miRTarBase - #MIRT709368 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SPECC1   
Synonyms CYTSB, HCMOGT-1, HCMOGT1, NSP
Description sperm antigen with calponin homology and coiled-coil domains 1
Transcript NM_001033554   
Other Transcripts NM_001033553 , NM_001033555 , NM_152904   
Expression
Putative miRNA Targets on SPECC1
3'UTR of SPECC1
(miRNA target sites are highlighted)
>SPECC1|NM_001033554|3'UTR
   1 CAGAGCATTTGGTGGAAGAAAGACAGCCCAGCTCTTGCCATGATTGGGAGCCGCAGCCATCTCTAGATGAAAGGGGGAAT
  81 GTGTAGAGGAGAAATTGCCTCTTTATAAAGAGCCCAGTTGTCTCCTTGTGACATTCTCTGTTTCTCAGAGTCATTGCCGT
 161 CGAGTCTCTGCTTTTTGTCCACATTTTGGGATCAGCTTACTGCATGATCAAAGATGATGTTTCCCTCTTTTTACTTTTCC
 241 TCAGAAGATTGAGCTGTCTTTTATTTGGAGAATAAAATGAAGTTCTGAAAAAAACAAAGTACAAGTCTTATGAAAAGTTA
 321 TTTGCAGCTGGAGTGCTGAAAAGGGCACAGTGGCAGAGCAGATGCAGAGCTGGGTACAGCGCAGGCCCGAGTTCTTTTGT
 401 TTTTTGTTGTTGTTGTTGTTGTTGTTTTGTTTTGTTTTTTTTTTTTTTTTGAGACAGAGTTTCACTCTTGTTGCCCAGGC
 481 TGGAGTGCAATGGTACGATCTCGGCTCACTGCAACCTCTGCCTCCCGGGTTCAAGTGATTCTCTTGCCTCAGCCTTCCAA
 561 GTAGCTGGAATTACAGGCGCCTGCCACCACACCCAGCTAATTTTTGTATTGTTAGTAGAGATGGGGTTTCACCGTGTTGG
 641 CCAGGCTGCTCTTGAACTCCTGACCTCAGGTGATCCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCAC
 721 CGCACCCAGAACCTAAGGCCCAAGTTCTACTTTTTGGTGTTCATTTCTCTGCTTCCTTTTGATCGTGGTGTCTGATCATC
 801 TTGGAATTCACATTACTCAAGGCAAAATAGGAAGCCATCTGCGTGATGTCACATTCCGAAGAAGTCAGAAGGTTCGGCGA
 881 GTTGGAGCTTTACTCTTGTTGCCCAGGCTAGAGTGCAGTGGTGCGATCTTGGCTCATTGCAAGCTCCGCTTCCTGGGTTT
 961 AAGCTATTCTCCTGCCTTGGCCTCCCAAGTAGCTGGGATTACAGGCATGTGCCGTCACTCCTGGCTAATTTTGTATTTTT
1041 AGTAGAGATGCAATTTCACCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATCTGGCCGCCTCAGCCTCCC
1121 AAAGTGCTGGGATTACAGGCTTGAGACCCCATGTCTGGCCCCTTCTGTGGGGTCTTGATTGAGCCCCTTCACTTGGAGTC
1201 TGACTTCATTACCTCGTCTGAAACAAGGTGCCTCCAAGCTTTGGGTTGATTTCCAGAATCTTGTTGGGTTAAACATAAGT
1281 AGAAGTTTGATCATAAAGGATGTTATTAAGCCGGATAGGTAAGCACGGTGACAATGGCAATAGAAATCTAATGGAAAACG
1361 ATTGAATGACAACTACACCAAAGTTTCATGGATGAAACTCACCCCAGAAACTTAGTGTTCAAATCAGAGTGATACACAAT
1441 TCAAAATGTGATTTTAAACTTCTGGAAATATGTGTGTTTGTGAAGATCCAAATCCAATTCAGCAACCTCCATCAGGCAGA
1521 AACCTTCTGCAATCCTCACATGAGGAACTGGTTCACAGTGTACACAGCATGGAGCCATTAGTGACGTTATCCAAAGGATG
1601 AGACAAGACAAAAGTTACTGTCTAATAAAAGGAAAATTAGGAACAGGAATGCTCTTTAAACTCAGGAAGATCTTTTGGGG
1681 TGTCAAACTGGACAGCACAGAATCATTAGAAAAATTAGCTTGGCGTGAGAAGAGACATTGAGGTCTTCTCTGTAAAATTT
1761 ACTTAGATACTTGTGAATAGGACTGAAATTTATATTTTGGGCACTCTTTACCTCAGATTCAGAGTTCTTAGGATTATTTA
1841 AAATTCATTTGCTGGATGTTTTCAAGTATAAACAATAAGAAAACTGCAACTTCAACTTAAAAGGCACTGCTGTATTTGCA
1921 CCCTATATTTTGACCTGTCGTTAGGTACTGTTGAATATTTTTATCTGTAAGCATTTATGAAGTGCAAAATAAACATGTTA
2001 TTATATAGAAGCGTCTGCTGCTTAGTTTTAATCACCAGCTACGTTTCTGCAGGGCCTTTATGTCGTTTTGTTCTACATTT
2081 TTTTCTGAATACAGTTTCAGAACTTCAAAGTCACATCAAGTAACTAGAATTTGAGGTAGAAAAAAGCTGGATGTAAGTTG
2161 TAAATAGGAGGTTGACATGGAATATGAACAGTTTCATTAGTAGAACAAAAGGGCATGGAGTAAAAATGCTAATTTTGCAT
2241 AAATTTTTAAAACTCTAGGGTCTCAGAAAATATAGCATGGACTTAAAGTCTAGATGTGTTTTGTTGACATTTAAATATGA
2321 ATAGATTGATGATTTAATGTATTGGATTTTTTCTTAATTATGAAGTATTATTTAGGTATACTAATAACAAAATGGAGACG
2401 TGTGAAGAAAAATATTAATCTTTCTTCTCCCTCAGTACCACCTGTGAGGAAATCAGTGTTAACAGTGTGTACATTTTTCT
2481 TTACTCATGAATATGTATAGGGTTCATTTTCATATTTTTAATAAAAATTGGATTATATTCTTTTCAGTAAAAAAAAAAAA
2561 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUA--ACAGUGUGAGGu 5'
            | |  |:|  |||||||:||| 
Target 5' ccATCTGCGTGATGTCACATTCCg 3'
835 - 858 146.00 -19.30
2
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              | || |||| |||:||: 
Target 5' ttgtCTCC-TTGTGACATTCTc 3'
118 - 138 129.00 -13.80
3
miRNA  3' guuUGU-GGUA-ACAG-UGUGAGGu 5'
             |||  ||| || |  |||||| 
Target 5' attACAGGCATGTGCCGTCACTCCt 3'
998 - 1022 123.00 -16.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30503469 29 COSMIC
COSN20122749 51 COSMIC
COSN30161663 90 COSMIC
COSN20113678 120 COSMIC
COSN24867530 150 COSMIC
COSN18123493 196 COSMIC
COSN5414813 324 COSMIC
COSN7161675 438 COSMIC
COSN5414814 785 COSMIC
COSN15692250 995 COSMIC
COSN23082128 1085 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1355567517 8 dbSNP
rs975379481 12 dbSNP
rs779412971 16 dbSNP
rs1279439086 18 dbSNP
rs772273974 21 dbSNP
rs1294351309 23 dbSNP
rs371421762 25 dbSNP
rs1447754795 29 dbSNP
rs748637082 30 dbSNP
rs756779930 33 dbSNP
rs1239253499 38 dbSNP
rs1479808403 41 dbSNP
rs780900551 45 dbSNP
rs1251770505 46 dbSNP
rs541532626 52 dbSNP
rs769637797 53 dbSNP
rs547335614 54 dbSNP
rs1434836748 59 dbSNP
rs768365404 60 dbSNP
rs775175656 62 dbSNP
rs909002255 63 dbSNP
rs774292773 64 dbSNP
rs761785886 69 dbSNP
rs1243503255 73 dbSNP
rs760466130 73 dbSNP
rs773344135 74 dbSNP
rs940429143 76 dbSNP
rs139284091 77 dbSNP
rs766569548 78 dbSNP
rs1220851798 79 dbSNP
rs754013388 81 dbSNP
rs755333478 89 dbSNP
rs762014006 95 dbSNP
rs150007419 98 dbSNP
rs1245719905 102 dbSNP
rs759014025 102 dbSNP
rs1459390512 104 dbSNP
rs780845506 108 dbSNP
rs1228118142 110 dbSNP
rs1252733821 112 dbSNP
rs1478673437 114 dbSNP
rs918712067 116 dbSNP
rs3214214 118 dbSNP
rs397710392 118 dbSNP
rs397759928 118 dbSNP
rs934279073 132 dbSNP
rs1364706595 135 dbSNP
rs1318690509 138 dbSNP
rs1469346343 146 dbSNP
rs1395136202 147 dbSNP
rs1321222435 151 dbSNP
rs940735506 155 dbSNP
rs1252669958 158 dbSNP
rs1403418944 159 dbSNP
rs1051257734 160 dbSNP
rs890022600 162 dbSNP
rs192786248 163 dbSNP
rs146740583 164 dbSNP
rs1387931847 168 dbSNP
rs1194961630 169 dbSNP
rs1468489456 178 dbSNP
rs1360972864 180 dbSNP
rs1054381655 181 dbSNP
rs1247822445 182 dbSNP
rs893253826 191 dbSNP
rs1221419355 192 dbSNP
rs1010700914 205 dbSNP
rs1023933858 212 dbSNP
rs1020116166 214 dbSNP
rs1229585713 216 dbSNP
rs1285098317 221 dbSNP
rs1341808146 225 dbSNP
rs971611863 238 dbSNP
rs1321260989 243 dbSNP
rs1222380636 251 dbSNP
rs1284302828 253 dbSNP
rs538332059 270 dbSNP
rs557781987 271 dbSNP
rs1428790625 292 dbSNP
rs906373500 294 dbSNP
rs958610900 295 dbSNP
rs73303599 297 dbSNP
rs1423901453 300 dbSNP
rs1016310985 305 dbSNP
rs961824207 309 dbSNP
rs972200800 310 dbSNP
rs1235101308 311 dbSNP
rs918776059 312 dbSNP
rs1241941778 315 dbSNP
rs1490615567 322 dbSNP
rs1213239792 324 dbSNP
rs934188961 327 dbSNP
rs986910680 328 dbSNP
rs1312964874 329 dbSNP
rs553505808 334 dbSNP
rs1480371911 336 dbSNP
rs1375448903 343 dbSNP
rs553669543 347 dbSNP
rs6587060 348 dbSNP
rs554274509 350 dbSNP
rs1466273751 352 dbSNP
rs542489024 353 dbSNP
rs975032687 366 dbSNP
rs1054391524 371 dbSNP
rs922209995 374 dbSNP
rs893084791 379 dbSNP
rs1183473172 381 dbSNP
rs1158649913 382 dbSNP
rs1344446028 384 dbSNP
rs77710816 389 dbSNP
rs187701571 390 dbSNP
rs1318759479 400 dbSNP
rs987659684 400 dbSNP
rs1268723556 401 dbSNP
rs1326963697 404 dbSNP
rs1378000980 404 dbSNP
rs1396391226 404 dbSNP
rs371945933 404 dbSNP
rs374557571 404 dbSNP
rs796622034 404 dbSNP
rs907269098 404 dbSNP
rs373309612 407 dbSNP
rs1343600477 408 dbSNP
rs1034177857 410 dbSNP
rs1279680148 412 dbSNP
rs545099070 413 dbSNP
rs1352178180 415 dbSNP
rs894405071 417 dbSNP
rs151289416 420 dbSNP
rs1037766262 421 dbSNP
rs200924467 421 dbSNP
rs1359640693 422 dbSNP
rs1255763372 424 dbSNP
rs1180291042 427 dbSNP
rs1428466384 429 dbSNP
rs1208169979 430 dbSNP
rs1248774074 430 dbSNP
rs1274902445 431 dbSNP
rs948014258 431 dbSNP
rs1225223253 433 dbSNP
rs1267148312 434 dbSNP
rs10713362 435 dbSNP
rs1166172112 435 dbSNP
rs1295748902 435 dbSNP
rs1310178407 435 dbSNP
rs1491459886 435 dbSNP
rs796436179 435 dbSNP
rs865802064 435 dbSNP
rs1458760597 436 dbSNP
rs1491110611 436 dbSNP
rs1490342704 437 dbSNP
rs1045070495 438 dbSNP
rs1463555362 439 dbSNP
rs906467259 439 dbSNP
rs562224309 440 dbSNP
rs1348548778 441 dbSNP
rs1386098109 442 dbSNP
rs1052233765 443 dbSNP
rs1206345049 445 dbSNP
rs892278262 446 dbSNP
rs1225570137 451 dbSNP
rs76278234 451 dbSNP
rs80307578 452 dbSNP
rs1423983450 456 dbSNP
rs1329455669 457 dbSNP
rs770251760 459 dbSNP
rs1337079549 460 dbSNP
rs1439414695 463 dbSNP
rs1387909749 465 dbSNP
rs1390629200 465 dbSNP
rs1278401693 466 dbSNP
rs527308112 477 dbSNP
rs1383098571 478 dbSNP
rs1431944878 480 dbSNP
rs1010616825 484 dbSNP
rs1290088040 485 dbSNP
rs1168144046 491 dbSNP
rs1359166932 497 dbSNP
rs773736287 502 dbSNP
rs547394609 503 dbSNP
rs560801207 504 dbSNP
rs1432583675 507 dbSNP
rs1265182063 513 dbSNP
rs1197348501 521 dbSNP
rs1483230491 525 dbSNP
rs542021462 527 dbSNP
rs1202631720 529 dbSNP
rs1021967965 536 dbSNP
rs963822897 545 dbSNP
rs996953681 549 dbSNP
rs1331036421 574 dbSNP
rs1299747601 576 dbSNP
rs1029311752 579 dbSNP
rs1006103301 580 dbSNP
rs2703779 592 dbSNP
rs1173304511 596 dbSNP
rs1465553253 598 dbSNP
rs962165489 602 dbSNP
rs1184199847 603 dbSNP
rs973491609 607 dbSNP
rs368917865 609 dbSNP
rs1179732115 612 dbSNP
rs1383226454 615 dbSNP
rs371770774 616 dbSNP
rs548115659 622 dbSNP
rs766555618 625 dbSNP
rs1342200694 631 dbSNP
rs1254797025 632 dbSNP
rs948145694 634 dbSNP
rs755098786 635 dbSNP
rs1288184984 636 dbSNP
rs1408385786 644 dbSNP
rs1408092297 652 dbSNP
rs1335040576 654 dbSNP
rs1395554282 663 dbSNP
rs765017868 671 dbSNP
rs145601167 672 dbSNP
rs986963085 678 dbSNP
rs1457758030 681 dbSNP
rs939290985 683 dbSNP
rs113062303 685 dbSNP
rs146508612 698 dbSNP
rs1454306340 701 dbSNP
rs1052266994 703 dbSNP
rs942955679 704 dbSNP
rs1312443678 708 dbSNP
rs1440309275 710 dbSNP
rs1381509112 711 dbSNP
rs1208800400 712 dbSNP
rs990782110 715 dbSNP
rs914818666 717 dbSNP
rs1272248387 722 dbSNP
rs1358859198 723 dbSNP
rs1043562591 725 dbSNP
rs538013962 733 dbSNP
rs899602074 737 dbSNP
rs551475538 750 dbSNP
rs1263878552 754 dbSNP
rs1322720727 764 dbSNP
rs1435819554 768 dbSNP
rs1387832159 769 dbSNP
rs1318406734 770 dbSNP
rs1406910016 772 dbSNP
rs1414310277 785 dbSNP
rs1462708134 789 dbSNP
rs571376336 790 dbSNP
rs533957480 795 dbSNP
rs955043329 807 dbSNP
rs1188649481 810 dbSNP
rs1448291882 812 dbSNP
rs35902356 821 dbSNP
rs1009154528 827 dbSNP
rs1214325206 829 dbSNP
rs1453806804 831 dbSNP
rs907316314 838 dbSNP
rs1015150964 840 dbSNP
rs553732839 843 dbSNP
rs1055638937 844 dbSNP
rs1229256890 854 dbSNP
rs1193675963 859 dbSNP
rs920761129 867 dbSNP
rs867264028 870 dbSNP
rs894290359 873 dbSNP
rs1006155670 874 dbSNP
rs191380712 875 dbSNP
rs1169863413 876 dbSNP
rs1322730455 879 dbSNP
rs980857225 880 dbSNP
rs927958987 884 dbSNP
rs1428667621 886 dbSNP
rs939323596 890 dbSNP
rs988096567 892 dbSNP
rs1470676719 896 dbSNP
rs533397379 897 dbSNP
rs897723388 899 dbSNP
rs1198611796 903 dbSNP
rs183513530 908 dbSNP
rs1277076755 910 dbSNP
rs1206191116 912 dbSNP
rs1043979192 913 dbSNP
rs556145682 925 dbSNP
rs374855231 926 dbSNP
rs1325019040 934 dbSNP
rs899634144 935 dbSNP
rs576204479 937 dbSNP
rs1402899037 939 dbSNP
rs1352137172 941 dbSNP
rs954467545 948 dbSNP
rs1007223122 949 dbSNP
rs545198160 959 dbSNP
rs558714147 967 dbSNP
rs555130769 970 dbSNP
rs751444331 972 dbSNP
rs1426510384 982 dbSNP
rs1326206053 983 dbSNP
rs1479725486 985 dbSNP
rs549728784 989 dbSNP
rs1183334626 994 dbSNP
rs1003915078 996 dbSNP
rs1231331906 998 dbSNP
rs1212359012 1003 dbSNP
rs572155543 1006 dbSNP
rs1277872836 1008 dbSNP
rs1262545838 1011 dbSNP
rs1331114090 1012 dbSNP
rs964149678 1014 dbSNP
rs990318309 1015 dbSNP
rs1408921045 1029 dbSNP
rs1370743234 1030 dbSNP
rs1304169981 1035 dbSNP
rs914849949 1048 dbSNP
rs1358114253 1050 dbSNP
rs541069701 1054 dbSNP
rs1468755093 1059 dbSNP
rs1263665359 1071 dbSNP
rs1445049429 1079 dbSNP
rs560864998 1081 dbSNP
rs928582835 1082 dbSNP
rs529610820 1087 dbSNP
rs1406093729 1088 dbSNP
rs1055860191 1092 dbSNP
rs745310944 1095 dbSNP
rs1483686818 1097 dbSNP
rs113198159 1098 dbSNP
rs1201842864 1103 dbSNP
rs941882278 1108 dbSNP
rs1376552891 1109 dbSNP
rs1227581072 1112 dbSNP
rs1314868556 1117 dbSNP
rs1454029694 1122 dbSNP
rs1037536656 1127 dbSNP
rs897769794 1132 dbSNP
rs1383333226 1136 dbSNP
rs769347900 1139 dbSNP
rs969545317 1140 dbSNP
rs981273957 1141 dbSNP
rs987102347 1144 dbSNP
rs1453538574 1150 dbSNP
rs993392470 1152 dbSNP
rs1167328267 1180 dbSNP
rs1304064435 1184 dbSNP
rs1413255248 1193 dbSNP
rs1181836253 1203 dbSNP
rs1051869070 1208 dbSNP
rs1035147058 1216 dbSNP
rs779246214 1217 dbSNP
rs1208071831 1233 dbSNP
rs1007275273 1235 dbSNP
rs748709571 1240 dbSNP
rs1317585857 1254 dbSNP
rs1241514467 1255 dbSNP
rs772615150 1256 dbSNP
rs1312391847 1265 dbSNP
rs1230010637 1271 dbSNP
rs1365242582 1275 dbSNP
rs913888648 1276 dbSNP
rs1382211151 1280 dbSNP
rs1012194732 1294 dbSNP
rs773534408 1299 dbSNP
rs1021762380 1307 dbSNP
rs1458678404 1310 dbSNP
rs761094982 1313 dbSNP
rs977679380 1314 dbSNP
rs1375846687 1320 dbSNP
rs1292168672 1325 dbSNP
rs1431827588 1326 dbSNP
rs921099031 1327 dbSNP
rs928633287 1328 dbSNP
rs1266139432 1334 dbSNP
rs960057918 1335 dbSNP
rs1051363098 1341 dbSNP
rs1488009403 1344 dbSNP
rs1289187718 1345 dbSNP
rs991468975 1353 dbSNP
rs543314056 1360 dbSNP
rs890918361 1364 dbSNP
rs939739369 1367 dbSNP
rs1224521106 1369 dbSNP
rs563005973 1374 dbSNP
rs1036711719 1378 dbSNP
rs898141446 1387 dbSNP
rs1345320066 1399 dbSNP
rs995501087 1407 dbSNP
rs1361713688 1408 dbSNP
rs916036561 1413 dbSNP
rs1418679576 1414 dbSNP
rs1371397646 1416 dbSNP
rs531954044 1425 dbSNP
rs1027873826 1428 dbSNP
rs1460480416 1433 dbSNP
rs905437226 1436 dbSNP
rs1176655164 1437 dbSNP
rs1002417690 1440 dbSNP
rs1480054403 1454 dbSNP
rs1035134875 1461 dbSNP
rs1329891083 1462 dbSNP
rs1241305502 1463 dbSNP
rs960804835 1466 dbSNP
rs1193593404 1469 dbSNP
rs551535093 1472 dbSNP
rs988153937 1477 dbSNP
rs1293441885 1498 dbSNP
rs1020929293 1503 dbSNP
rs967980864 1506 dbSNP
rs72830194 1510 dbSNP
rs919056424 1512 dbSNP
rs929231028 1517 dbSNP
rs1376467605 1523 dbSNP
rs763757554 1524 dbSNP
rs1051600666 1525 dbSNP
rs189370038 1528 dbSNP
rs1007221525 1529 dbSNP
rs1292280839 1530 dbSNP
rs143004164 1533 dbSNP
rs1427029631 1541 dbSNP
rs759496179 1547 dbSNP
rs1161114719 1548 dbSNP
rs1219357525 1550 dbSNP
rs1010617724 1555 dbSNP
rs1362891754 1583 dbSNP
rs1179271031 1585 dbSNP
rs1022230030 1587 dbSNP
rs1480881850 1588 dbSNP
rs1256316704 1590 dbSNP
rs1036744326 1595 dbSNP
rs1197073195 1603 dbSNP
rs192302725 1605 dbSNP
rs1230648266 1610 dbSNP
rs765382182 1612 dbSNP
rs1330197119 1615 dbSNP
rs931029801 1623 dbSNP
rs536219523 1625 dbSNP
rs1313534315 1630 dbSNP
rs1183812496 1639 dbSNP
rs999417129 1645 dbSNP
rs1451927221 1650 dbSNP
rs1035968491 1651 dbSNP
rs1322412100 1654 dbSNP
rs1457673858 1655 dbSNP
rs1384033434 1663 dbSNP
rs867014877 1665 dbSNP
rs369631020 1669 dbSNP
rs1002854115 1670 dbSNP
rs1368618465 1673 dbSNP
rs75741679 1680 dbSNP
rs185348501 1683 dbSNP
rs1442190046 1687 dbSNP
rs991520742 1688 dbSNP
rs1241868926 1689 dbSNP
rs544102061 1697 dbSNP
rs190191661 1700 dbSNP
rs532959805 1705 dbSNP
rs1296572922 1715 dbSNP
rs1284085951 1721 dbSNP
rs1399601242 1723 dbSNP
rs1203754373 1724 dbSNP
rs1020960453 1725 dbSNP
rs963795218 1726 dbSNP
rs1245375114 1730 dbSNP
rs1000912673 1735 dbSNP
rs973487579 1737 dbSNP
rs1435795087 1742 dbSNP
rs1317413728 1744 dbSNP
rs1315967631 1749 dbSNP
rs1406819364 1751 dbSNP
rs1380784745 1758 dbSNP
rs529299436 1759 dbSNP
rs1028723312 1762 dbSNP
rs919096062 1767 dbSNP
rs1308034532 1768 dbSNP
rs929182501 1772 dbSNP
rs762919199 1793 dbSNP
rs1241982144 1796 dbSNP
rs1191510188 1798 dbSNP
rs181402200 1800 dbSNP
rs911846549 1802 dbSNP
rs943256491 1806 dbSNP
rs1357533836 1807 dbSNP
rs986692520 1807 dbSNP
rs1272705931 1809 dbSNP
rs1203679455 1812 dbSNP
rs79740973 1819 dbSNP
rs1459668046 1821 dbSNP
rs1268298456 1822 dbSNP
rs961167165 1824 dbSNP
rs893449826 1832 dbSNP
rs1302284067 1833 dbSNP
rs751391207 1834 dbSNP
rs1430850633 1849 dbSNP
rs186424039 1855 dbSNP
rs1423080907 1860 dbSNP
rs902242377 1871 dbSNP
rs1044099017 1881 dbSNP
rs1166700952 1887 dbSNP
rs999063549 1896 dbSNP
rs1479275557 1897 dbSNP
rs1035853289 1902 dbSNP
rs896076706 1905 dbSNP
rs1199140448 1919 dbSNP
rs1470353015 1923 dbSNP
rs1489922143 1926 dbSNP
rs1254176267 1935 dbSNP
rs1205339484 1940 dbSNP
rs1338708137 1941 dbSNP
rs1404227869 1942 dbSNP
rs1447514460 1947 dbSNP
rs189458886 1956 dbSNP
rs574389071 1982 dbSNP
rs1282478933 1995 dbSNP
rs963381125 1996 dbSNP
rs1298351346 1998 dbSNP
rs1440984032 1998 dbSNP
rs200745397 1998 dbSNP
rs973795987 2001 dbSNP
rs780921198 2003 dbSNP
rs543022635 2004 dbSNP
rs1176179356 2007 dbSNP
rs1026420719 2014 dbSNP
rs1223625727 2026 dbSNP
rs1264406762 2034 dbSNP
rs750119717 2039 dbSNP
rs755527438 2040 dbSNP
rs1042529999 2042 dbSNP
rs148190603 2043 dbSNP
rs943310141 2044 dbSNP
rs1001343462 2050 dbSNP
rs1243124635 2056 dbSNP
rs1028343497 2063 dbSNP
rs1487046591 2065 dbSNP
rs531893271 2066 dbSNP
rs1452654588 2068 dbSNP
rs915131358 2071 dbSNP
rs1201374817 2087 dbSNP
rs1263110050 2088 dbSNP
rs1008156532 2091 dbSNP
rs946427901 2093 dbSNP
rs961283134 2105 dbSNP
rs1427269806 2107 dbSNP
rs1042444540 2109 dbSNP
rs1391351522 2110 dbSNP
rs923747530 2113 dbSNP
rs1347123158 2116 dbSNP
rs1432640309 2118 dbSNP
rs939048315 2119 dbSNP
rs141228760 2121 dbSNP
rs1405457951 2127 dbSNP
rs565132351 2137 dbSNP
rs1183689010 2150 dbSNP
rs1027223007 2154 dbSNP
rs373548284 2163 dbSNP
rs1013186565 2164 dbSNP
rs1364869751 2166 dbSNP
rs1261160445 2168 dbSNP
rs1218339006 2169 dbSNP
rs1314778377 2171 dbSNP
rs1291519660 2172 dbSNP
rs1246116610 2176 dbSNP
rs748788142 2185 dbSNP
rs1312254025 2187 dbSNP
rs547503299 2196 dbSNP
rs567628195 2197 dbSNP
rs1364696274 2198 dbSNP
rs1289826824 2201 dbSNP
rs1318280381 2202 dbSNP
rs938315394 2213 dbSNP
rs994884343 2214 dbSNP
rs1026702402 2219 dbSNP
rs778816363 2228 dbSNP
rs945613364 2231 dbSNP
rs1042562340 2238 dbSNP
rs950806913 2240 dbSNP
rs1008914829 2244 dbSNP
rs10549056 2253 dbSNP
rs796988661 2253 dbSNP
rs1018747502 2256 dbSNP
rs1245129427 2257 dbSNP
rs964544042 2261 dbSNP
rs1222835387 2273 dbSNP
rs778311047 2274 dbSNP
rs530138601 2277 dbSNP
rs1229967005 2279 dbSNP
rs1008272662 2280 dbSNP
rs1177784106 2281 dbSNP
rs1382120907 2285 dbSNP
rs1360344566 2297 dbSNP
rs1410475984 2304 dbSNP
rs34106745 2310 dbSNP
rs1019610432 2318 dbSNP
rs563407549 2320 dbSNP
rs530812353 2321 dbSNP
rs1161815761 2324 dbSNP
rs1026835178 2325 dbSNP
rs781497672 2333 dbSNP
rs1169694112 2348 dbSNP
rs1426615459 2352 dbSNP
rs1304864825 2357 dbSNP
rs977793722 2359 dbSNP
rs1329219303 2362 dbSNP
rs1435137184 2366 dbSNP
rs1490102919 2366 dbSNP
rs923562264 2368 dbSNP
rs1266307953 2375 dbSNP
rs1279594179 2384 dbSNP
rs939100846 2394 dbSNP
rs979881887 2398 dbSNP
rs1237482417 2400 dbSNP
rs538933068 2400 dbSNP
rs1056195920 2401 dbSNP
rs1306202152 2408 dbSNP
rs1309044495 2412 dbSNP
rs1285662034 2416 dbSNP
rs1224496668 2419 dbSNP
rs1360616159 2422 dbSNP
rs1301491801 2424 dbSNP
rs1393320927 2424 dbSNP
rs916319443 2425 dbSNP
rs1225104751 2428 dbSNP
rs1460407604 2429 dbSNP
rs1408200971 2430 dbSNP
rs959777943 2433 dbSNP
rs1451494850 2439 dbSNP
rs1479973507 2441 dbSNP
rs180926200 2442 dbSNP
rs1234649053 2445 dbSNP
rs912885305 2455 dbSNP
rs1419246302 2463 dbSNP
rs1044953445 2464 dbSNP
rs1193569592 2464 dbSNP
rs141841808 2464 dbSNP
rs755026277 2464 dbSNP
rs1479978768 2465 dbSNP
rs978710069 2467 dbSNP
rs899423490 2473 dbSNP
rs1204759088 2474 dbSNP
rs7220746 2475 dbSNP
rs534773915 2481 dbSNP
rs1047744229 2485 dbSNP
rs1241466637 2489 dbSNP
rs778327195 2492 dbSNP
rs886415787 2498 dbSNP
rs554671019 2501 dbSNP
rs1408269440 2503 dbSNP
rs185148195 2511 dbSNP
rs1469189180 2513 dbSNP
rs889893305 2517 dbSNP
rs1019009788 2524 dbSNP
rs964764177 2531 dbSNP
rs1454055790 2536 dbSNP
rs1412183203 2538 dbSNP
rs1362851641 2541 dbSNP
rs996058415 2547 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |:|||| |   :|||||| 
Target 5' agcAUACCACU---GCACUCCa 3'
1 - 19
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000395530.2 | 3UTR | AGCAUACCACUGCACUCCAGCCUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*