miRTarBase - #MIRT706659 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RNF216   
Synonyms CAHH, TRIAD3, U7I1, UBCE7IP1, ZIN
Description ring finger protein 216
Transcript NM_207111   
Other Transcripts NM_207116   
Expression
Putative miRNA Targets on RNF216
3'UTR of RNF216
(miRNA target sites are highlighted)
>RNF216|NM_207111|3'UTR
   1 TGGCCCCGAATCCCCATTGAGCAGCACAAAGCCCGTTTGGGGTAGGAGTGTGGATGGAGAACCCTCCCCCAAGGCTGGTG
  81 TCTGTACCATTGCATCCTAAGTCAGCTTGAAGGGTAGGCTGGTTTTCTTCCCACCCCTTTCCTAGAAGGGCTACTGCTCC
 161 TGGAAGAGTGGACGGATCCATAATAAAGACGTCCCAAATGGTGGAGTTCGGAGAGAGCTGCGATGTGAACTGCCCCTCCC
 241 CTCGCATCCCCCAGGCCACCAACGGCAGTCCTTCTGCCTTGTCCATGGCATAGGCCATAGACCAGGTCCCTGCTGCTCAC
 321 ACCTGGGCCTCTCCTCGGAGCCGACCCCTGGGTAGCAAGGCAGCCGAGAGCATCTCCCTGGAGGGGCCCACGGTTGGGCC
 401 AAGGGCAGAGGGGGCTGCACCTGCGGGCCTGGGAAGCATTGCTCAGGGTGGGGGGCTGGGACCATGGCCCGCAGAGGCAC
 481 TGCCACAGCTGTGAGGGCCAAGATGCTGTCCCCCCATCCAAAACCCGTGCGCCACTGCAGTGAGTGTTGAGGGCACCTCT
 561 CCTCCCCTCTTACACCTACTCAGATGAGGCAGCAGCAGACCCATCTCGCGGCGGGGGTTTTGTTCTGTTGCCGCCTAACT
 641 TTCTCATCCTCGGTCTCTGGAAAGTCAGGCTGAGAAATCCTTTCCCAGGCCAGGCCGCTGCGGTACACTGGATGGTTCTG
 721 AAGCTGGCCCATTGAAAGAGCCTCTTAAGGCAGCTGGGACAGAGGCCTGGTGGCCCTGCTGGGCAGCCCAACTGCTGGGG
 801 GAGACGTTTCTGCCACCCTGGGTGATGAGCAGCTTTTCCCCCCTGGCTTTCTGGGGGAGGAGTGGGCCTCCTTAGGGAGA
 881 CAGGTGACCCTGGGTGCCACCCCTGCCCCGTGTGTGCCCCGGGTGTTCTCAGTGGTTGCTGAAGGCAGGTAGAGGGTGCT
 961 GTCCAGTATCCCCCATGTGAAGGTCACTTCCCTTCTCATGGAGTCAGCTGAGCATCAGCTCAGCCCTGCCATGTCCCCAC
1041 TCACCCTCCTCGCCTCCTGTCCGGCCCTGGGTTTCTAGCGGTGCCTGAGGCATCACTCTGGCCCATTGACAGATGAGAGG
1121 TCTGAAGCCTTCCTGGCCACAGGCATCACTTTCTCCTCCTCCTCATGCCCTGCCTTGTCCTTGTCGTGTTGCCATGGGGT
1201 TCTGAGAGGCTGGGAGTTCACAGACCTCAGACACAGCTGAGTCCGACAACCATTGGGGTGGGGCTGCATCAGTCTCCGGA
1281 GTGGCCCGCCACCTCCTGAAGCAGGGCCTGGCCCACCCAAGGTGCCTGGGGCAGGCGGGCACCGTCATTCGCTGCCATTG
1361 GCTTCTCAGATGTATTTCAAGGACTAAAGTGGGCTCTAAGATCTAAGATGGCCCGGCGCGGTGGCTCCCGCCTGTAATCC
1441 CAGCACTTTGGGAGGCCGAGGCGGGCGGATGAGTTGAGGTCGGGAGTTTGAGTCCCCGTCTCTACTAAAAATACAAAATT
1521 AGCCGGACAAGGTGGCGCATGCCTATAATCCCAGGTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAACCTGGGAGGCA
1601 GAGGTTGCAGTGAGCCAAGATTGTGCCACTGCACTCCAGCCTGAGCAACAAAAGCAAAACTCTATCTTTAAAAAAAAAAA
1681 AAAAAAAACTAAGATACCCATTCTTTCTGCCTTTGCCCAGGATGGAGGCTTTGAAGACAGGTGGTCACCTGGACCTGGGG
1761 TAAGGGTGCGCAGGGAGGCCGGGCTTGGGGGCAGCCTGCTGCTATGTCCTTGCTGGCGCCCATACCTGTTGGACTGCCTG
1841 AACTTTGCTACTAGCCTGAACGACAGTGCCTTGGAAAGGCAGGCTCCATGCGGCAGCAACAGGATTGTCTTCGGTACCTT
1921 AAATATGCTCCCTGTGCTTCCCCAGGGAGGATCTCTGGGAGCAGAGGGCGGCTGTAGACATCACAGCTGAAGAGGTGACC
2001 TCAGGCCCTGGGAGCCTCAGCTCCCTCTGCCCTGTACCCTAGGCACGTGGCTCCAGCAAGAGCCCCAGGCAGGACAAAGG
2081 GAGCAGGCAGCAGCTGCAGAAACAGCCCTAGACAGGTGCTGGCCTCAACCCTGGCAGGGGAGGGGGAGCCCAGAGTGATG
2161 TTTCTCCTAAGGCCAAACCCCAGGGGTGGGTCATTTGAGAGGAGTTCCAGCTGTTCTGGCCACACTGGGCTGGTGGGGAA
2241 GGAGCGGCGGCCTCTTTCCTTGGAGGGTCCCTGATTCCTGAGGATCCTCCCCGAGCCAGGCACGGGGGACCACAGGGCTG
2321 CCGTGAGCACCCACCCTGGTTCTCCAGGCCCCTCTGTCCAGAGGCAGGGCCTGAACCTCGGGCTCCTGCCTGGACCAGTG
2401 ACAGCATTGGGGAGAGAAGCACTGGGGGTCTTCAGACCAGCCAGCAAGGGGCCGTGCCAGTGCCCAGAGAGCAGGTCAGA
2481 CAACAGGCAACCCTGAGGCAGCTGGCTCCCTCTCTCTGCCCTGCAGGGCTTGCCGCAGGGCGTGAGGCTCCCCAGCCACA
2561 GCCCCCTCTTACTTGCCTTAAAACTGGAGAGAGGAATCTAGTATTTGCACTTAGCAAAATATTTAAAAACTGAAAAAAAT
2641 GTGCATGATCTGTCACTTTGTATAAAAACAAGAAACGATTAGTTCATTAAACTTTTTCTTTACCTTCTGGTAGTAAAAAT
2721 AGATAAAATAATTCCGTTTCAACTACTGTGTGTAAAAAGCCTGTATCATATGTAACTGGGACTTTTGTAAATAAATGTTT
2801 GTGCGCTCTGCTCCCTCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACA-----GUGUGAGGu 5'
              ||  |||||     ::|||||| 
Target 5' gagcCAAGATTGTGCCACTGCACTCCa 3'
1612 - 1638 138.00 -14.20
2
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              | |||   |||| |||| 
Target 5' atgtCCCCA--CTCACCCTCCt 3'
1031 - 1050 122.00 -11.00
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :::||| |   :|::|||| 
Target 5' tcGGTACCTTAAATATGCTCCc 3'
1911 - 1932 120.00 -10.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30506602 4 COSMIC
COSN26992468 7 COSMIC
COSN26992466 8 COSMIC
COSN30509104 12 COSMIC
COSN30491530 13 COSMIC
COSN30481741 33 COSMIC
COSN30455947 34 COSMIC
COSN31481818 35 COSMIC
COSN30455118 39 COSMIC
COSN30145545 121 COSMIC
COSN30463256 132 COSMIC
COSN30520333 136 COSMIC
COSN30496457 153 COSMIC
COSN9994800 233 COSMIC
COSN28201938 346 COSMIC
COSN21821540 408 COSMIC
COSN15906022 724 COSMIC
COSN29161838 1206 COSMIC
COSN17978921 1278 COSMIC
COSN19127418 1687 COSMIC
COSN27299619 1688 COSMIC
COSN15992972 2018 COSMIC
COSN24661493 2289 COSMIC
COSN17038056 2476 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779519196 4 dbSNP
rs1390481312 6 dbSNP
rs756638314 7 dbSNP
rs767873301 8 dbSNP
rs757505119 9 dbSNP
rs1195841424 10 dbSNP
rs1427057109 11 dbSNP
rs751938766 12 dbSNP
rs375027678 15 dbSNP
rs1490863805 16 dbSNP
rs1032282779 17 dbSNP
rs763202402 21 dbSNP
rs370619106 22 dbSNP
rs572673952 24 dbSNP
rs765356095 29 dbSNP
rs1001189641 32 dbSNP
rs1223363022 34 dbSNP
rs373733949 35 dbSNP
rs370599339 36 dbSNP
rs753346261 37 dbSNP
rs567863138 41 dbSNP
rs1301901372 45 dbSNP
rs1406634985 46 dbSNP
rs763515140 48 dbSNP
rs760026704 54 dbSNP
rs1466802098 64 dbSNP
rs1056168313 66 dbSNP
rs1246726263 69 dbSNP
rs937362170 70 dbSNP
rs185141832 78 dbSNP
rs774823145 81 dbSNP
rs1472785103 82 dbSNP
rs1041247884 89 dbSNP
rs1164181411 90 dbSNP
rs1045866047 92 dbSNP
rs554425712 97 dbSNP
rs908036532 99 dbSNP
rs1350498022 105 dbSNP
rs1441774699 114 dbSNP
rs531134005 118 dbSNP
rs1286654690 119 dbSNP
rs911376396 133 dbSNP
rs1229390780 137 dbSNP
rs930854639 138 dbSNP
rs1333352197 149 dbSNP
rs974789798 153 dbSNP
rs180886348 154 dbSNP
rs535704826 157 dbSNP
rs965752972 164 dbSNP
rs931522288 166 dbSNP
rs918597748 173 dbSNP
rs1483301390 174 dbSNP
rs1018593468 176 dbSNP
rs763651978 180 dbSNP
rs972683346 188 dbSNP
rs1444377844 190 dbSNP
rs763271758 191 dbSNP
rs1025041743 197 dbSNP
rs1372628676 200 dbSNP
rs1022077274 203 dbSNP
rs990844528 205 dbSNP
rs1033621608 209 dbSNP
rs545038797 210 dbSNP
rs1225544699 213 dbSNP
rs1276410195 217 dbSNP
rs1032584589 218 dbSNP
rs1342452602 218 dbSNP
rs907191228 219 dbSNP
rs533374530 222 dbSNP
rs1045797633 224 dbSNP
rs1241441387 228 dbSNP
rs559544224 230 dbSNP
rs1004961585 232 dbSNP
rs886529517 233 dbSNP
rs1392029288 234 dbSNP
rs1000799876 241 dbSNP
rs930845066 243 dbSNP
rs922147917 244 dbSNP
rs773614158 245 dbSNP
rs1039274301 250 dbSNP
rs966992579 253 dbSNP
rs188555930 257 dbSNP
rs1433459339 259 dbSNP
rs1299185914 262 dbSNP
rs1245573088 263 dbSNP
rs966399339 264 dbSNP
rs1253848298 266 dbSNP
rs914996346 271 dbSNP
rs1312585830 274 dbSNP
rs989697020 276 dbSNP
rs959249966 281 dbSNP
rs1445212622 285 dbSNP
rs997156598 288 dbSNP
rs1380015547 293 dbSNP
rs1392322903 296 dbSNP
rs1163798604 298 dbSNP
rs1250007681 300 dbSNP
rs1450141438 303 dbSNP
rs760375750 306 dbSNP
rs1193286968 326 dbSNP
rs1376129552 329 dbSNP
rs1423565859 330 dbSNP
rs1383013113 331 dbSNP
rs901496961 336 dbSNP
rs1003446441 338 dbSNP
rs371482772 342 dbSNP
rs1038826286 343 dbSNP
rs1024276137 346 dbSNP
rs1191726426 347 dbSNP
rs1007712709 348 dbSNP
rs1004888131 350 dbSNP
rs1233434005 352 dbSNP
rs1453370237 353 dbSNP
rs889967982 358 dbSNP
rs570707491 363 dbSNP
rs141250652 364 dbSNP
rs995358957 365 dbSNP
rs1357480000 366 dbSNP
rs900650422 370 dbSNP
rs748350948 371 dbSNP
rs944952120 376 dbSNP
rs1199807456 381 dbSNP
rs912155033 382 dbSNP
rs1230332896 388 dbSNP
rs1041997858 391 dbSNP
rs568630800 392 dbSNP
rs1037230496 394 dbSNP
rs949409031 395 dbSNP
rs914947821 397 dbSNP
rs917912895 404 dbSNP
rs549149979 408 dbSNP
rs1348446340 410 dbSNP
rs990900322 410 dbSNP
rs1332795493 411 dbSNP
rs1303166304 413 dbSNP
rs868778117 414 dbSNP
rs1403800042 415 dbSNP
rs1288980401 416 dbSNP
rs371252112 420 dbSNP
rs925146411 421 dbSNP
rs768632728 424 dbSNP
rs966666481 425 dbSNP
rs1166547266 428 dbSNP
rs1210699833 433 dbSNP
rs1251351658 436 dbSNP
rs1479262211 439 dbSNP
rs1482310885 444 dbSNP
rs1184802812 447 dbSNP
rs1378734744 449 dbSNP
rs1475185361 450 dbSNP
rs1163230752 451 dbSNP
rs1020912084 452 dbSNP
rs1489899837 455 dbSNP
rs1369747652 456 dbSNP
rs1254231818 464 dbSNP
rs1206202016 466 dbSNP
rs997417146 470 dbSNP
rs1271978565 471 dbSNP
rs1308418601 472 dbSNP
rs1193882879 479 dbSNP
rs543718518 481 dbSNP
rs576453005 482 dbSNP
rs1015537035 486 dbSNP
rs1323646761 490 dbSNP
rs1007311948 496 dbSNP
rs1340306003 502 dbSNP
rs887499837 506 dbSNP
rs1028093386 509 dbSNP
rs1048567151 510 dbSNP
rs76401198 515 dbSNP
rs377192550 516 dbSNP
rs545452537 516 dbSNP
rs897309728 516 dbSNP
rs1442432464 518 dbSNP
rs900618182 519 dbSNP
rs747145243 525 dbSNP
rs1017732956 526 dbSNP
rs1037282973 527 dbSNP
rs949632548 530 dbSNP
rs147805116 531 dbSNP
rs893457915 532 dbSNP
rs917926054 540 dbSNP
rs1416523246 545 dbSNP
rs866647809 546 dbSNP
rs1297001848 549 dbSNP
rs1055498228 553 dbSNP
rs938129977 559 dbSNP
rs1230950660 560 dbSNP
rs539392925 567 dbSNP
rs1407469977 568 dbSNP
rs1275584947 573 dbSNP
rs879678663 573 dbSNP
rs925331454 576 dbSNP
rs979528031 577 dbSNP
rs780140034 579 dbSNP
rs1188444529 580 dbSNP
rs937738598 582 dbSNP
rs1450773984 583 dbSNP
rs1414338495 589 dbSNP
rs945228290 591 dbSNP
rs926375340 603 dbSNP
rs1431034747 605 dbSNP
rs1469777680 607 dbSNP
rs758453997 608 dbSNP
rs913735761 609 dbSNP
rs976003787 610 dbSNP
rs144289831 612 dbSNP
rs952771874 613 dbSNP
rs1027653660 615 dbSNP
rs73052800 616 dbSNP
rs1263654269 617 dbSNP
rs962253481 618 dbSNP
rs1172185725 622 dbSNP
rs1321362043 622 dbSNP
rs1303905479 624 dbSNP
rs778598081 625 dbSNP
rs553551520 626 dbSNP
rs537148906 628 dbSNP
rs551092498 632 dbSNP
rs753443942 633 dbSNP
rs1008994979 642 dbSNP
rs1027839039 643 dbSNP
rs1192518043 644 dbSNP
rs1425668150 645 dbSNP
rs1472124046 651 dbSNP
rs763861261 652 dbSNP
rs567734713 654 dbSNP
rs1319071938 655 dbSNP
rs1349335204 657 dbSNP
rs1015683092 659 dbSNP
rs1434613878 661 dbSNP
rs569729227 667 dbSNP
rs1013795345 673 dbSNP
rs1384058964 688 dbSNP
rs755572169 696 dbSNP
rs141999640 697 dbSNP
rs868734770 701 dbSNP
rs903834482 702 dbSNP
rs1288551488 704 dbSNP
rs1044240004 707 dbSNP
rs945408443 712 dbSNP
rs377692133 715 dbSNP
rs531098680 718 dbSNP
rs1183861649 726 dbSNP
rs569976460 729 dbSNP
rs908368124 736 dbSNP
rs1446207978 737 dbSNP
rs982651918 740 dbSNP
rs551663219 741 dbSNP
rs533148705 749 dbSNP
rs1182792610 759 dbSNP
rs1413233097 760 dbSNP
rs1403651695 762 dbSNP
rs1167240432 768 dbSNP
rs551414257 769 dbSNP
rs1409366009 770 dbSNP
rs919845024 773 dbSNP
rs1352661491 776 dbSNP
rs944618750 781 dbSNP
rs973399159 789 dbSNP
rs144890391 791 dbSNP
rs1229524786 796 dbSNP
rs186611672 798 dbSNP
rs541150598 805 dbSNP
rs910574854 806 dbSNP
rs1483249402 813 dbSNP
rs529417944 822 dbSNP
rs972233580 824 dbSNP
rs961732917 833 dbSNP
rs1385893995 837 dbSNP
rs1229722398 841 dbSNP
rs954824217 842 dbSNP
rs1021073470 844 dbSNP
rs1410875087 845 dbSNP
rs561863147 845 dbSNP
rs958288203 846 dbSNP
rs1450731469 848 dbSNP
rs1315181797 854 dbSNP
rs852437 855 dbSNP
rs1225790137 857 dbSNP
rs1002484785 858 dbSNP
rs1276301400 858 dbSNP
rs904845384 860 dbSNP
rs576305460 864 dbSNP
rs896646205 870 dbSNP
rs1013338606 880 dbSNP
rs1444091458 885 dbSNP
rs1210665215 887 dbSNP
rs886859765 894 dbSNP
rs1046896694 901 dbSNP
rs1034371249 902 dbSNP
rs558055762 903 dbSNP
rs1392242019 906 dbSNP
rs919829598 907 dbSNP
rs1430070267 908 dbSNP
rs1040007306 909 dbSNP
rs546093849 910 dbSNP
rs1002458501 915 dbSNP
rs1384852560 917 dbSNP
rs987470280 918 dbSNP
rs571931867 920 dbSNP
rs1043691883 921 dbSNP
rs1272878863 922 dbSNP
rs952372287 922 dbSNP
rs1346830849 932 dbSNP
rs143549897 933 dbSNP
rs945460932 936 dbSNP
rs1267421337 940 dbSNP
rs1464546803 950 dbSNP
rs367697176 953 dbSNP
rs958429981 953 dbSNP
rs1187077302 955 dbSNP
rs1447832447 959 dbSNP
rs1032541436 963 dbSNP
rs892524403 964 dbSNP
rs1002862308 966 dbSNP
rs1479192968 967 dbSNP
rs1411861825 972 dbSNP
rs1040469053 974 dbSNP
rs1456045544 975 dbSNP
rs1322004302 979 dbSNP
rs1239810080 981 dbSNP
rs969668947 983 dbSNP
rs1332678145 991 dbSNP
rs944543551 992 dbSNP
rs79931409 993 dbSNP
rs1013265372 997 dbSNP
rs1230110885 1007 dbSNP
rs143117476 1014 dbSNP
rs1050805210 1016 dbSNP
rs888237021 1023 dbSNP
rs930542424 1036 dbSNP
rs1490960667 1037 dbSNP
rs1200622758 1042 dbSNP
rs181414224 1044 dbSNP
rs1471916402 1049 dbSNP
rs920259348 1052 dbSNP
rs971683079 1062 dbSNP
rs961785463 1063 dbSNP
rs1344811697 1064 dbSNP
rs1161165801 1066 dbSNP
rs1392437009 1079 dbSNP
rs852438 1080 dbSNP
rs1348350534 1083 dbSNP
rs898308703 1084 dbSNP
rs1214448224 1087 dbSNP
rs1307588629 1089 dbSNP
rs112503803 1092 dbSNP
rs1336487127 1095 dbSNP
rs961201350 1096 dbSNP
rs756296916 1099 dbSNP
rs1361896938 1100 dbSNP
rs1405644270 1100 dbSNP
rs201394644 1101 dbSNP
rs568186015 1101 dbSNP
rs555848298 1105 dbSNP
rs1274427039 1109 dbSNP
rs1482267348 1126 dbSNP
rs1002878568 1128 dbSNP
rs1179524176 1133 dbSNP
rs968304964 1135 dbSNP
rs912479151 1136 dbSNP
rs1022730086 1137 dbSNP
rs1009599551 1147 dbSNP
rs1422479810 1148 dbSNP
rs1051689142 1155 dbSNP
rs892452580 1162 dbSNP
rs1368526930 1165 dbSNP
rs913929502 1165 dbSNP
rs1040518926 1167 dbSNP
rs1008976114 1169 dbSNP
rs888953770 1171 dbSNP
rs988620143 1172 dbSNP
rs547651826 1174 dbSNP
rs1310711006 1179 dbSNP
rs1385048737 1180 dbSNP
rs1050232141 1181 dbSNP
rs925441215 1185 dbSNP
rs770214884 1186 dbSNP
rs980966745 1188 dbSNP
rs529116973 1193 dbSNP
rs1219863869 1194 dbSNP
rs149957776 1198 dbSNP
rs1244486289 1199 dbSNP
rs1036227173 1208 dbSNP
rs991799617 1209 dbSNP
rs1187600809 1212 dbSNP
rs569938873 1213 dbSNP
rs1252212197 1225 dbSNP
rs1170889655 1236 dbSNP
rs940385440 1244 dbSNP
rs916911856 1245 dbSNP
rs1204275292 1248 dbSNP
rs1306209342 1249 dbSNP
rs951008055 1251 dbSNP
rs1285815979 1253 dbSNP
rs992571958 1256 dbSNP
rs995654972 1257 dbSNP
rs958450137 1268 dbSNP
rs1296779825 1271 dbSNP
rs898281516 1272 dbSNP
rs1231764894 1274 dbSNP
rs386709752 1275 dbSNP
rs926802054 1275 dbSNP
rs1265525572 1276 dbSNP
rs561542289 1277 dbSNP
rs11556570 1278 dbSNP
rs540163304 1287 dbSNP
rs1009817769 1288 dbSNP
rs956724128 1290 dbSNP
rs776704459 1293 dbSNP
rs1178585773 1294 dbSNP
rs1178554164 1295 dbSNP
rs1480467651 1302 dbSNP
rs565913289 1308 dbSNP
rs892460778 1317 dbSNP
rs760810222 1324 dbSNP
rs1052486012 1325 dbSNP
rs889184194 1326 dbSNP
rs1367413751 1329 dbSNP
rs547817523 1330 dbSNP
rs529361055 1336 dbSNP
rs994711603 1337 dbSNP
rs898977656 1342 dbSNP
rs73676614 1343 dbSNP
rs948220285 1344 dbSNP
rs1318179288 1346 dbSNP
rs1216139711 1350 dbSNP
rs550317995 1351 dbSNP
rs895494641 1355 dbSNP
rs1201334903 1356 dbSNP
rs1056687238 1358 dbSNP
rs73336241 1362 dbSNP
rs1156820205 1367 dbSNP
rs927092253 1369 dbSNP
rs992396136 1370 dbSNP
rs1160191132 1377 dbSNP
rs1241276448 1380 dbSNP
rs1422909361 1382 dbSNP
rs1305360998 1393 dbSNP
rs1346495143 1396 dbSNP
rs1336514908 1397 dbSNP
rs115776482 1398 dbSNP
rs1286992814 1403 dbSNP
rs190154117 1408 dbSNP
rs572349629 1414 dbSNP
rs988397413 1415 dbSNP
rs1319578795 1417 dbSNP
rs956901016 1418 dbSNP
rs1018976035 1419 dbSNP
rs987463067 1420 dbSNP
rs1482592562 1421 dbSNP
rs1179997224 1426 dbSNP
rs953492657 1428 dbSNP
rs559882474 1429 dbSNP
rs890946589 1430 dbSNP
rs185350352 1432 dbSNP
rs995327907 1434 dbSNP
rs1454947735 1441 dbSNP
rs1010107057 1445 dbSNP
rs1364015636 1449 dbSNP
rs531700450 1457 dbSNP
rs1052829590 1458 dbSNP
rs555813834 1460 dbSNP
rs1366649085 1462 dbSNP
rs852439 1463 dbSNP
rs1184624359 1466 dbSNP
rs1004760845 1467 dbSNP
rs1461204428 1468 dbSNP
rs545906927 1469 dbSNP
rs1056963278 1471 dbSNP
rs1351576456 1479 dbSNP
rs899634756 1480 dbSNP
rs113132759 1481 dbSNP
rs368350646 1482 dbSNP
rs930170019 1490 dbSNP
rs1042844767 1496 dbSNP
rs947088407 1497 dbSNP
rs150776265 1498 dbSNP
rs988283178 1499 dbSNP
rs371780795 1504 dbSNP
rs912178613 1514 dbSNP
rs988112329 1518 dbSNP
rs953446979 1520 dbSNP
rs1422048211 1521 dbSNP
rs547786659 1524 dbSNP
rs1010032645 1525 dbSNP
rs73336234 1526 dbSNP
rs973521723 1536 dbSNP
rs568478479 1537 dbSNP
rs546905185 1538 dbSNP
rs1224723945 1539 dbSNP
rs1164540947 1545 dbSNP
rs1444463810 1546 dbSNP
rs903838258 1550 dbSNP
rs1462547472 1552 dbSNP
rs1014729626 1556 dbSNP
rs852440 1557 dbSNP
rs865799986 1558 dbSNP
rs1191263209 1570 dbSNP
rs1328308989 1572 dbSNP
rs1244242892 1574 dbSNP
rs896573457 1580 dbSNP
rs895633377 1583 dbSNP
rs1172574223 1584 dbSNP
rs1427818120 1591 dbSNP
rs1471208458 1594 dbSNP
rs1035648363 1604 dbSNP
rs1387222204 1607 dbSNP
rs1380204077 1630 dbSNP
rs1319852749 1632 dbSNP
rs1397071099 1633 dbSNP
rs531870199 1643 dbSNP
rs1281078717 1649 dbSNP
rs1325619712 1650 dbSNP
rs1203475622 1661 dbSNP
rs564266339 1662 dbSNP
rs1292854397 1664 dbSNP
rs1264117107 1665 dbSNP
rs1447731535 1669 dbSNP
rs71004690 1670 dbSNP
rs78254837 1670 dbSNP
rs1481721801 1671 dbSNP
rs930171076 1678 dbSNP
rs1246433493 1680 dbSNP
rs552387304 1681 dbSNP
rs1038606229 1682 dbSNP
rs1385241277 1682 dbSNP
rs1229456744 1683 dbSNP
rs1347129208 1683 dbSNP
rs941643816 1684 dbSNP
rs1236979010 1685 dbSNP
rs199935271 1686 dbSNP
rs905534801 1687 dbSNP
rs113115920 1688 dbSNP
rs1011342310 1689 dbSNP
rs1183390615 1689 dbSNP
rs1250443290 1689 dbSNP
rs1417794697 1689 dbSNP
rs200227974 1689 dbSNP
rs201794175 1689 dbSNP
rs796494865 1689 dbSNP
rs1483328847 1690 dbSNP
rs1377811413 1692 dbSNP
rs891523536 1694 dbSNP
rs922369786 1694 dbSNP
rs1223710209 1695 dbSNP
rs1367033828 1697 dbSNP
rs527502124 1698 dbSNP
rs1052843400 1699 dbSNP
rs1250675858 1700 dbSNP
rs865943500 1703 dbSNP
rs1181443590 1711 dbSNP
rs1386711786 1715 dbSNP
rs1444802686 1716 dbSNP
rs560346730 1719 dbSNP
rs1167752156 1721 dbSNP
rs912062282 1724 dbSNP
rs541782898 1728 dbSNP
rs932193947 1732 dbSNP
rs921960741 1736 dbSNP
rs1000108940 1739 dbSNP
rs1298653994 1740 dbSNP
rs1397372944 1743 dbSNP
rs868491366 1746 dbSNP
rs1451997471 1747 dbSNP
rs75954616 1750 dbSNP
rs574063300 1751 dbSNP
rs1334720382 1757 dbSNP
rs970417463 1761 dbSNP
rs973789424 1763 dbSNP
rs963333754 1764 dbSNP
rs907987402 1769 dbSNP
rs139908682 1770 dbSNP
rs1295367459 1771 dbSNP
rs1306105027 1779 dbSNP
rs543884539 1780 dbSNP
rs959896846 1781 dbSNP
rs1323369762 1784 dbSNP
rs1311368293 1787 dbSNP
rs1481499433 1787 dbSNP
rs1244391246 1789 dbSNP
rs576577510 1790 dbSNP
rs778708975 1793 dbSNP
rs1035896892 1795 dbSNP
rs1461514997 1798 dbSNP
rs1001461706 1800 dbSNP
rs970355350 1801 dbSNP
rs770615403 1804 dbSNP
rs852441 1805 dbSNP
rs539983043 1806 dbSNP
rs1428519872 1814 dbSNP
rs891450324 1817 dbSNP
rs890045407 1818 dbSNP
rs1052895755 1821 dbSNP
rs1197339631 1822 dbSNP
rs181845931 1823 dbSNP
rs1269581729 1827 dbSNP
rs1360400606 1827 dbSNP
rs890640356 1828 dbSNP
rs1384281401 1832 dbSNP
rs777258789 1834 dbSNP
rs1216245770 1836 dbSNP
rs1264501987 1837 dbSNP
rs933676707 1842 dbSNP
rs1346886729 1846 dbSNP
rs1258576993 1847 dbSNP
rs1283397790 1850 dbSNP
rs755812160 1851 dbSNP
rs1403913834 1853 dbSNP
rs554409637 1855 dbSNP
rs1186914617 1858 dbSNP
rs536187317 1861 dbSNP
rs934438311 1862 dbSNP
rs932272818 1866 dbSNP
rs922150967 1870 dbSNP
rs979003015 1878 dbSNP
rs1343667683 1879 dbSNP
rs146102863 1886 dbSNP
rs942073859 1888 dbSNP
rs1289847719 1889 dbSNP
rs907870911 1890 dbSNP
rs983507970 1891 dbSNP
rs960074715 1892 dbSNP
rs189339915 1893 dbSNP
rs1345663935 1895 dbSNP
rs1035055840 1903 dbSNP
rs758838369 1904 dbSNP
rs897235782 1907 dbSNP
rs969905151 1912 dbSNP
rs1234827238 1914 dbSNP
rs117332740 1920 dbSNP
rs1183702159 1925 dbSNP
rs745682845 1930 dbSNP
rs1290830642 1932 dbSNP
rs1006148145 1934 dbSNP
rs890014120 1935 dbSNP
rs1269528589 1940 dbSNP
rs1011497570 1946 dbSNP
rs1176711004 1949 dbSNP
rs1405831904 1958 dbSNP
rs750909895 1959 dbSNP
rs1159451313 1961 dbSNP
rs142842205 1964 dbSNP
rs765831946 1969 dbSNP
rs1053236625 1970 dbSNP
rs1470863298 1975 dbSNP
rs1350986944 1977 dbSNP
rs1222389817 1980 dbSNP
rs570916071 1988 dbSNP
rs552391913 1989 dbSNP
rs890848361 2006 dbSNP
rs925699742 2008 dbSNP
rs1030513707 2011 dbSNP
rs1313920172 2018 dbSNP
rs1356741616 2022 dbSNP
rs1247919218 2023 dbSNP
rs762081232 2025 dbSNP
rs915778149 2036 dbSNP
rs992738753 2039 dbSNP
rs1437195334 2040 dbSNP
rs996770708 2046 dbSNP
rs527455949 2047 dbSNP
rs1037949886 2050 dbSNP
rs1179564008 2053 dbSNP
rs201976922 2056 dbSNP
rs1384846650 2062 dbSNP
rs566567644 2062 dbSNP
rs942250220 2073 dbSNP
rs1414941305 2080 dbSNP
rs1017454454 2088 dbSNP
rs1327426833 2093 dbSNP
rs1355847974 2096 dbSNP
rs1455013093 2101 dbSNP
rs1446889409 2103 dbSNP
rs1005660103 2108 dbSNP
rs886445221 2110 dbSNP
rs1454209720 2112 dbSNP
rs1047697185 2113 dbSNP
rs548451283 2116 dbSNP
rs998390348 2119 dbSNP
rs901435912 2124 dbSNP
rs1052750809 2127 dbSNP
rs1307932185 2128 dbSNP
rs1199361055 2130 dbSNP
rs1410430262 2132 dbSNP
rs1242557298 2136 dbSNP
rs1159402082 2142 dbSNP
rs1185634510 2145 dbSNP
rs1475291519 2148 dbSNP
rs751872006 2152 dbSNP
rs938792513 2152 dbSNP
rs529968342 2153 dbSNP
rs1403223945 2154 dbSNP
rs537506293 2158 dbSNP
rs928739344 2159 dbSNP
rs1325708401 2168 dbSNP
rs1462554476 2175 dbSNP
rs34290885 2183 dbSNP
rs575141728 2183 dbSNP
rs948600235 2193 dbSNP
rs1259537009 2197 dbSNP
rs1321491936 2201 dbSNP
rs914404902 2207 dbSNP
rs948487073 2208 dbSNP
rs543845859 2216 dbSNP
rs955905118 2217 dbSNP
rs1446581828 2221 dbSNP
rs531991209 2224 dbSNP
rs1056993743 2227 dbSNP
rs1026629813 2228 dbSNP
rs919181465 2228 dbSNP
rs1426666064 2237 dbSNP
rs1031361935 2241 dbSNP
rs1172581020 2246 dbSNP
rs564949166 2248 dbSNP
rs1349543124 2249 dbSNP
rs183529755 2254 dbSNP
rs1404322839 2257 dbSNP
rs984160995 2258 dbSNP
rs1347254393 2259 dbSNP
rs954166021 2260 dbSNP
rs1275462052 2264 dbSNP
rs561942877 2265 dbSNP
rs1028528721 2266 dbSNP
rs572583622 2267 dbSNP
rs900673776 2269 dbSNP
rs1288661594 2277 dbSNP
rs965569659 2278 dbSNP
rs1336726692 2283 dbSNP
rs1016344969 2284 dbSNP
rs1032356910 2286 dbSNP
rs1481669905 2291 dbSNP
rs1006446365 2292 dbSNP
rs886662967 2293 dbSNP
rs11974054 2303 dbSNP
rs373787213 2304 dbSNP
rs1423777162 2305 dbSNP
rs1301007504 2307 dbSNP
rs1367397555 2308 dbSNP
rs542538125 2310 dbSNP
rs1387239854 2315 dbSNP
rs1044909544 2319 dbSNP
rs1335222436 2320 dbSNP
rs775675397 2322 dbSNP
rs575246150 2323 dbSNP
rs1385752959 2326 dbSNP
rs1354596423 2327 dbSNP
rs1245717502 2329 dbSNP
rs1289981936 2330 dbSNP
rs191342965 2331 dbSNP
rs538193398 2334 dbSNP
rs570778064 2335 dbSNP
rs1435566507 2336 dbSNP
rs759745566 2339 dbSNP
rs919122057 2340 dbSNP
rs538409742 2342 dbSNP
rs866272241 2344 dbSNP
rs1161481627 2350 dbSNP
rs1386830377 2351 dbSNP
rs770938855 2356 dbSNP
rs1227933095 2360 dbSNP
rs1167246016 2363 dbSNP
rs1395941593 2365 dbSNP
rs749013323 2377 dbSNP
rs1389745498 2379 dbSNP
rs558976871 2380 dbSNP
rs1283510537 2382 dbSNP
rs1248616954 2388 dbSNP
rs1377955479 2390 dbSNP
rs924553796 2401 dbSNP
rs777644716 2404 dbSNP
rs534069990 2407 dbSNP
rs955248479 2408 dbSNP
rs1027952608 2409 dbSNP
rs368171236 2412 dbSNP
rs1364708811 2413 dbSNP
rs769396345 2420 dbSNP
rs1460630944 2422 dbSNP
rs921358603 2426 dbSNP
rs566639798 2428 dbSNP
rs548031905 2430 dbSNP
rs1424168956 2433 dbSNP
rs852442 2434 dbSNP
rs1371276250 2438 dbSNP
rs1358861106 2443 dbSNP
rs77248118 2444 dbSNP
rs1401082873 2448 dbSNP
rs978075818 2448 dbSNP
rs550465128 2453 dbSNP
rs377700330 2454 dbSNP
rs531954979 2458 dbSNP
rs1325235975 2462 dbSNP
rs1026565408 2467 dbSNP
rs1258202725 2475 dbSNP
rs1421582979 2479 dbSNP
rs1003120629 2484 dbSNP
rs1201457707 2490 dbSNP
rs1257395986 2498 dbSNP
rs1483337920 2509 dbSNP
rs1012603201 2510 dbSNP
rs754474047 2513 dbSNP
rs1477247340 2518 dbSNP
rs564760360 2518 dbSNP
rs1424493041 2519 dbSNP
rs1480154469 2519 dbSNP
rs1013439090 2524 dbSNP
rs893199435 2532 dbSNP
rs1054532646 2534 dbSNP
rs1002654408 2535 dbSNP
rs934506258 2537 dbSNP
rs1279385195 2541 dbSNP
rs924429702 2542 dbSNP
rs1051460371 2545 dbSNP
rs941901992 2564 dbSNP
rs933881565 2565 dbSNP
rs887709463 2569 dbSNP
rs1312442260 2570 dbSNP
rs879452153 2571 dbSNP
rs751149228 2572 dbSNP
rs1490417270 2573 dbSNP
rs540299566 2581 dbSNP
rs187715839 2584 dbSNP
rs962339211 2585 dbSNP
rs1309769537 2587 dbSNP
rs1189576623 2588 dbSNP
rs1274410318 2589 dbSNP
rs1214033643 2590 dbSNP
rs752161532 2593 dbSNP
rs1158643832 2594 dbSNP
rs1378927939 2595 dbSNP
rs184812314 2598 dbSNP
rs1299119151 2600 dbSNP
rs1365528372 2601 dbSNP
rs950920260 2610 dbSNP
rs1294815673 2612 dbSNP
rs1405737870 2615 dbSNP
rs1367667000 2617 dbSNP
rs1345123142 2633 dbSNP
rs79215819 2639 dbSNP
rs1240630878 2640 dbSNP
rs575089022 2641 dbSNP
rs1456250215 2650 dbSNP
rs192803477 2658 dbSNP
rs1248592543 2660 dbSNP
rs969350063 2672 dbSNP
rs763439593 2675 dbSNP
rs138928771 2676 dbSNP
rs1464625770 2677 dbSNP
rs1159657755 2679 dbSNP
rs1384968970 2685 dbSNP
rs767179508 2686 dbSNP
rs1167509230 2689 dbSNP
rs544937732 2691 dbSNP
rs752950717 2692 dbSNP
rs754564803 2698 dbSNP
rs752224343 2699 dbSNP
rs1266306978 2701 dbSNP
rs1189839878 2704 dbSNP
rs9401 2706 dbSNP
rs577154563 2707 dbSNP
rs565658533 2708 dbSNP
rs1314177938 2725 dbSNP
rs558710798 2735 dbSNP
rs998904739 2739 dbSNP
rs534297417 2740 dbSNP
rs1230028198 2743 dbSNP
rs1290517167 2748 dbSNP
rs759140527 2752 dbSNP
rs903018560 2754 dbSNP
rs1003032059 2760 dbSNP
rs759500393 2768 dbSNP
rs1316631634 2771 dbSNP
rs116952741 2776 dbSNP
rs376126209 2777 dbSNP
rs933914999 2781 dbSNP
rs1459288230 2785 dbSNP
rs1179469369 2803 dbSNP
rs1015137550 2804 dbSNP
rs554656063 2805 dbSNP
rs1040007380 2806 dbSNP
rs1415187465 2807 dbSNP
rs941069224 2810 dbSNP
rs77494326 2812 dbSNP
rs909545527 2813 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               :||| |   :|||||| 
Target 5' -----GCCACU---GCACUCCa 3'
1 - 14
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000425013.2 | 3UTR | GCCACUGCACUCCAGCCUGAGCAACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*