384 3703 dbSNP
rs996079499 3703 dbSNP
rs1157626132 3707 dbSNP
rs1246573552 3710 dbSNP
rs1208432318 3713 dbSNP
rs1406776934 3715 dbSNP
rs1321336080 3716 dbSNP
rs1468655451 3717 dbSNP
rs1291523925 3721 dbSNP
rs1207580923 3722 dbSNP
rs1354998875 3723 dbSNP
rs1239485332 3724 dbSNP
rs546350962 3725 dbSNP
rs1229498078 3726 dbSNP
rs1362847692 3728 dbSNP
rs1207197803 3729 dbSNP
rs1289544472 3729 dbSNP
rs1296604844 3732 dbSNP
rs1236912389 3733 dbSNP
rs771308413 3735 dbSNP
rs1457749748 3737 dbSNP
rs1441287554 3738 dbSNP
rs912720917 3741 dbSNP
rs978110062 3744 dbSNP
rs1385390438 3749 dbSNP
rs1473567862 3756 dbSNP
rs946315347 3757 dbSNP
rs1161100383 3759 dbSNP
rs1410345136 3760 dbSNP
rs1172615081 3762 dbSNP
rs1397985094 3766 dbSNP
rs1446027577 3768 dbSNP
rs1007169048 3771 dbSNP
rs1372026650 3772 dbSNP
rs1446011565 3774 dbSNP
rs1283858944 3779 dbSNP
rs1476185203 3790 dbSNP
rs914768135 3800 dbSNP
rs1403726873 3817 dbSNP
rs577497369 3820 dbSNP
rs989166715 3822 dbSNP
rs957911048 3824 dbSNP
rs1390091521 3834 dbSNP
rs111370838 3848 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' ------------guUGCUGCUc 3'
1 - 10
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_ControlA_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control A
Location of target site ENST00000310343.9 | 3UTR | GUUGCUGCUCUGGCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE14794 Lymphoblastoid cells -0.337 5.8e-4 -0.219 1.9e-2 90 Click to see details
GSE19783 ER- ER- breast cancer 0.347 8.7e-4 0.281 6.1e-3 79 Click to see details
GSE19536 Breast cancer 0.259 4.6e-3 0.166 4.9e-2 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.495 1.3e-2 -0.731 1.3e-4 20 Click to see details
GSE21032 Prostate cancer 0.204 3.2e-2 0.163 7.0e-2 83 Click to see details
GSE38226 Liver fibrosis -0.401 3.6e-2 -0.229 1.6e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer -0.351 6.5e-2 -0.332 7.6e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.273 9.8e-2 0.248 1.2e-1 24 Click to see details
GSE17498 Multiple myeloma 0.159 1.6e-1 0.008 4.8e-1 40 Click to see details
GSE21849 B cell lymphoma -0.186 1.7e-1 0.379 2.1e-2 29 Click to see details
GSE28544 Breast cancer -0.183 2.0e-1 -0.361 4.2e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.176 2.0e-1 0.088 3.4e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.103 2.1e-1 -0.088 2.4e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.145 2.1e-1 0.084 3.2e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.107 3.6e-1 -0.275 1.8e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.07 3.7e-1 -0.021 4.6e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.068 3.8e-1 0.024 4.6e-1 23 Click to see details
GSE17306 Multiple myeloma -0.032 4.1e-1 -0.081 2.9e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.056 4.3e-1 -0.042 4.5e-1 12 Click to see details
GSE27834 Pluripotent stem cells 0.028 4.6e-1 0.056 4.2e-1 16 Click to see details
GSE27834 Pluripotent stem cells 0.028 4.6e-1 0.056 4.2e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.638 0 0.591 0 32 Click to see details
BLCA 0.57 0.01 0.449 0.03 18 Click to see details
PRAD 0.258 0.04 0.144 0.16 50 Click to see details
THCA -0.196 0.07 -0.243 0.03 59 Click to see details
PAAD -0.856 0.07 -0.400 0.3 4 Click to see details
CHOL -0.525 0.07 -0.433 0.12 9 Click to see details
KICH -0.272 0.09 -0.154 0.23 25 Click to see details
BRCA -0.111 0.16 -0.145 0.09 84 Click to see details
PCPG -0.854 0.17 -0.500 0.33 3 Click to see details
UCEC 0.187 0.22 0.151 0.27 19 Click to see details
LIHC 0.109 0.23 0.145 0.16 49 Click to see details
COAD -0.253 0.27 -0.048 0.46 8 Click to see details
KIRC -0.066 0.3 -0.029 0.41 68 Click to see details
HNSC 0.082 0.3 0.091 0.28 42 Click to see details
CESC -0.577 0.3 -0.500 0.33 3 Click to see details
ESCA -0.07 0.42 -0.427 0.1 11 Click to see details
KIRP -0.025 0.45 -0.047 0.4 32 Click to see details
LUSC -0.009 0.48 -0.036 0.42 38 Click to see details
LUAD 0.016 0.48 -0.077 0.41 12 Click to see details
LUAD 0.016 0.48 -0.077 0.41 12 Click to see details
LUAD 0.016 0.48 -0.077 0.41 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*