miRTarBase - #MIRT706896 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ST3GAL1   
Synonyms Gal-NAc6S, SIAT4A, SIATFL, ST3GalA, ST3GalA.1, ST3GalIA, ST3GalIA,1, ST3O
Description ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Transcript NM_003033   
Other Transcripts NM_173344   
Expression
Putative miRNA Targets on ST3GAL1
3'UTR of ST3GAL1
(miRNA target sites are highlighted)
>ST3GAL1|NM_003033|3'UTR
   1 CGCAGTGAAGGGCTGAGGATGGACGCACTGTCACACCTCTGCATTTCCAGCCCCAGCATCTTGCTGGAGCCGTTCCATCC
  81 CGGAGCTTGGAGGGGCAGCCTCAGGTGTGTGCCTGGGCACCGCTCACAGCCTCTTGCACCCAGCCGTTGGCAGCATCTAC
 161 TCAGCAAGGTCACTAAGCTCTGCCAGCGTGGCAGAGCATGTCTTGGAACCTGTCTTGAGTGGGGACAACGTCCCCCCACT
 241 GCTGCCCTAGAGCTGGGGAGACGCTGGGAAAGGTTCAACCTCCACACACTAAAATCATTTTGGCTCCTGGGGCAAGCTTG
 321 GGGAATGAATGTGGAAGATGCCTATATTCTGAGAGACAGGACAGTTTCCCAGGAAGATGGGCAGAGACTTGAGTGGCGAT
 401 TACCTCCAGCACAGAGACGTGCCAGGCGGTGTTGGCGCTCGGGGCGAGATGCTGCCCTTCTTTGCACGAAGCCTGGCCTC
 481 TTGCTTGGCGTGATAACCCTGTCATCTTCCCAAAGCTCATTTATGAGCCACCAGAGGCTCCTACCCCAAAGATTTTCACA
 561 GAAACTTGAGGCCAGGTGCCGTGGCTCACACCTGTAATCTGAACACTTTGGGAGGCCGAGGCGGGAGGATCACTTGAGCC
 641 CAGGAGTTCAAGACCAGCCTGGGCAACATAGTGAGACTCCTGTCTCTACAAAAATAAAAGATTTAAAAAAATTAGCCAGG
 721 CACGGTGGCACACACTTGTAGCCCCAGCTACTAGGGAGGCTGAGGAGGGAGGATCTCTTGTGCCTAGGAGTTCGAGGCTG
 801 CAGTGGGCTGTGATCACACCACTGCACTCCAGCCTGGGCAACAGAGTGAGACCCTGTCTCTGAAAAAAAAAAAAAAAGAA
 881 AAGAAAAAAAACCCCAAACTTGGCACCGTGTTTCTGACTCCTGCAGATGCCTCTTCCCAAGCAGTTGTTCCTTTGAGTAG
 961 TCAGTCTCATGGTTCTAATCGTGGCGAGAGCGGATCTGACCACTTCCATGTGCCTTTGTATTTGGGAAAGAAAAGCATGC
1041 ATTGGCTGAAATGAAACAAAAGCCCTTACTTGGGAAAAGGGACCCCCACCAGCGGCCCTGCTTGCTCCGTAGCTGGGAAC
1121 ATCTTTTCTGGTTTCCTGAGCCAGCACCTGAATTGCAACGAAGCTCTGAGGATACTCAACACCACCCAGCAGTGCGTCAG
1201 AATGGAACGTACATTCTCATTCTCAGACTGTTCAATATGGTGCCCGTAACCTCCAAAGCCACACAGGAGGCTGCCAGCAG
1281 CATTTTCCCCAAGGGCCTGAGCTCAGGGTCAAGTCCCTGCTGGCCATCTTGGGGCTGTCACTGGGGGTCTGGGTCAAGGA
1361 CATCCCAGGAATGGTAACTGCCACATACCTCATCTTCTTACTCCCCAGCTACTCTCTTTTCCTCATTAGCCTTCCTGATT
1441 ATTTATTGATTTCTTTTTTTTATTCAACTGACATTGTTTGCACCCTGGCTCTGTTGGTGGTCCTGGTGTTTTAATGAAGC
1521 TTGCCTCACCCAGTAGCTGGGAAATTAGGTGGGGGTGCTTAAGGGAGGTTTGTAGGAGTCCTCGGACGTGGGATATTGGG
1601 GGTATCTAGGGCTTGGATGGTTTGTGGAATGTCCTCAGCATCCTCCCGTCCCAACCCAACCTTCCTTCTTCCTCATTGTG
1681 GACTTGGATTTATTCTCAGGCTAGGAGTCTCCAAAACTCCGTGAAACCTTATTGCTGCTGGGTGTGGAGTGGAGAGTGAC
1761 AGGAATGTGGGGGACGGTGATTGTTGGCTCCAGTTACTAATGTTTAAGCAGAAAAACCACTTTCTTGTTGAAAATATCCC
1841 TGAAAAGGTCGCTGCTGCTTTGAGGAGGCGTGACTTTTTCCTGGTGGAGTGTGACGGAGGCATGGGGCCTGTGCTCCCAG
1921 GCTCGGGGGAGCCCCCTCTGCACACGGGGAGGGAGGAACTTGGGGACATCAGTCATGGGTCACAGGTGGCTTCAGGCCAT
2001 TCACAAGAGTCCCCGGAAGTTGCGTGCCAAGTTTGGTTTTTTCCCTGAATCTCTGCATATGAGCATTTTTCTGGAGAAAG
2081 GACCATAGCTTTTATTAGATTCTCAAAGGTTCAGAATGGGGAATGTGTTAAACAAACCGAAAACCTGTTTCAGCTTTAAA
2161 ATCCTCCAAAACTTTAAAGACTTTTCTTTTTTCTGAGAAAGGCTGGTAAATCACTGAGTCATCATTCAGAACATACAGCC
2241 TCGAAGGGCAGAGCTCACACCCATATATGACGTTAAGAGCTCAACAAATGTTTGTTGAGTGACTGAGTGACCCCAGGGGC
2321 AGACTCCAGATCATCAGACACTGATACAGAGAGCGATGCTATCTCCTCAACTCTCCCTCTTCTCCTAAAAGCTGAGTCTA
2401 TATAGGGATGACAGGCTCAGGCTGAGCAGTCGACTTCTCTGGGTTTTGCTGTGTAAGAATAGGTCCCTCAACATGAAGAT
2481 GTGTCTGCGTCTGAGCCAGATGCTGCCTGGGTCGGTTGCCTGGCCTCCGTCTGGTCTCCCTCCCTCCTACTAGGGTGGTC
2561 AAGCTGTGAGATCTCTTCCAGCCTCCAAATCCAGCTTTCCCATTTTACTGATGAGAAAATCAAGGCCACATTGCAGCTGG
2641 GTGGGGAGTGGAGCGTGACAGGCACGGGAGAGGACAGCGATTGTTGACTCTAGTTCCTGATGTTTAATCAGAAAAACCAC
2721 TTTTCCTGTAGAGCACATTTCCTAAAAGGCTGCTGCTGTGTAGGGAGGTGTGGCCTTTTCCTGGTGCAGTGTGAAGGAGG
2801 GAAGTGACGGGCAGTCGTGAACTGTCTGGGACAGATAGCACAAGTCAGAGTTTGAGCAAAACTAGGGTGTTACCGGCGCT
2881 ATGTTGAAATTGTCTGGAGGCGGGCTTTCCCAGCGAGTCTCCATTCAGCATCTGGAAAAAGTGTAACCAGAATGGAGGTG
2961 TCTGACTCTCCTGTGCTCTCTCAGCGCCGAGCTCTAGCTGCAGGCTGCCTGGGTGGCCTTCTCACACCCTCCCGTGCAGG
3041 AGACTGCATTTCTCTTTCCCACAGCCCAGCAGATAGCTCATTGGCTTAGCAATGGGCACTTAACAGAATCCAGTTGTTGC
3121 AGCCAGAATTAAATGCACCAGTCTGGCTTAAACCAACTGGAACTCATCCCTGGGGTGAAGGTGGCTGGGAATTAGACAAG
3201 AGTGTGTGTTAGCCAAAAGGCACATGCATGCTGTCAGCAGGAGAATGAGGAGCACTGGTTCTGGGCAGGCAGTGGCAGGG
3281 GCTCCCTCAGGCCCCTGATTCCCAGCCCACAGCTCTTTCTACTCTGCAGACAGAGTTCCTTGGAGACTGGCCCTGCATTC
3361 AGGCAGGGAGCAGAGGGGTCCCTGCCTGCAGCACCCAGAGCTGAACCTGAAGCTACAAAGATGGGCTGATGAGGTGGCCC
3441 ATGAGGTGTCAGCAACATCCCAACCCCCTGGGTCTCCCCAGTGAGTCAGGGCACTGATTTGCTATAGCTGGAGCTACATG
3521 CACCTCTCCTCCCCTCAGCCACCTTTTAGGGGAGAAAGGAGGGCAGATTTGTAACCTCTGGTTCTCTGCAGGGATCCTGG
3601 GCTGGAAGAAAGTTCATAAATGGATGAATGCCTTTTAAAACTCCAGCTTTTCCAAGCATCATTCACCAAAGCATTTGGTT
3681 AGGCTTAGAGAGAAAAGCTGGATATGAGAAAATAGAATGTAAAATAGGAGGGAAAAAAAAAAAGAAGGTGGAGAGGGCAG
3761 TTAAGATCTGGGTGATTCTTTAGGGAAACGGCTGGTTGAGAGGCTTTGATGGAATCCCATTCTCTGCTGTGGCCAGAAGG
3841 TGGTGCTAGAGGCCAGTCCCACTTGGATGTGACCCTGGCCTCTGCCAGGATTCAAACCACAAAGAACATTTGGAACTGGG
3921 ATGTTTGCTTTGAAGCAGCCCGAAAACAAGTGAAAGGAAACCAAGATAACTCTCTCTCCCTCCGCTGGCAAGGATCAAAA
4001 ATACCTTGTGCAGGGAAGCCCGAGCCTCGAGGGGCCACTGCCCAGCTAAAGATGACTGGACACCAGCCATGCACCATCAG
4081 GAACCAGCACCTGTCCTCACCCCTGAGAAGAGCCCCGGGGGTATCATTATATCCATCGCAGACATCTGGTTTGCAGCAAA
4161 TGTGGCTACACGCCATCAGGATTATCCTGCCCTGTGGACTGGGCTAGCTAGTTTTGAGATAGAGTCAACCTCCCCATTTT
4241 TGTTTGTCATGAAAACACCAGCTCCTGCACCCCTGGGGTGCTACCTGACACCTGTGCAAAGAAAAGGAGGAAAACTTAGA
4321 AGAAAAGGCAGAGACAGGCAAGACAGCATCTCACAGCTTGTCAGGATCAGGGCATTACCGACTATTTTTTCTTACCAAAA
4401 GAGCACTGAATTTCCTAGGGGAAGGTGAGCCACCTTTACACCTCCTGTCCTCCCTCCCAGCCCGTCAAGCGATCCCATCA
4481 CCCAGCCTCATCACTCAGCTTCTTCCTAGTACAAAACTGCCATCGGTTGTACGTCCTGAGCTGTGGGACGTCAGCTTTAA
4561 CCCTAGCCTGTCTCAGGGCCTCGCCCTCCAGCCCCCCGCCCCTTAGGGTGATCGTGGGTTTCTTCCCTTCCTCCTGCACA
4641 ATCGCTTCCCTTCACTGAATTCCCTTCAAAGCCAAAGTTTCTTGAGCACTTTTTCTTGTGTGCAGTCTTGTGTGTTTGGG
4721 TGTTGGTGTTTTTAAATTTGCTTTCTATTCCCCCCTGCCTCTCTCCATGTCGTTACGCAGCTGAGCACTGGTTGGGATGC
4801 ATTCGAATGACTTCAGCAAGATCCTGCTTTCCTCAGCCCCCGCTCTGTTTTATTTATTGTTTAATATTTCCAATGATCCA
4881 AATCAAAGTGAATAAACAAAGAGCTATTTTATTGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' atcACACCACT---GCACTCCa 3'
813 - 831 144.00 -18.50
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::|| ||| || | ||||| 
Target 5' tgGGCAACATAGTGAGACTCCt 3'
660 - 681 136.00 -14.10
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :|| |||  | || ||||| 
Target 5' gtGACCCCAGGGGCAGACTCCa 3'
2307 - 2328 132.00 -18.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14326975 1 COSMIC
COSN30119538 7 COSMIC
COSN4894125 10 COSMIC
COSN30105163 15 COSMIC
COSN30111491 24 COSMIC
COSN30161818 39 COSMIC
COSN31532919 82 COSMIC
COSN26566114 100 COSMIC
COSN30504369 108 COSMIC
COSN18733203 112 COSMIC
COSN31539640 229 COSMIC
COSN25601167 705 COSMIC
COSN32061432 863 COSMIC
COSN17182238 990 COSMIC
COSN31963011 1095 COSMIC
COSN29759913 1211 COSMIC
COSN20105906 1453 COSMIC
COSN20091865 1540 COSMIC
COSN20927876 1728 COSMIC
COSN4877019 1762 COSMIC
COSN24626101 1774 COSMIC
COSN22027528 1895 COSMIC
COSN21414965 2059 COSMIC
COSN6913689 2568 COSMIC
COSN8067948 2667 COSMIC
COSN17182237 2799 COSMIC
COSN22623120 2875 COSMIC
COSN5675315 2881 COSMIC
COSN23209197 2888 COSMIC
COSN25601166 2915 COSMIC
COSN19578966 3025 COSMIC
COSN29284537 3207 COSMIC
COSN20105904 3464 COSMIC
COSN9256171 3718 COSMIC
COSN20105899 3733 COSMIC
COSN25622567 3733 COSMIC
COSN4923083 3885 COSMIC
COSN20105896 3952 COSMIC
COSN6913688 3973 COSMIC
COSN9599753 4034 COSMIC
COSN8067947 4170 COSMIC
COSN25065667 4368 COSMIC
COSN8067946 4369 COSMIC
COSN4938395 4526 COSMIC
COSN22443121 4636 COSMIC
COSN32210932 4783 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761386475 1 dbSNP
rs372644972 2 dbSNP
rs755120716 4 dbSNP
rs754028236 5 dbSNP
rs766704745 6 dbSNP
rs1300707473 11 dbSNP
rs756327019 12 dbSNP
rs183854192 24 dbSNP
rs115046803 25 dbSNP
rs1268937500 26 dbSNP
rs1208237430 27 dbSNP
rs376638427 28 dbSNP
rs781463721 28 dbSNP
rs1050166504 30 dbSNP
rs1279140824 33 dbSNP
rs951587336 41 dbSNP
rs761745757 47 dbSNP
rs933069023 47 dbSNP
rs1338903511 48 dbSNP
rs557346494 55 dbSNP
rs747777176 55 dbSNP
rs993168847 64 dbSNP
rs539490346 71 dbSNP
rs529290228 72 dbSNP
rs1410769852 73 dbSNP
rs1264154517 77 dbSNP
rs1219152606 79 dbSNP
rs1484713414 81 dbSNP
rs1001873549 82 dbSNP
rs1279764572 88 dbSNP
rs1457374826 104 dbSNP
rs1291648332 105 dbSNP
rs113261692 106 dbSNP
rs1210938269 112 dbSNP
rs905047316 116 dbSNP
rs111656289 118 dbSNP
rs763662465 121 dbSNP
rs1213710946 122 dbSNP
rs949326468 123 dbSNP
rs373894253 128 dbSNP
rs1275462215 130 dbSNP
rs979407348 139 dbSNP
rs553890316 144 dbSNP
rs1412599953 145 dbSNP
rs1052898595 146 dbSNP
rs1481368954 150 dbSNP
rs1182234182 163 dbSNP
rs968906971 169 dbSNP
rs936683638 170 dbSNP
rs1302879562 171 dbSNP
rs1023133617 173 dbSNP
rs925236643 187 dbSNP
rs535328178 188 dbSNP
rs1361348181 191 dbSNP
rs1414264621 208 dbSNP
rs1404485873 218 dbSNP
rs991614831 223 dbSNP
rs960117955 225 dbSNP
rs751050152 229 dbSNP
rs1036153369 230 dbSNP
rs1465429102 232 dbSNP
rs964097416 235 dbSNP
rs1424835424 236 dbSNP
rs865881131 237 dbSNP
rs190331844 239 dbSNP
rs1228107661 240 dbSNP
rs1016209248 247 dbSNP
rs1006086518 250 dbSNP
rs1206436907 261 dbSNP
rs1182448745 262 dbSNP
rs550126048 263 dbSNP
rs1050221951 264 dbSNP
rs1484282771 267 dbSNP
rs951749829 269 dbSNP
rs763732517 276 dbSNP
rs561119281 278 dbSNP
rs540782442 282 dbSNP
rs996121139 290 dbSNP
rs1167837635 303 dbSNP
rs149496241 311 dbSNP
rs1427834345 320 dbSNP
rs1254908978 332 dbSNP
rs1052591408 339 dbSNP
rs1359934878 342 dbSNP
rs186313534 346 dbSNP
rs1367745468 351 dbSNP
rs924929374 359 dbSNP
rs1297442162 364 dbSNP
rs75550731 365 dbSNP
rs527741746 373 dbSNP
rs904932894 379 dbSNP
rs1046244750 390 dbSNP
rs991667094 394 dbSNP
rs775265621 397 dbSNP
rs1013365339 398 dbSNP
rs1465125322 405 dbSNP
rs1333619541 410 dbSNP
rs138029507 418 dbSNP
rs376052351 419 dbSNP
rs1052366445 421 dbSNP
rs936552307 423 dbSNP
rs146251517 427 dbSNP
rs562821196 428 dbSNP
rs1414155941 432 dbSNP
rs1296923480 436 dbSNP
rs544539103 437 dbSNP
rs1320548067 438 dbSNP
rs562105536 440 dbSNP
rs987015018 441 dbSNP
rs759440498 445 dbSNP
rs1343619645 448 dbSNP
rs1460206707 449 dbSNP
rs1217119742 452 dbSNP
rs564061340 454 dbSNP
rs918869826 467 dbSNP
rs141821144 468 dbSNP
rs1207847633 475 dbSNP
rs770840862 483 dbSNP
rs1246170133 487 dbSNP
rs1453279810 489 dbSNP
rs1425602606 490 dbSNP
rs1248575766 492 dbSNP
rs77173808 497 dbSNP
rs745768443 500 dbSNP
rs1015943863 509 dbSNP
rs553630173 515 dbSNP
rs1414457292 517 dbSNP
rs1458129376 523 dbSNP
rs1158856558 527 dbSNP
rs1386843200 528 dbSNP
rs1407605218 531 dbSNP
rs1324707286 535 dbSNP
rs1239942430 557 dbSNP
rs1330014910 558 dbSNP
rs1433655363 560 dbSNP
rs1289879979 565 dbSNP
rs1350706289 566 dbSNP
rs1227345988 572 dbSNP
rs1048484 581 dbSNP
rs1358126799 582 dbSNP
rs1210376266 585 dbSNP
rs1024599720 588 dbSNP
rs1289048574 589 dbSNP
rs574716649 590 dbSNP
rs1013707554 596 dbSNP
rs60809881 599 dbSNP
rs1451178009 617 dbSNP
rs144945976 618 dbSNP
rs183132294 622 dbSNP
rs770689606 623 dbSNP
rs916182235 629 dbSNP
rs1473945588 630 dbSNP
rs1314590115 632 dbSNP
rs544889560 633 dbSNP
rs1203136931 637 dbSNP
rs1000685471 644 dbSNP
rs903700873 645 dbSNP
rs1403148437 646 dbSNP
rs570765576 649 dbSNP
rs942767197 652 dbSNP
rs1370595488 659 dbSNP
rs891257935 668 dbSNP
rs1378207568 673 dbSNP
rs1286014732 681 dbSNP
rs1342106940 686 dbSNP
rs1245243986 696 dbSNP
rs1283565283 702 dbSNP
rs1354136034 705 dbSNP
rs1207147134 706 dbSNP
rs938859839 712 dbSNP
rs1051089551 715 dbSNP
rs577637407 716 dbSNP
rs1204719323 719 dbSNP
rs748443452 723 dbSNP
rs1444557758 724 dbSNP
rs974750333 724 dbSNP
rs909266196 732 dbSNP
rs1443360653 733 dbSNP
rs1459597262 734 dbSNP
rs1170957957 736 dbSNP
rs1390271620 738 dbSNP
rs1428526566 743 dbSNP
rs1296164385 745 dbSNP
rs1403867799 751 dbSNP
rs1396437415 762 dbSNP
rs941510934 767 dbSNP
rs927474595 793 dbSNP
rs984769380 794 dbSNP
rs190805229 803 dbSNP
rs953357309 821 dbSNP
rs1028891117 827 dbSNP
rs1343035271 844 dbSNP
rs1227756096 850 dbSNP
rs1382080950 852 dbSNP
rs1347428362 853 dbSNP
rs1201211729 855 dbSNP
rs6986155 860 dbSNP
rs1191744957 862 dbSNP
rs1450789932 863 dbSNP
rs79188200 864 dbSNP
rs975960639 868 dbSNP
rs533979963 869 dbSNP
rs1211437543 870 dbSNP
rs1249189058 871 dbSNP
rs1031251913 873 dbSNP
rs552626471 874 dbSNP
rs999329483 876 dbSNP
rs1321213432 878 dbSNP
rs1378810813 878 dbSNP
rs1466257351 878 dbSNP
rs397708721 878 dbSNP
rs575624556 878 dbSNP
rs61689158 878 dbSNP
rs879077709 878 dbSNP
rs1364329440 880 dbSNP
rs1432751836 882 dbSNP
rs969107487 882 dbSNP
rs1037527950 883 dbSNP
rs1313958045 883 dbSNP
rs1022027615 888 dbSNP
rs1216625443 888 dbSNP
rs566953012 890 dbSNP
rs553389605 892 dbSNP
rs760234253 892 dbSNP
rs894798893 892 dbSNP
rs938929232 895 dbSNP
rs114917950 899 dbSNP
rs1433199997 905 dbSNP
rs1312087030 906 dbSNP
rs556485028 907 dbSNP
rs148099880 908 dbSNP
rs571594192 915 dbSNP
rs1388895012 923 dbSNP
rs909308082 933 dbSNP
rs550763512 937 dbSNP
rs1295159247 941 dbSNP
rs770042618 944 dbSNP
rs16904926 945 dbSNP
rs1282931324 947 dbSNP
rs1343853928 955 dbSNP
rs891205934 963 dbSNP
rs567779730 969 dbSNP
rs1328830237 970 dbSNP
rs1214289446 971 dbSNP
rs1051641336 980 dbSNP
rs994159616 981 dbSNP
rs1267742043 983 dbSNP
rs781417399 985 dbSNP
rs1362582937 986 dbSNP
rs565479448 991 dbSNP
rs757803260 992 dbSNP
rs755155311 1000 dbSNP
rs1182371105 1009 dbSNP
rs1410974502 1013 dbSNP
rs1417069111 1018 dbSNP
rs1166915228 1025 dbSNP
rs1378163311 1026 dbSNP
rs1458522005 1029 dbSNP
rs927588702 1040 dbSNP
rs186219901 1044 dbSNP
rs1200648745 1052 dbSNP
rs1363744241 1057 dbSNP
rs1411901206 1060 dbSNP
rs1426529331 1063 dbSNP
rs1373125636 1066 dbSNP
rs1044534819 1071 dbSNP
rs950247031 1083 dbSNP
rs917646466 1084 dbSNP
rs967886886 1087 dbSNP
rs1022081442 1088 dbSNP
rs1244636624 1088 dbSNP
rs1483718309 1088 dbSNP
rs527313235 1090 dbSNP
rs180822923 1093 dbSNP
rs956369102 1094 dbSNP
rs541911134 1095 dbSNP
rs1479561291 1098 dbSNP
rs1011995177 1104 dbSNP
rs979331958 1105 dbSNP
rs1488974018 1108 dbSNP
rs967951831 1109 dbSNP
rs1034687692 1116 dbSNP
rs1383474449 1118 dbSNP
rs540178771 1120 dbSNP
rs1344846056 1125 dbSNP
rs1257113978 1131 dbSNP
rs1308935845 1133 dbSNP
rs1354127186 1148 dbSNP
rs1440524776 1154 dbSNP
rs1018235090 1155 dbSNP
rs1380265817 1157 dbSNP
rs1003176325 1158 dbSNP
rs1235872608 1159 dbSNP
rs1338996029 1160 dbSNP
rs1343762786 1165 dbSNP
rs1228459179 1166 dbSNP
rs1277772836 1167 dbSNP
rs1006712151 1173 dbSNP
rs1400893002 1180 dbSNP
rs955211981 1182 dbSNP
rs1029718892 1183 dbSNP
rs907462283 1189 dbSNP
rs994668399 1193 dbSNP
rs747057604 1195 dbSNP
rs556349198 1196 dbSNP
rs940880345 1213 dbSNP
rs887934276 1217 dbSNP
rs1005541865 1226 dbSNP
rs1402749908 1234 dbSNP
rs544431969 1235 dbSNP
rs1418831025 1242 dbSNP
rs932067243 1245 dbSNP
rs1178435477 1246 dbSNP
rs1044650617 1254 dbSNP
rs758019792 1262 dbSNP
rs1452366856 1265 dbSNP
rs917426993 1275 dbSNP
rs1367951739 1277 dbSNP
rs976499768 1295 dbSNP
rs944697681 1296 dbSNP
rs1056180822 1304 dbSNP
rs752285067 1308 dbSNP
rs1220608878 1311 dbSNP
rs1478577895 1315 dbSNP
rs577203508 1317 dbSNP
rs879459592 1325 dbSNP
rs1186157906 1334 dbSNP
rs1322626784 1337 dbSNP
rs978019400 1343 dbSNP
rs143705764 1347 dbSNP
rs1465306590 1349 dbSNP
rs979497238 1353 dbSNP
rs915074486 1356 dbSNP
rs990613233 1369 dbSNP
rs1316425313 1374 dbSNP
rs2142306 1376 dbSNP
rs1034739992 1384 dbSNP
rs1426099246 1386 dbSNP
rs1469657523 1388 dbSNP
rs1174759477 1408 dbSNP
rs1219666433 1424 dbSNP
rs1458237433 1425 dbSNP
rs566788459 1432 dbSNP
rs911120560 1442 dbSNP
rs753601034 1443 dbSNP
rs766192134 1446 dbSNP
rs1015621996 1448 dbSNP
rs774360497 1448 dbSNP
rs554966203 1454 dbSNP
rs1290018216 1455 dbSNP
rs1341211806 1458 dbSNP
rs1329519421 1459 dbSNP
rs142441475 1462 dbSNP
rs536299448 1473 dbSNP
rs72718252 1474 dbSNP
rs1269641669 1475 dbSNP
rs1049224825 1480 dbSNP
rs1197460605 1482 dbSNP
rs1414676378 1483 dbSNP
rs16904925 1485 dbSNP
rs1467006326 1493 dbSNP
rs1406648434 1496 dbSNP
rs1323668554 1499 dbSNP
rs76173227 1506 dbSNP
rs1402723295 1516 dbSNP
rs1309459552 1527 dbSNP
rs1350952651 1529 dbSNP
rs147923651 1530 dbSNP
rs1472823016 1532 dbSNP
rs558304690 1540 dbSNP
rs1042736126 1541 dbSNP
rs1179077266 1552 dbSNP
rs1456793260 1554 dbSNP
rs1220606662 1555 dbSNP
rs1254235499 1557 dbSNP
rs1181505396 1562 dbSNP
rs1438794215 1562 dbSNP
rs144842138 1564 dbSNP
rs1474075906 1568 dbSNP
rs1199600090 1569 dbSNP
rs1023143083 1571 dbSNP
rs541852033 1581 dbSNP
rs1287984620 1583 dbSNP
rs1227996277 1584 dbSNP
rs562849740 1587 dbSNP
rs142602337 1588 dbSNP
rs1448692863 1592 dbSNP
rs1238066863 1595 dbSNP
rs1358895352 1599 dbSNP
rs1243827236 1602 dbSNP
rs1277093491 1610 dbSNP
rs147747211 1616 dbSNP
rs1195402377 1617 dbSNP
rs149654047 1625 dbSNP
rs1444431212 1642 dbSNP
rs28687047 1646 dbSNP
rs190027134 1647 dbSNP
rs566311747 1648 dbSNP
rs554501101 1649 dbSNP
rs900664136 1657 dbSNP
rs866025579 1676 dbSNP
rs933893505 1678 dbSNP
rs367622159 1686 dbSNP
rs1404163040 1699 dbSNP
rs1156231517 1700 dbSNP
rs1414818254 1700 dbSNP
rs922578524 1720 dbSNP
rs1380457914 1721 dbSNP
rs972964740 1727 dbSNP
rs961257336 1730 dbSNP
rs763715634 1740 dbSNP
rs1226984764 1742 dbSNP
rs1179886109 1743 dbSNP
rs1441890994 1758 dbSNP
rs1204688769 1767 dbSNP
rs1262859017 1772 dbSNP
rs186170886 1775 dbSNP
rs747490888 1776 dbSNP
rs139460635 1781 dbSNP
rs1452337247 1785 dbSNP
rs757964666 1788 dbSNP
rs1378968978 1796 dbSNP
rs1480666654 1802 dbSNP
rs182014580 1803 dbSNP
rs752191427 1805 dbSNP
rs778287418 1807 dbSNP
rs1385835645 1817 dbSNP
rs1353163988 1823 dbSNP
rs538830431 1827 dbSNP
rs896045817 1828 dbSNP
rs1333072222 1829 dbSNP
rs1242292992 1832 dbSNP
rs1031949515 1842 dbSNP
rs1283049668 1842 dbSNP
rs1321788361 1843 dbSNP
rs1211189991 1850 dbSNP
rs571712931 1851 dbSNP
rs1273987701 1862 dbSNP
rs536001193 1869 dbSNP
rs568417455 1870 dbSNP
rs1490419873 1877 dbSNP
rs1351200635 1880 dbSNP
rs1043462283 1883 dbSNP
rs1473442538 1884 dbSNP
rs1159826654 1888 dbSNP
rs34794109 1888 dbSNP
rs1418553190 1895 dbSNP
rs946453038 1896 dbSNP
rs71526295 1897 dbSNP
rs908257616 1901 dbSNP
rs1367457899 1905 dbSNP
rs188938240 1908 dbSNP
rs1405798050 1911 dbSNP
rs1302770238 1917 dbSNP
rs528735131 1918 dbSNP
rs1423695756 1925 dbSNP
rs1237463809 1927 dbSNP
rs1490353391 1934 dbSNP
rs1190919207 1938 dbSNP
rs567960542 1945 dbSNP
rs933699956 1946 dbSNP
rs974956507 1949 dbSNP
rs964886515 1955 dbSNP
rs1249510565 1957 dbSNP
rs1417245781 1958 dbSNP
rs922492908 1959 dbSNP
rs1166761918 1964 dbSNP
rs1019112857 1966 dbSNP
rs1286768807 1983 dbSNP
rs1163227130 1997 dbSNP
rs1009444853 2004 dbSNP
rs1299127413 2005 dbSNP
rs1372967720 2013 dbSNP
rs972693464 2014 dbSNP
rs13274052 2015 dbSNP
rs766140136 2020 dbSNP
rs1244559881 2021 dbSNP
rs1021433824 2023 dbSNP
rs529764516 2024 dbSNP
rs760531202 2026 dbSNP
rs1023036844 2031 dbSNP
rs992772214 2036 dbSNP
rs562547151 2040 dbSNP
rs1299450843 2043 dbSNP
rs1445371521 2043 dbSNP
rs1183083926 2044 dbSNP
rs35446312 2046 dbSNP
rs112459088 2057 dbSNP
rs1411869076 2059 dbSNP
rs1032312861 2060 dbSNP
rs999126854 2068 dbSNP
rs750347816 2069 dbSNP
rs1354376413 2074 dbSNP
rs906404958 2089 dbSNP
rs530797811 2092 dbSNP
rs34383166 2094 dbSNP
rs1046239461 2106 dbSNP
rs1384154778 2109 dbSNP
rs1357919054 2114 dbSNP
rs550729776 2117 dbSNP
rs939823446 2119 dbSNP
rs766994674 2127 dbSNP
rs1271849530 2135 dbSNP
rs1205310224 2138 dbSNP
rs1305594931 2138 dbSNP
rs767386351 2139 dbSNP
rs572054881 2147 dbSNP
rs1241370567 2161 dbSNP
rs1476423793 2168 dbSNP
rs564904353 2175 dbSNP
rs1419035197 2181 dbSNP
rs1427161446 2182 dbSNP
rs749852082 2186 dbSNP
rs759396044 2186 dbSNP
rs1407215789 2197 dbSNP
rs1477596364 2200 dbSNP
rs1469751839 2201 dbSNP
rs1335303594 2202 dbSNP
rs1346525345 2207 dbSNP
rs766239065 2208 dbSNP
rs1269285378 2215 dbSNP
rs1359463904 2221 dbSNP
rs1224922848 2224 dbSNP
rs1283686154 2229 dbSNP
rs889526086 2229 dbSNP
rs1221669142 2232 dbSNP
rs1322491219 2232 dbSNP
rs920924952 2233 dbSNP
rs1448856149 2238 dbSNP
rs1216563233 2239 dbSNP
rs1049528466 2242 dbSNP
rs1487433078 2243 dbSNP
rs975008944 2247 dbSNP
rs1430500744 2260 dbSNP
rs1480310552 2263 dbSNP
rs1174954182 2265 dbSNP
rs1264172765 2267 dbSNP
rs1410770402 2269 dbSNP
rs540430057 2271 dbSNP
rs573043236 2272 dbSNP
rs761662348 2279 dbSNP
rs560894625 2289 dbSNP
rs1303369109 2290 dbSNP
rs987675059 2291 dbSNP
rs1221434971 2298 dbSNP
rs542590312 2306 dbSNP
rs939953781 2313 dbSNP
rs563456049 2315 dbSNP
rs909840133 2324 dbSNP
rs1313713484 2326 dbSNP
rs571159992 2330 dbSNP
rs1351340773 2344 dbSNP
rs1223077124 2345 dbSNP
rs371971808 2347 dbSNP
rs775602957 2348 dbSNP
rs765257013 2354 dbSNP
rs1217815463 2355 dbSNP
rs1021078904 2361 dbSNP
rs1279765405 2370 dbSNP
rs1225084859 2377 dbSNP
rs992941582 2378 dbSNP
rs960281676 2380 dbSNP
rs954097664 2384 dbSNP
rs1197223556 2394 dbSNP
rs1377867536 2395 dbSNP
rs1470803679 2401 dbSNP
rs1158442138 2411 dbSNP
rs924639334 2415 dbSNP
rs565031871 2421 dbSNP
rs1449335466 2431 dbSNP
rs1408984676 2432 dbSNP
rs1364549279 2433 dbSNP
rs893852705 2443 dbSNP
rs759785706 2451 dbSNP
rs977865193 2452 dbSNP
rs3184728 2460 dbSNP
rs774337770 2462 dbSNP
rs1021913682 2468 dbSNP
rs11782689 2471 dbSNP
rs953544253 2473 dbSNP
rs1028046367 2474 dbSNP
rs796488129 2476 dbSNP
rs538728353 2482 dbSNP
rs1413224060 2487 dbSNP
rs900793263 2488 dbSNP
rs1036696381 2489 dbSNP
rs1236854827 2510 dbSNP
rs1445983269 2513 dbSNP
rs185000123 2514 dbSNP
rs1456075258 2528 dbSNP
rs888348575 2529 dbSNP
rs1046723072 2538 dbSNP
rs553252587 2546 dbSNP
rs1048319769 2549 dbSNP
rs1326827991 2553 dbSNP
rs192614453 2563 dbSNP
rs1458101417 2566 dbSNP
rs915754042 2574 dbSNP
rs886932362 2578 dbSNP
rs1057453314 2586 dbSNP
rs938777817 2587 dbSNP
rs1272143899 2593 dbSNP
rs747431664 2600 dbSNP
rs924724990 2607 dbSNP
rs773723033 2611 dbSNP
rs1256509071 2614 dbSNP
rs1463077426 2621 dbSNP
rs532943435 2631 dbSNP
rs1242052631 2637 dbSNP
rs968729541 2637 dbSNP
rs142554366 2639 dbSNP
rs943679022 2640 dbSNP
rs914803100 2650 dbSNP
rs1474847272 2652 dbSNP
rs986393203 2654 dbSNP
rs953491403 2655 dbSNP
rs1030500413 2659 dbSNP
rs988115578 2663 dbSNP
rs549726903 2665 dbSNP
rs965147024 2666 dbSNP
rs1394335754 2675 dbSNP
rs189414797 2678 dbSNP
rs1300089103 2679 dbSNP
rs1456535864 2680 dbSNP
rs1276703937 2683 dbSNP
rs568837433 2690 dbSNP
rs1326085615 2697 dbSNP
rs749066666 2701 dbSNP
rs1349545636 2717 dbSNP
rs16904924 2730 dbSNP
rs778435199 2733 dbSNP
rs1482016387 2741 dbSNP
rs1446583897 2750 dbSNP
rs1378402803 2764 dbSNP
rs989609519 2769 dbSNP
rs1446067133 2771 dbSNP
rs958118200 2773 dbSNP
rs1431243516 2780 dbSNP
rs1012790422 2784 dbSNP
rs894437897 2786 dbSNP
rs1175671245 2787 dbSNP
rs1252344520 2788 dbSNP
rs555707201 2789 dbSNP
rs370781602 2793 dbSNP
rs1375840826 2795 dbSNP
rs34844235 2799 dbSNP
rs903250245 2808 dbSNP
rs1385676172 2809 dbSNP
rs573414786 2816 dbSNP
rs947342073 2817 dbSNP
rs1350953450 2818 dbSNP
rs1014895049 2824 dbSNP
rs1310987110 2827 dbSNP
rs1241716731 2835 dbSNP
rs1260811959 2850 dbSNP
rs1349318972 2864 dbSNP
rs1214090020 2865 dbSNP
rs546474939 2865 dbSNP
rs914583632 2866 dbSNP
rs986342284 2868 dbSNP
rs932216766 2874 dbSNP
rs923550848 2875 dbSNP
rs561316874 2877 dbSNP
rs369752019 2878 dbSNP
rs962543961 2881 dbSNP
rs1385455593 2883 dbSNP
rs1055799924 2884 dbSNP
rs1364525020 2890 dbSNP
rs1001603484 2894 dbSNP
rs1015317110 2899 dbSNP
rs1157132370 2901 dbSNP
rs139225016 2902 dbSNP
rs1425490781 2905 dbSNP
rs1293308374 2910 dbSNP
rs755777197 2915 dbSNP
rs1358759630 2928 dbSNP
rs1026607901 2930 dbSNP
rs1012571224 2944 dbSNP
rs1420191584 2947 dbSNP
rs894385678 2949 dbSNP
rs560831078 2957 dbSNP
rs1002685969 2960 dbSNP
rs1293265807 2964 dbSNP
rs1338130162 2969 dbSNP
rs913482942 2976 dbSNP
rs1221192549 2979 dbSNP
rs1432440199 2983 dbSNP
rs1052067498 2985 dbSNP
rs542477310 2986 dbSNP
rs1041770246 2988 dbSNP
rs146232876 2989 dbSNP
rs1437692093 2990 dbSNP
rs1176887631 2996 dbSNP
rs1387091690 3000 dbSNP
rs1445478286 3003 dbSNP
rs1487009333 3005 dbSNP
rs767332909 3007 dbSNP
rs893263233 3013 dbSNP
rs757172383 3018 dbSNP
rs1299295666 3023 dbSNP
rs117222248 3024 dbSNP
rs923528096 3029 dbSNP
rs141757417 3031 dbSNP
rs940837374 3033 dbSNP
rs759604707 3034 dbSNP
rs1227445263 3048 dbSNP
rs776976862 3052 dbSNP
rs984965984 3058 dbSNP
rs1302222493 3069 dbSNP
rs1406946817 3076 dbSNP
rs1309087936 3079 dbSNP
rs1204981710 3080 dbSNP
rs578029193 3087 dbSNP
rs1015255394 3090 dbSNP
rs558153107 3092 dbSNP
rs1245099595 3111 dbSNP
rs1445308744 3115 dbSNP
rs1014207659 3120 dbSNP
rs540167038 3136 dbSNP
rs1400705564 3138 dbSNP
rs4736675 3143 dbSNP
rs1034337444 3147 dbSNP
rs534886799 3154 dbSNP
rs1293061971 3156 dbSNP
rs1406258807 3163 dbSNP
rs1446622970 3168 dbSNP
rs1465331480 3176 dbSNP
rs1363674897 3180 dbSNP
rs760980162 3193 dbSNP
rs904629822 3200 dbSNP
rs1315819275 3204 dbSNP
rs1035583079 3207 dbSNP
rs1021760602 3221 dbSNP
rs1003210222 3224 dbSNP
rs1443131685 3226 dbSNP
rs574319379 3227 dbSNP
rs773668051 3228 dbSNP
rs1413369995 3229 dbSNP
rs1187275151 3231 dbSNP
rs1476611097 3238 dbSNP
rs11539665 3241 dbSNP
rs1477044234 3243 dbSNP
rs116784117 3256 dbSNP
rs1430637871 3258 dbSNP
rs1414360143 3259 dbSNP
rs879762977 3262 dbSNP
rs1173349537 3274 dbSNP
rs1346394318 3292 dbSNP
rs4736674 3299 dbSNP
rs1297191246 3309 dbSNP
rs748664599 3312 dbSNP
rs1041685002 3315 dbSNP
rs184653642 3316 dbSNP
rs944330310 3319 dbSNP
rs890106291 3322 dbSNP
rs774760625 3327 dbSNP
rs1050104290 3331 dbSNP
rs1276608166 3335 dbSNP
rs1199297196 3338 dbSNP
rs570368473 3340 dbSNP
rs1217710903 3344 dbSNP
rs1050521936 3348 dbSNP
rs1262707302 3354 dbSNP
rs1487401944 3355 dbSNP
rs375624219 3380 dbSNP
rs901849747 3381 dbSNP
rs1269965856 3384 dbSNP
rs1040592669 3385 dbSNP
rs940939433 3386 dbSNP
rs74400910 3403 dbSNP
rs1049206485 3407 dbSNP
rs1400750297 3420 dbSNP
rs571232902 3422 dbSNP
rs1358259885 3423 dbSNP
rs930836373 3429 dbSNP
rs112618202 3437 dbSNP
rs546708810 3443 dbSNP
rs1219319387 3445 dbSNP
rs528186587 3446 dbSNP
rs907731748 3448 dbSNP
rs372891528 3449 dbSNP
rs991212837 3451 dbSNP
rs958363957 3463 dbSNP
rs1434291963 3464 dbSNP
rs1281210796 3465 dbSNP
rs77503871 3468 dbSNP
rs112935291 3469 dbSNP
rs1395335130 3472 dbSNP
rs4736673 3474 dbSNP
rs1338378172 3476 dbSNP
rs1034284915 3481 dbSNP
rs1224933500 3490 dbSNP
rs1291107677 3495 dbSNP
rs980080206 3503 dbSNP
rs981170109 3504 dbSNP
rs548768319 3505 dbSNP
rs967690636 3511 dbSNP
rs1020239436 3512 dbSNP
rs1011395616 3518 dbSNP
rs1446099196 3524 dbSNP
rs530678428 3529 dbSNP
rs1029050804 3533 dbSNP
rs891944444 3541 dbSNP
rs563285625 3543 dbSNP
rs1355071695 3547 dbSNP
rs1008458954 3549 dbSNP
rs996668832 3558 dbSNP
rs1374744945 3566 dbSNP
rs754231000 3571 dbSNP
rs901968431 3575 dbSNP
rs1248523856 3576 dbSNP
rs1366155996 3578 dbSNP
rs1356147792 3579 dbSNP
rs1186270832 3581 dbSNP
rs1208451478 3581 dbSNP
rs1275507880 3601 dbSNP
rs1458613421 3604 dbSNP
rs1442283439 3608 dbSNP
rs545073330 3616 dbSNP
rs1462266738 3618 dbSNP
rs188294743 3622 dbSNP
rs1367509083 3625 dbSNP
rs898867596 3626 dbSNP
rs1169431390 3651 dbSNP
rs1423999889 3654 dbSNP
rs1004914958 3655 dbSNP
rs1205955861 3677 dbSNP
rs886674457 3697 dbSNP
rs1398245424 3701 dbSNP
rs1454623652 3703 dbSNP
rs182820781 3708 dbSNP
rs1257627055 3714 dbSNP
rs1340132678 3715 dbSNP
rs746261179 3715 dbSNP
rs541482405 3716 dbSNP
rs940475948 3717 dbSNP
rs1314769826 3723 dbSNP
rs907678237 3727 dbSNP
rs113932819 3729 dbSNP
rs374490508 3730 dbSNP
rs1225752270 3731 dbSNP
rs1325132814 3731 dbSNP
rs1200559014 3732 dbSNP
rs78468413 3733 dbSNP
rs1056825457 3734 dbSNP
rs539476657 3734 dbSNP
rs544068865 3736 dbSNP
rs1263718602 3737 dbSNP
rs1431380550 3744 dbSNP
rs34563134 3744 dbSNP
rs570809715 3744 dbSNP
rs796294217 3744 dbSNP
rs796309636 3744 dbSNP
rs1466447846 3748 dbSNP
rs1244159625 3749 dbSNP
rs1401518724 3755 dbSNP
rs1394570809 3756 dbSNP
rs930785353 3762 dbSNP
rs576804628 3769 dbSNP
rs916754753 3772 dbSNP
rs112435249 3778 dbSNP
rs937084119 3779 dbSNP
rs980027744 3781 dbSNP
rs1254963943 3785 dbSNP
rs968681901 3789 dbSNP
rs1399339642 3790 dbSNP
rs1286252643 3794 dbSNP
rs1487728512 3804 dbSNP
rs138729890 3808 dbSNP
rs1270697212 3819 dbSNP
rs981498748 3826 dbSNP
rs1433718519 3843 dbSNP
rs78879753 3846 dbSNP
rs552712994 3851 dbSNP
rs1377211221 3858 dbSNP
rs913127866 3859 dbSNP
rs990078461 3861 dbSNP
rs1464582192 3863 dbSNP
rs1471658107 3870 dbSNP
rs956165933 3875 dbSNP
rs1239018595 3876 dbSNP
rs1162066189 3883 dbSNP
rs192173419 3887 dbSNP
rs1386407889 3893 dbSNP
rs74574336 3895 dbSNP
rs957154629 3899 dbSNP
rs1028829717 3902 dbSNP
rs570856484 3920 dbSNP
rs1370163484 3923 dbSNP
rs966516350 3932 dbSNP
rs2458 3941 dbSNP
rs954235204 3942 dbSNP
rs35418681 3956 dbSNP
rs397729081 3956 dbSNP
rs78450876 3956 dbSNP
rs200948318 3958 dbSNP
rs1240584142 3965 dbSNP
rs751514757 3970 dbSNP
rs1439708201 3972 dbSNP
rs1309302166 3973 dbSNP
rs1352529088 3975 dbSNP
rs1288009432 3979 dbSNP
rs1005269592 3981 dbSNP
rs1360341288 3983 dbSNP
rs1209208704 3984 dbSNP
rs530666808 3988 dbSNP
rs1420755744 3992 dbSNP
rs16904923 3994 dbSNP
rs758364645 3995 dbSNP
rs1237809001 3996 dbSNP
rs551690609 4003 dbSNP
rs1376108064 4004 dbSNP
rs1439379891 4006 dbSNP
rs1279852299 4008 dbSNP
rs1157075597 4013 dbSNP
rs753900269 4020 dbSNP
rs995052421 4021 dbSNP
rs146030209 4022 dbSNP
rs559671744 4025 dbSNP
rs541070880 4028 dbSNP
rs187463098 4029 dbSNP
rs1389241788 4035 dbSNP
rs1005011728 4037 dbSNP
rs766594526 4038 dbSNP
rs886198670 4045 dbSNP
rs1056854130 4047 dbSNP
rs562209727 4048 dbSNP
rs1237601884 4059 dbSNP
rs1314402175 4063 dbSNP
rs1322156233 4072 dbSNP
rs751497331 4077 dbSNP
rs1243824437 4081 dbSNP
rs939561909 4100 dbSNP
rs766385030 4101 dbSNP
rs938514956 4102 dbSNP
rs547208178 4104 dbSNP
rs1156324454 4105 dbSNP
rs1045502579 4110 dbSNP
rs576743804 4113 dbSNP
rs947328017 4114 dbSNP
rs376498104 4116 dbSNP
rs546445195 4117 dbSNP
rs935898003 4120 dbSNP
rs1164521433 4121 dbSNP
rs1367023182 4122 dbSNP
rs1467698695 4131 dbSNP
rs988839586 4133 dbSNP
rs1318133461 4137 dbSNP
rs551250999 4138 dbSNP
rs1490581767 4149 dbSNP
rs750720577 4171 dbSNP
rs528929911 4172 dbSNP
rs767892395 4176 dbSNP
rs762150864 4177 dbSNP
rs1379483861 4180 dbSNP
rs561608327 4190 dbSNP
rs1310383244 4194 dbSNP
rs561195217 4195 dbSNP
rs1284947446 4198 dbSNP
rs965924972 4199 dbSNP
rs1019419405 4206 dbSNP
rs1315930137 4208 dbSNP
rs1225257931 4227 dbSNP
rs986919357 4230 dbSNP
rs1239211077 4241 dbSNP
rs1342663235 4248 dbSNP
rs983564707 4249 dbSNP
rs950679674 4258 dbSNP
rs1172082336 4261 dbSNP
rs774793016 4262 dbSNP
rs1027608757 4264 dbSNP
rs994832639 4265 dbSNP
rs1423570306 4283 dbSNP
rs895388273 4284 dbSNP
rs1347039567 4289 dbSNP
rs552891779 4294 dbSNP
rs1359180877 4296 dbSNP
rs995736335 4297 dbSNP
rs963007253 4301 dbSNP
rs1033957023 4307 dbSNP
rs1342196020 4311 dbSNP
rs1398862108 4313 dbSNP
rs1277283739 4318 dbSNP
rs1338339349 4323 dbSNP
rs1231097305 4326 dbSNP
rs886143886 4327 dbSNP
rs1004094543 4333 dbSNP
rs1056800681 4344 dbSNP
rs1209735480 4345 dbSNP
rs1002606273 4347 dbSNP
rs1402770223 4354 dbSNP
rs906713777 4359 dbSNP
rs1489368227 4361 dbSNP
rs1194887968 4364 dbSNP
rs1262837419 4365 dbSNP
rs1423444368 4372 dbSNP
rs1044226050 4379 dbSNP
rs182832686 4382 dbSNP
rs1431737114 4384 dbSNP
rs534358703 4384 dbSNP
rs768978369 4390 dbSNP
rs1173282475 4391 dbSNP
rs1285161704 4391 dbSNP
rs567020383 4393 dbSNP
rs1362095200 4395 dbSNP
rs1488045048 4397 dbSNP
rs1419856333 4409 dbSNP
rs1297366382 4418 dbSNP
rs1242603274 4423 dbSNP
rs555071739 4434 dbSNP
rs1438612776 4435 dbSNP
rs1275340480 4436 dbSNP
rs1054111832 4439 dbSNP
rs1440650682 4442 dbSNP
rs536834365 4450 dbSNP
rs1218743106 4451 dbSNP
rs1277601790 4463 dbSNP
rs191044387 4464 dbSNP
rs912599112 4465 dbSNP
rs1285832167 4468 dbSNP
rs6993472 4469 dbSNP
rs1038964958 4470 dbSNP
rs944505057 4471 dbSNP
rs773166428 4472 dbSNP
rs1477963303 4477 dbSNP
rs539674909 4494 dbSNP
rs138139215 4496 dbSNP
rs1439983806 4506 dbSNP
rs1157668566 4514 dbSNP
rs763484990 4522 dbSNP
rs1378299011 4524 dbSNP
rs543539095 4525 dbSNP
rs920708117 4532 dbSNP
rs1349256728 4533 dbSNP
rs1357934445 4537 dbSNP
rs963249305 4544 dbSNP
rs547808188 4549 dbSNP
rs529331580 4550 dbSNP
rs1241198209 4551 dbSNP
rs1431717974 4554 dbSNP
rs562146308 4563 dbSNP
rs1290953814 4566 dbSNP
rs6993461 4572 dbSNP
rs1334578929 4579 dbSNP
rs971427156 4582 dbSNP
rs1021117151 4583 dbSNP
rs1035341520 4589 dbSNP
rs1420252822 4592 dbSNP
rs1361728264 4596 dbSNP
rs1009770183 4597 dbSNP
rs1333411690 4598 dbSNP
rs1471729350 4598 dbSNP
rs745491373 4601 dbSNP
rs1402606941 4602 dbSNP
rs905631360 4607 dbSNP
rs531864145 4608 dbSNP
rs187168631 4609 dbSNP
rs1011409214 4613 dbSNP
rs182857868 4614 dbSNP
rs1260530047 4616 dbSNP
rs544720841 4623 dbSNP
rs1197494328 4627 dbSNP
rs1247723711 4630 dbSNP
rs1255725414 4633 dbSNP
rs1197674707 4636 dbSNP
rs1039325765 4640 dbSNP
rs1187803815 4643 dbSNP
rs944635572 4644 dbSNP
rs1474089192 4653 dbSNP
rs891109397 4660 dbSNP
rs1424280800 4662 dbSNP
rs1051110114 4679 dbSNP
rs1167421346 4698 dbSNP
rs932690865 4700 dbSNP
rs1416444898 4705 dbSNP
rs1335064653 4707 dbSNP
rs921352351 4710 dbSNP
rs974603318 4712 dbSNP
rs911831235 4713 dbSNP
rs1280448215 4720 dbSNP
rs1341685644 4726 dbSNP
rs79479031 4733 dbSNP
rs560670553 4743 dbSNP
rs929164378 4753 dbSNP
rs1346506717 4754 dbSNP
rs908732639 4755 dbSNP
rs1277501828 4756 dbSNP
rs1484461190 4759 dbSNP
rs1377606258 4768 dbSNP
rs920654022 4771 dbSNP
rs973470560 4772 dbSNP
rs540603669 4773 dbSNP
rs926644946 4776 dbSNP
rs746719934 4777 dbSNP
rs982556607 4778 dbSNP
rs970991989 4786 dbSNP
rs1453801670 4790 dbSNP
rs769659821 4798 dbSNP
rs1009717853 4799 dbSNP
rs564156575 4802 dbSNP
rs1461632995 4804 dbSNP
rs1433023091 4805 dbSNP
rs573336036 4809 dbSNP
rs1032729038 4811 dbSNP
rs1361561609 4817 dbSNP
rs999949189 4831 dbSNP
rs1400004303 4834 dbSNP
rs969738460 4841 dbSNP
rs900289395 4842 dbSNP
rs1038687510 4843 dbSNP
rs892955054 4854 dbSNP
rs1009008196 4856 dbSNP
rs1218324243 4859 dbSNP
rs890359608 4859 dbSNP
rs1403730649 4865 dbSNP
rs1487820923 4883 dbSNP
rs1384530209 4884 dbSNP
rs1269403859 4891 dbSNP
rs1452070902 4897 dbSNP
rs1199680190 4899 dbSNP
rs1394495128 4906 dbSNP
rs554958708 4915 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' aucACACCACU---GCACUCCa 3'
1 - 19
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000319914.5 | 3UTR | AUCACACCACUGCACUCCAGCCUGGGCAACAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2