miRTarBase - #MIRT702096 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MCFD2   
Synonyms F5F8D, F5F8D2, LMAN1IP, SDNSF
Description multiple coagulation factor deficiency 2
Transcript NM_001171506   
Other Transcripts NM_001171507 , NM_001171508 , NM_001171509 , NM_001171510 , NM_001171511 , NM_139279   
Putative miRNA Targets on MCFD2
3'UTR of MCFD2
(miRNA target sites are highlighted)
3601 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 :||||  ||||||| 
Target 5' tagtctgTATTA-ATGCTGCTg 3'
248 - 268 150.00 -11.40
miRNA  3' guGUUUGGU----AAU-----ACACGACGAu 5'
            |||::||    ||:     | ||||||| 
1706 - 1736 150.00 -12.40
miRNA  3' guGUUUGGUAAUAC------------ACGACGau 5'
            ||||:|  ||||            ||||||  
1789 - 1822 130.00 -16.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
336380 62 ClinVar
336379 64 ClinVar
336378 73 ClinVar
899218 79 ClinVar
336377 84 ClinVar
336376 133 ClinVar
336375 173 ClinVar
898103 217 ClinVar
336374 311 ClinVar
898102 354 ClinVar
898101 375 ClinVar
898100 418 ClinVar
898099 422 ClinVar
336373 428 ClinVar
898098 445 ClinVar
336372 498 ClinVar
336371 517 ClinVar
896474 529 ClinVar
336370 557 ClinVar
336369 569 ClinVar
896473 632 ClinVar
896472 640 ClinVar
896471 648 ClinVar
336368 693 ClinVar
895035 751 ClinVar
336367 892 ClinVar
336366 912 ClinVar
895034 991 ClinVar
336365 1010 ClinVar
895033 1024 ClinVar
336364 1042 ClinVar
336363 1043 ClinVar
899158 1059 ClinVar
899157 1079 ClinVar
336362 1111 ClinVar
899156 1124 ClinVar
899155 1151 ClinVar
336361 1158 ClinVar
899154 1187 ClinVar
336360 1267 ClinVar
336359 1289 ClinVar
336358 1314 ClinVar
898041 1316 ClinVar
336357 1346 ClinVar
336356 1354 ClinVar
898040 1407 ClinVar
336355 1415 ClinVar
896409 1448 ClinVar
896408 1464 ClinVar
336354 1525 ClinVar
896407 1537 ClinVar
896406 1610 ClinVar
336353 1677 ClinVar
336352 1724 ClinVar
336351 1752 ClinVar
336350 1788 ClinVar
894970 1867 ClinVar
336349 1875 ClinVar
336348 1908 ClinVar
336347 1924 ClinVar
336346 1995 ClinVar
336345 2017 ClinVar
899099 2056 ClinVar
336344 2075 ClinVar
899098 2106 ClinVar
336343 2121 ClinVar
899097 2128 ClinVar
336342 2141 ClinVar
336341 2163 ClinVar
336340 2169 ClinVar
336339 2336 ClinVar
897965 2423 ClinVar
897964 2436 ClinVar
336338 2454 ClinVar
897963 2556 ClinVar
336337 2565 ClinVar
812908 2632 ClinVar
897962 2647 ClinVar
336336 2658 ClinVar
336335 2675 ClinVar
896349 2760 ClinVar
896348 2761 ClinVar
336334 2782 ClinVar
336333 2789 ClinVar
896347 2843 ClinVar
336332 2848 ClinVar
896346 2983 ClinVar
336331 3014 ClinVar
336330 3073 ClinVar
336329 3099 ClinVar
336328 3100 ClinVar
894909 3272 ClinVar
336327 3293 ClinVar
336326 3318 ClinVar
336325 3354 ClinVar
894908 3591 ClinVar
COSN30498444 6 COSMIC
COSN8609265 16 COSMIC
COSN31514458 29 COSMIC
COSN31483497 52 COSMIC
COSN30504830 62 COSMIC
COSN30528051 89 COSMIC
COSN30493420 124 COSMIC
COSN30463773 129 COSMIC
COSN18726985 133 COSMIC
COSN31602019 157 COSMIC
COSN31796432 355 COSMIC
COSN31796394 361 COSMIC
COSN17461762 395 COSMIC
COSN17037844 693 COSMIC
COSN4804688 807 COSMIC
COSN29928030 1336 COSMIC
COSN18000296 1460 COSMIC
COSN27851490 1655 COSMIC
COSN17182847 2721 COSMIC
COSN25775589 2826 COSMIC
COSN31778208 2844 COSMIC
COSN7804504 2868 COSMIC
COSN31513797 2971 COSMIC
COSN31534054 3128 COSMIC
COSN31583225 3210 COSMIC
COSN19658348 3318 COSMIC
COSN31537712 3332 COSMIC
COSN30543790 3367 COSMIC
COSN515917 3375 COSMIC
COSN31516144 3393 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1458622569 2 dbSNP
rs1447255350 3 dbSNP
rs1311245186 6 dbSNP
rs1262849477 7 dbSNP
rs762727755 8 dbSNP
rs1354940540 10 dbSNP
rs775316481 11 dbSNP
rs769408679 14 dbSNP
rs759190774 19 dbSNP
rs1210095487 22 dbSNP
rs776171930 26 dbSNP
rs376318903 27 dbSNP
rs1202821676 29 dbSNP
rs964556981 32 dbSNP
rs373036686 34 dbSNP
rs756891034 38 dbSNP
rs779558728 41 dbSNP
rs562412082 42 dbSNP
rs749647374 46 dbSNP
rs1016538263 54 dbSNP
rs886056117 62 dbSNP
rs1208319065 63 dbSNP
rs754447509 64 dbSNP
rs886193020 66 dbSNP
rs941046181 69 dbSNP
rs1025904661 70 dbSNP
rs71423925 73 dbSNP
rs1416769665 76 dbSNP
rs1286902800 81 dbSNP
rs528839446 82 dbSNP
rs182576601 84 dbSNP
rs1055285647 88 dbSNP
rs938291632 91 dbSNP
rs1432591232 93 dbSNP
rs1172017493 94 dbSNP
rs1276950405 118 dbSNP
rs1375016527 124 dbSNP
rs1400826843 125 dbSNP
rs1290748725 129 dbSNP
rs775740460 130 dbSNP
rs75416242 133 dbSNP
rs1350508539 134 dbSNP
rs910828410 141 dbSNP
rs945441936 150 dbSNP
rs913993774 154 dbSNP
rs990358730 157 dbSNP
rs1217459217 161 dbSNP
rs572389042 163 dbSNP
rs1485232327 164 dbSNP
rs1191735283 171 dbSNP
rs886056116 173 dbSNP
rs1486712419 177 dbSNP
rs1254745622 180 dbSNP
rs1452359121 182 dbSNP
rs1192840729 183 dbSNP
rs1360593906 187 dbSNP
rs933974905 190 dbSNP
rs139447086 191 dbSNP
rs1032097260 193 dbSNP
rs998827412 198 dbSNP
rs746370141 217 dbSNP
rs964998587 220 dbSNP
rs1016061945 222 dbSNP
rs1172903030 225 dbSNP
rs1373900410 226 dbSNP
rs1439335023 228 dbSNP
rs1012783418 233 dbSNP
rs1378083947 247 dbSNP
rs1474980396 248 dbSNP
rs1423127542 249 dbSNP
rs985039913 250 dbSNP
rs1038330905 268 dbSNP
rs1005481669 269 dbSNP
rs371983269 271 dbSNP
rs1221592222 274 dbSNP
rs886987440 275 dbSNP
rs1467137498 276 dbSNP
rs950615769 277 dbSNP
rs1047189488 282 dbSNP
rs753705093 283 dbSNP
rs1263994263 294 dbSNP
rs1179173508 301 dbSNP
rs1209579421 302 dbSNP
rs1418705268 308 dbSNP
rs886056115 311 dbSNP
rs922373706 318 dbSNP
rs1261044743 319 dbSNP
rs1238282784 324 dbSNP
rs879826825 327 dbSNP
rs943580269 334 dbSNP
rs910712125 337 dbSNP
rs1277426945 343 dbSNP
rs1372236670 348 dbSNP
rs191255002 354 dbSNP
rs1276751471 355 dbSNP
rs940198548 361 dbSNP
rs1331961638 362 dbSNP
rs1213021499 367 dbSNP
rs896144670 371 dbSNP
rs957621417 375 dbSNP
rs1033319706 378 dbSNP
rs1283069461 380 dbSNP
rs1202250614 383 dbSNP
rs776760267 387 dbSNP
rs1002437272 388 dbSNP
rs977835778 399 dbSNP
rs971408462 401 dbSNP
rs1024832907 402 dbSNP
rs1164842090 406 dbSNP
rs578055409 407 dbSNP
rs1334776055 413 dbSNP
rs904105907 414 dbSNP
rs1043866618 418 dbSNP
rs1415039127 420 dbSNP
rs1314284181 421 dbSNP
rs781195000 428 dbSNP
rs1232089115 440 dbSNP
rs1278261788 441 dbSNP
rs1160902939 445 dbSNP
rs1212704470 453 dbSNP
rs892676992 457 dbSNP
rs1211906545 462 dbSNP
rs1259793898 463 dbSNP
rs1005368953 467 dbSNP
rs1484741370 468 dbSNP
rs887038350 470 dbSNP
rs1046962109 471 dbSNP
rs1476699459 472 dbSNP
rs1166611008 477 dbSNP
rs1419282762 481 dbSNP
rs369281271 484 dbSNP
rs757318063 490 dbSNP
rs556333990 493 dbSNP
rs1373297327 497 dbSNP
rs144674773 498 dbSNP
rs942461042 503 dbSNP
rs893517338 504 dbSNP
rs934091404 515 dbSNP
rs761766519 517 dbSNP
rs1348331754 526 dbSNP
rs1471868400 528 dbSNP
rs542831100 529 dbSNP
rs1346076825 542 dbSNP
rs1211410218 544 dbSNP
rs1457739523 546 dbSNP
rs1241984267 548 dbSNP
rs185756640 557 dbSNP
rs1200976820 559 dbSNP
rs751707844 562 dbSNP
rs149363149 569 dbSNP
rs1433766724 578 dbSNP
rs984765706 587 dbSNP
rs950589313 588 dbSNP
rs919121295 592 dbSNP
rs991841759 596 dbSNP
rs917266721 599 dbSNP
rs1301035806 600 dbSNP
rs960462247 607 dbSNP
rs1369953131 610 dbSNP
rs1232844209 615 dbSNP
rs1280287656 616 dbSNP
rs1033268088 617 dbSNP
rs1002285871 625 dbSNP
rs967772216 628 dbSNP
rs1469336136 629 dbSNP
rs1022965604 634 dbSNP
rs951228199 635 dbSNP
rs534106665 640 dbSNP
rs892624358 642 dbSNP
rs1333050289 643 dbSNP
rs1365124555 647 dbSNP
rs1468272258 648 dbSNP
rs1157557626 650 dbSNP
rs752483756 666 dbSNP
rs1462998611 667 dbSNP
rs764970057 669 dbSNP
rs899928462 671 dbSNP
rs1393458966 683 dbSNP
rs1391696666 685 dbSNP
rs1039826163 688 dbSNP
rs566742625 692 dbSNP
rs28516550 693 dbSNP
rs909910182 704 dbSNP
rs377101269 708 dbSNP
rs1335495030 709 dbSNP
rs901049690 711 dbSNP
rs568939641 714 dbSNP
rs1271749701 717 dbSNP
rs1017896932 727 dbSNP
rs1196804717 730 dbSNP
rs1006488809 731 dbSNP
rs1049439497 734 dbSNP
rs1180624033 738 dbSNP
rs550453047 742 dbSNP
rs1417985502 749 dbSNP
rs544942135 751 dbSNP
rs919068837 753 dbSNP
rs1417148812 754 dbSNP
rs991956385 755 dbSNP
rs1053454227 762 dbSNP
rs1394038368 770 dbSNP
rs960410177 771 dbSNP
rs561381759 778 dbSNP
rs926357317 779 dbSNP
rs1389911799 780 dbSNP
rs1307608419 787 dbSNP
rs1356182597 797 dbSNP
rs1236896388 799 dbSNP
rs980585592 802 dbSNP
rs903347385 804 dbSNP
rs968099656 819 dbSNP
rs1246543865 820 dbSNP
rs1337803793 824 dbSNP
rs1021987761 828 dbSNP
rs560779002 831 dbSNP
rs1218890238 832 dbSNP
rs1486438769 834 dbSNP
rs1185245091 835 dbSNP
rs950335076 841 dbSNP
rs1429097578 853 dbSNP
rs546168417 856 dbSNP
rs1323212879 858 dbSNP
rs1172383416 873 dbSNP
rs1010203545 879 dbSNP
rs181372586 880 dbSNP
rs1461238063 885 dbSNP
rs560373576 886 dbSNP
rs1168214668 891 dbSNP
rs886056114 892 dbSNP
rs1238808591 899 dbSNP
rs1351331105 903 dbSNP
rs763119325 907 dbSNP
rs991502878 909 dbSNP
rs1378507030 911 dbSNP
rs189018618 912 dbSNP
rs186261378 915 dbSNP
rs578143759 934 dbSNP
rs998348737 935 dbSNP
rs984203062 936 dbSNP
rs900043107 937 dbSNP
rs1349646849 949 dbSNP
rs1208248426 958 dbSNP
rs1434570668 963 dbSNP
rs1351892370 977 dbSNP
rs867582100 979 dbSNP
rs1485885655 981 dbSNP
rs1164226403 982 dbSNP
rs1040176620 988 dbSNP
rs1259504368 991 dbSNP
rs951325212 1000 dbSNP
rs1005666704 1006 dbSNP
rs138758588 1010 dbSNP
rs1171961019 1015 dbSNP
rs35218202 1016 dbSNP
rs1358689495 1028 dbSNP
rs111603188 1042 dbSNP
rs114662283 1043 dbSNP
rs760256247 1044 dbSNP
rs919183331 1046 dbSNP
rs1383513440 1049 dbSNP
rs1434968562 1053 dbSNP
rs1420248449 1059 dbSNP
rs1424901101 1060 dbSNP
rs555818192 1062 dbSNP
rs939184847 1063 dbSNP
rs1269161263 1071 dbSNP
rs926500408 1075 dbSNP
rs1487034701 1076 dbSNP
rs999273788 1078 dbSNP
rs980914930 1079 dbSNP
rs1386166823 1080 dbSNP
rs1287601340 1082 dbSNP
rs868281161 1088 dbSNP
rs1041910234 1095 dbSNP
rs534146289 1096 dbSNP
rs1240745437 1097 dbSNP
rs1311599404 1100 dbSNP
rs1214226048 1101 dbSNP
rs914866518 1102 dbSNP
rs548766359 1103 dbSNP
rs181922575 1111 dbSNP
rs1452302300 1118 dbSNP
rs551560845 1119 dbSNP
rs557723030 1119 dbSNP
rs1424792962 1122 dbSNP
rs1369911429 1123 dbSNP
rs190398265 1124 dbSNP
rs1056039741 1125 dbSNP
rs1457196366 1138 dbSNP
rs937365077 1145 dbSNP
rs1029919146 1148 dbSNP
rs761404637 1151 dbSNP
rs977028081 1155 dbSNP
rs886056113 1158 dbSNP
rs1304297636 1160 dbSNP
rs1327814040 1165 dbSNP
rs1233859715 1178 dbSNP
rs1274903930 1182 dbSNP
rs184285591 1183 dbSNP
rs550737178 1187 dbSNP
rs918642344 1189 dbSNP
rs976626433 1196 dbSNP
rs1174316421 1201 dbSNP
rs1435309394 1204 dbSNP
rs77998573 1211 dbSNP
rs1472283424 1221 dbSNP
rs965570611 1230 dbSNP
rs535201945 1231 dbSNP
rs1164597369 1234 dbSNP
rs1192451366 1237 dbSNP
rs985339197 1238 dbSNP
rs888543043 1240 dbSNP
rs957733560 1245 dbSNP
rs1205262214 1247 dbSNP
rs7596256 1247 dbSNP
rs1294565097 1251 dbSNP
rs1026033202 1260 dbSNP
rs148148734 1260 dbSNP
rs59011693 1260 dbSNP
rs1031972367 1264 dbSNP
rs7596245 1267 dbSNP
rs1308971224 1269 dbSNP
rs1206931362 1275 dbSNP
rs1249832562 1277 dbSNP
rs1482839366 1278 dbSNP
rs546205296 1286 dbSNP
rs527427772 1289 dbSNP
rs1472128487 1291 dbSNP
rs1277375740 1293 dbSNP
rs1218246300 1297 dbSNP
rs1338795208 1298 dbSNP
rs1056291706 1310 dbSNP
rs1411958905 1313 dbSNP
rs150644996 1314 dbSNP
rs1402071299 1315 dbSNP
rs1301628664 1316 dbSNP
rs904992870 1318 dbSNP
rs1338135912 1322 dbSNP
rs1447210222 1323 dbSNP
rs551828232 1329 dbSNP
rs1363844184 1333 dbSNP
rs1273613497 1334 dbSNP
rs1044921290 1336 dbSNP
rs1282577850 1342 dbSNP
rs111535939 1346 dbSNP
rs1187495067 1349 dbSNP
rs886056112 1354 dbSNP
rs562966477 1357 dbSNP
rs895984920 1371 dbSNP
rs1056094313 1381 dbSNP
rs1001795665 1385 dbSNP
rs1454459193 1385 dbSNP
rs1399475772 1391 dbSNP
rs1413359570 1392 dbSNP
rs1318381552 1397 dbSNP
rs915002774 1401 dbSNP
rs888661188 1405 dbSNP
rs138459734 1407 dbSNP
rs1296673668 1413 dbSNP
rs147096932 1415 dbSNP
rs1235302826 1418 dbSNP
rs1276788952 1421 dbSNP
rs918707809 1424 dbSNP
rs1422755144 1427 dbSNP
rs1199988653 1431 dbSNP
rs1041505834 1448 dbSNP
rs922294243 1452 dbSNP
rs943911126 1456 dbSNP
rs959842293 1460 dbSNP
rs1207325090 1464 dbSNP
rs976976169 1473 dbSNP
rs911046210 1475 dbSNP
rs964345803 1478 dbSNP
rs1469157673 1496 dbSNP
rs985224668 1501 dbSNP
rs1461767960 1503 dbSNP
rs562121864 1507 dbSNP
rs1477474856 1510 dbSNP
rs372935939 1513 dbSNP
rs1409514292 1515 dbSNP
rs1455588640 1516 dbSNP
rs1018820179 1517 dbSNP
rs1196543049 1521 dbSNP
rs7596198 1525 dbSNP
rs1253332282 1531 dbSNP
rs1228181666 1532 dbSNP
rs977816663 1533 dbSNP
rs1232795179 1535 dbSNP
rs1280227531 1537 dbSNP
rs866411092 1545 dbSNP
rs573324362 1548 dbSNP
rs1227126719 1552 dbSNP
rs953025727 1559 dbSNP
rs1310715135 1560 dbSNP
rs771471485 1563 dbSNP
rs1398300203 1564 dbSNP
rs994235775 1566 dbSNP
rs1265702664 1568 dbSNP
rs895807880 1572 dbSNP
rs1384255380 1573 dbSNP
rs966762131 1573 dbSNP
rs1471300690 1576 dbSNP
rs1024765834 1604 dbSNP
rs992310604 1626 dbSNP
rs1035665246 1627 dbSNP
rs1003388868 1629 dbSNP
rs1401968953 1634 dbSNP
rs1161309799 1638 dbSNP
rs376820950 1639 dbSNP
rs1386432484 1657 dbSNP
rs1045265134 1658 dbSNP
rs1329747211 1658 dbSNP
rs946570358 1659 dbSNP
rs747066175 1661 dbSNP
rs867841946 1668 dbSNP
rs1247610744 1669 dbSNP
rs1264063969 1673 dbSNP
rs28770495 1677 dbSNP
rs935083539 1698 dbSNP
rs922240212 1700 dbSNP
rs1276269375 1703 dbSNP
rs1445107516 1705 dbSNP
rs1027634546 1707 dbSNP
rs1180872957 1709 dbSNP
rs545813060 1710 dbSNP
rs1185247685 1711 dbSNP
rs1367714584 1718 dbSNP
rs897144511 1721 dbSNP
rs115137793 1724 dbSNP
rs911471571 1729 dbSNP
rs1458944195 1730 dbSNP
rs1428060927 1741 dbSNP
rs1307562018 1745 dbSNP
rs1356104795 1746 dbSNP
rs772294167 1748 dbSNP
rs952891225 1749 dbSNP
rs918783881 1750 dbSNP
rs6544935 1752 dbSNP
rs1228671056 1759 dbSNP
rs1277170061 1761 dbSNP
rs936496265 1766 dbSNP
rs778711051 1769 dbSNP
rs1203979245 1770 dbSNP
rs1355993185 1776 dbSNP
rs978414329 1776 dbSNP
rs1483926407 1785 dbSNP
rs115043642 1788 dbSNP
rs917583744 1794 dbSNP
rs1001550493 1801 dbSNP
rs1190351528 1821 dbSNP
rs1360707863 1822 dbSNP
rs991786415 1826 dbSNP
rs1204317279 1831 dbSNP
rs1487305247 1832 dbSNP
rs1168123619 1838 dbSNP
rs959127319 1846 dbSNP
rs1467603837 1850 dbSNP
rs1301139858 1852 dbSNP
rs1402166750 1853 dbSNP
rs1383260786 1859 dbSNP
rs970496028 1859 dbSNP
rs1023535417 1868 dbSNP
rs189739846 1871 dbSNP
rs552695942 1875 dbSNP
rs1227259134 1896 dbSNP
rs1303628238 1899 dbSNP
rs6743994 1908 dbSNP
rs570386928 1911 dbSNP
rs1330057517 1919 dbSNP
rs552125435 1922 dbSNP
rs6715391 1924 dbSNP
rs1486187340 1925 dbSNP
rs999236641 1926 dbSNP
rs569497332 1931 dbSNP
rs1040851791 1937 dbSNP
rs942379009 1939 dbSNP
rs910902178 1942 dbSNP
rs1188188263 1944 dbSNP
rs1294709257 1953 dbSNP
rs994819182 1955 dbSNP
rs148827063 1958 dbSNP
rs897370488 1973 dbSNP
rs529463565 1984 dbSNP
rs1377121838 1986 dbSNP
rs1454772606 1992 dbSNP
rs1048626972 1993 dbSNP
rs1020034661 1994 dbSNP
rs183896754 1995 dbSNP
rs918729779 1998 dbSNP
rs201733303 2000 dbSNP
rs1326963104 2003 dbSNP
rs1369368323 2008 dbSNP
rs972875904 2013 dbSNP
rs886056111 2017 dbSNP
rs191820414 2019 dbSNP
rs1156745185 2026 dbSNP
rs1441511036 2031 dbSNP
rs1266113870 2034 dbSNP
rs928713769 2040 dbSNP
rs1328362252 2041 dbSNP
rs1364154086 2047 dbSNP
rs145495352 2056 dbSNP
rs1489619806 2061 dbSNP
rs970071736 2071 dbSNP
rs6743966 2075 dbSNP
rs1472933147 2079 dbSNP
rs1161437066 2090 dbSNP
rs1457173010 2101 dbSNP
rs1042191098 2102 dbSNP
rs1351923922 2103 dbSNP
rs1433858644 2110 dbSNP
rs945290437 2111 dbSNP
rs540335710 2115 dbSNP
rs1373455758 2116 dbSNP
rs1010802569 2119 dbSNP
rs1411176397 2120 dbSNP
rs187335799 2121 dbSNP
rs1030805726 2128 dbSNP
rs751162062 2129 dbSNP
rs917820069 2130 dbSNP
rs546151221 2141 dbSNP
rs1219678260 2148 dbSNP
rs149699330 2149 dbSNP
rs557180805 2159 dbSNP
rs1249697014 2162 dbSNP
rs140937815 2163 dbSNP
rs79487300 2169 dbSNP
rs984534468 2170 dbSNP
rs1403903784 2171 dbSNP
rs1353546906 2183 dbSNP
rs1326598177 2184 dbSNP
rs1164487901 2185 dbSNP
rs1370829184 2194 dbSNP
rs1280447739 2196 dbSNP
rs1232991876 2198 dbSNP
rs1349270996 2202 dbSNP
rs1328959301 2212 dbSNP
rs750355748 2218 dbSNP
rs1304606178 2219 dbSNP
rs1448673599 2220 dbSNP
rs952944137 2233 dbSNP
rs920095471 2234 dbSNP
rs889430513 2236 dbSNP
rs1048553118 2237 dbSNP
rs931524090 2238 dbSNP
rs972885250 2247 dbSNP
rs961944683 2249 dbSNP
rs1272581360 2250 dbSNP
rs1482747733 2255 dbSNP
rs1019852595 2256 dbSNP
rs1008206811 2257 dbSNP
rs539615165 2262 dbSNP
rs954044321 2267 dbSNP
rs897417353 2270 dbSNP
rs1472077963 2272 dbSNP
rs1181710344 2275 dbSNP
rs1028400393 2277 dbSNP
rs1037278084 2279 dbSNP
rs759866591 2296 dbSNP
rs1166253179 2298 dbSNP
rs1369431987 2311 dbSNP
rs903898835 2313 dbSNP
rs938847879 2321 dbSNP
rs928838584 2323 dbSNP
rs1357429071 2328 dbSNP
rs569085213 2329 dbSNP
rs183048719 2330 dbSNP
rs144118640 2336 dbSNP
rs914542104 2337 dbSNP
rs558281588 2340 dbSNP
rs990564429 2341 dbSNP
rs1280822140 2357 dbSNP
rs956059646 2358 dbSNP
rs1201825977 2365 dbSNP
rs537008004 2366 dbSNP
rs764089749 2368 dbSNP
rs1466496097 2374 dbSNP
rs1187045254 2378 dbSNP
rs1480927161 2388 dbSNP
rs937697163 2389 dbSNP
rs557205133 2390 dbSNP
rs1478151622 2391 dbSNP
rs926269133 2396 dbSNP
rs1030921276 2397 dbSNP
rs978027201 2401 dbSNP
rs1449175046 2409 dbSNP
rs1285615297 2414 dbSNP
rs1321097050 2415 dbSNP
rs1390593209 2416 dbSNP
rs139408737 2423 dbSNP
rs930391460 2424 dbSNP
rs918988461 2425 dbSNP
rs1343286879 2431 dbSNP
rs535350829 2436 dbSNP
rs761197408 2440 dbSNP
rs961549776 2442 dbSNP
rs1051317 2454 dbSNP
rs772056842 2455 dbSNP
rs987005825 2459 dbSNP
rs954264033 2461 dbSNP
rs1339503605 2462 dbSNP
rs1275692541 2471 dbSNP
rs1451839308 2475 dbSNP
rs1200468749 2488 dbSNP
rs1244508301 2489 dbSNP
rs1477381665 2494 dbSNP
rs1028285754 2499 dbSNP
rs1000852001 2510 dbSNP
rs1455572026 2514 dbSNP
rs1432290431 2518 dbSNP
rs1391108693 2524 dbSNP
rs968552813 2526 dbSNP
rs1325726451 2528 dbSNP
rs1329438306 2532 dbSNP
rs1021023903 2541 dbSNP
rs1289065326 2548 dbSNP
rs1352931104 2553 dbSNP
rs1009835953 2556 dbSNP
rs886056110 2565 dbSNP
rs1211289575 2569 dbSNP
rs1357447741 2569 dbSNP
rs1287361592 2599 dbSNP
rs1450651902 2600 dbSNP
rs896315688 2606 dbSNP
rs568707634 2613 dbSNP
rs1182353888 2615 dbSNP
rs1253326172 2618 dbSNP
rs547193800 2628 dbSNP
rs1412733120 2636 dbSNP
rs1002129385 2637 dbSNP
rs905072261 2638 dbSNP
rs374313566 2647 dbSNP
rs1161216221 2649 dbSNP
rs564570742 2651 dbSNP
rs1424251848 2656 dbSNP
rs930313677 2657 dbSNP
rs17035887 2658 dbSNP
rs1408570760 2660 dbSNP
rs1306854026 2665 dbSNP
rs1476445224 2667 dbSNP
rs17035884 2675 dbSNP
rs1282782246 2676 dbSNP
rs888654276 2682 dbSNP
rs1276161209 2691 dbSNP
rs563332032 2701 dbSNP
rs759800242 2709 dbSNP
rs1481760918 2712 dbSNP
rs1195176497 2719 dbSNP
rs150799189 2720 dbSNP
rs1265368865 2730 dbSNP
rs912741050 2731 dbSNP
rs1204724867 2732 dbSNP
rs1373744003 2733 dbSNP
rs986892633 2734 dbSNP
rs1316842799 2744 dbSNP
rs1169423657 2746 dbSNP
rs1392127407 2749 dbSNP
rs1255790114 2751 dbSNP
rs1427963162 2756 dbSNP
rs768961580 2758 dbSNP
rs1403622431 2760 dbSNP
rs193204253 2761 dbSNP
rs921489609 2764 dbSNP
rs1362009606 2765 dbSNP
rs1299292184 2766 dbSNP
rs1283130755 2771 dbSNP
rs1445718398 2778 dbSNP
rs1256063119 2781 dbSNP
rs886056109 2782 dbSNP
rs979868510 2785 dbSNP
rs886056108 2789 dbSNP
rs780029043 2795 dbSNP
rs1242337829 2798 dbSNP
rs1465141967 2808 dbSNP
rs1190247594 2813 dbSNP
rs755625135 2813 dbSNP
rs11675741 2814 dbSNP
rs1169898984 2817 dbSNP
rs1337077069 2820 dbSNP
rs1021494343 2827 dbSNP
rs559142075 2843 dbSNP
rs142254354 2848 dbSNP
rs1436337659 2849 dbSNP
rs1034853745 2850 dbSNP
rs1322928465 2853 dbSNP
rs1362666443 2856 dbSNP
rs1411907877 2860 dbSNP
rs1002013374 2861 dbSNP
rs188802724 2863 dbSNP
rs1162799167 2867 dbSNP
rs1262485984 2875 dbSNP
rs1329742993 2876 dbSNP
rs1210433360 2885 dbSNP
rs1027555738 2886 dbSNP
rs1443260507 2894 dbSNP
rs748164901 2896 dbSNP
rs1186080134 2900 dbSNP
rs897483287 2914 dbSNP
rs1036404659 2917 dbSNP
rs1429247579 2918 dbSNP
rs1245515285 2922 dbSNP
rs560200432 2925 dbSNP
rs944476865 2928 dbSNP
rs1386826571 2931 dbSNP
rs1192252734 2944 dbSNP
rs777008314 2948 dbSNP
rs890182689 2951 dbSNP
rs1457613605 2954 dbSNP
rs1369258322 2964 dbSNP
rs1051219907 2965 dbSNP
rs932810776 2966 dbSNP
rs1236782050 2970 dbSNP
rs921540879 2976 dbSNP
rs1230089936 2981 dbSNP
rs368187483 2982 dbSNP
rs1316076292 2983 dbSNP
rs1215359264 2988 dbSNP
rs182661866 3013 dbSNP
rs886056107 3014 dbSNP
rs988507304 3035 dbSNP
rs960799532 3037 dbSNP
rs576031270 3040 dbSNP
rs554591887 3043 dbSNP
rs1406274705 3048 dbSNP
rs1315673068 3050 dbSNP
rs980625623 3056 dbSNP
rs536185717 3062 dbSNP
rs1351327820 3066 dbSNP
rs559484016 3073 dbSNP
rs568742005 3077 dbSNP
rs781251820 3097 dbSNP
rs886056106 3099 dbSNP
rs13424086 3100 dbSNP
rs1411617679 3110 dbSNP
rs994773508 3112 dbSNP
rs1372494025 3133 dbSNP
rs1228710100 3136 dbSNP
rs897699464 3138 dbSNP
rs1355350063 3139 dbSNP
rs1322895264 3140 dbSNP
rs1323790574 3141 dbSNP
rs1220453415 3146 dbSNP
rs1422855648 3148 dbSNP
rs1483395432 3149 dbSNP
rs1014613198 3152 dbSNP
rs190858774 3156 dbSNP
rs1480591883 3158 dbSNP
rs1182868645 3164 dbSNP
rs1416339481 3164 dbSNP
rs1008490886 3168 dbSNP
rs890233722 3174 dbSNP
rs1390272809 3175 dbSNP
rs1431151595 3179 dbSNP
rs1326243039 3184 dbSNP
rs1353930271 3198 dbSNP
rs1485264201 3210 dbSNP
rs1051328 3211 dbSNP
rs1380256765 3214 dbSNP
rs1244086989 3223 dbSNP
rs1050114183 3224 dbSNP
rs932858469 3231 dbSNP
rs1164745812 3237 dbSNP
rs1230795819 3242 dbSNP
rs1270959872 3245 dbSNP
rs1307442711 3250 dbSNP
rs1211355546 3259 dbSNP
rs900000203 3260 dbSNP
rs1439662068 3271 dbSNP
rs148722702 3272 dbSNP
rs1179336985 3276 dbSNP
rs763634945 3293 dbSNP
rs914116335 3303 dbSNP
rs1165708345 3304 dbSNP
rs8861 3318 dbSNP
rs939319998 3320 dbSNP
rs1291921502 3322 dbSNP
rs377030436 3323 dbSNP
rs1215806282 3325 dbSNP
rs928074163 3328 dbSNP
rs980845521 3330 dbSNP
rs552679014 3332 dbSNP
rs1366274311 3333 dbSNP
rs530892671 3347 dbSNP
rs886056105 3354 dbSNP
rs1308802732 3356 dbSNP
rs1224132012 3357 dbSNP
rs1374278226 3362 dbSNP
rs1321990912 3363 dbSNP
rs1203505204 3380 dbSNP
rs1274504390 3381 dbSNP
rs969427644 3383 dbSNP
rs1465985470 3385 dbSNP
rs754159439 3393 dbSNP
rs561678711 3394 dbSNP
rs563368982 3398 dbSNP
rs1419572904 3399 dbSNP
rs1192398542 3400 dbSNP
rs973623568 3404 dbSNP
rs1469220344 3406 dbSNP
rs1161688299 3420 dbSNP
rs962003454 3426 dbSNP
rs1015244014 3433 dbSNP
rs1316427350 3439 dbSNP
rs1326049392 3443 dbSNP
rs1424968545 3447 dbSNP
rs1196798194 3448 dbSNP
rs1437327152 3449 dbSNP
rs1481253232 3453 dbSNP
rs1344233238 3460 dbSNP
rs1223368545 3462 dbSNP
rs1289377027 3466 dbSNP
rs1008543293 3469 dbSNP
rs1203733603 3471 dbSNP
rs1283169718 3481 dbSNP
rs954373474 3496 dbSNP
rs1223210414 3498 dbSNP
rs766732010 3512 dbSNP
rs1266084200 3543 dbSNP
rs760699052 3547 dbSNP
rs867177659 3548 dbSNP
rs1182766683 3555 dbSNP
rs1468450955 3558 dbSNP
rs1157745554 3562 dbSNP
rs548150630 3564 dbSNP
rs771695943 3565 dbSNP
rs1384603530 3580 dbSNP
rs1406157844 3585 dbSNP
rs78040887 3591 dbSNP
rs11899789 3594 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauACACGACGAu 5'
                      | ||||||| 
Target 5' --------acacUUUGCUGCUu 3'
1 - 14
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000444761.2 | 3UTR | ACACUUUGCUGCUUAGAAAUUUCUUCCGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.57 3.3e-4 0.036 4.2e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.642 1.1e-3 0.767 4.0e-5 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.535 7.5e-3 -0.519 9.5e-3 20 Click to see details
GSE17498 Multiple myeloma 0.374 8.7e-3 0.296 3.2e-2 40 Click to see details
GSE19536 Breast cancer -0.159 5.7e-2 -0.194 2.7e-2 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.335 5.9e-2 0.320 6.8e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.285 8.9e-2 -0.272 9.9e-2 24 Click to see details
GSE21687 Ependynoma primary tumors -0.152 1.2e-1 -0.088 2.4e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.327 1.4e-1 -0.423 7.5e-2 13 Click to see details
GSE38226 Liver fibrosis 0.224 1.6e-1 0.266 1.2e-1 21 Click to see details
GSE21032 Prostate cancer 0.103 1.8e-1 0.023 4.2e-1 83 Click to see details
GSE19783 ER- ER- breast cancer -0.097 2.0e-1 -0.144 1.0e-1 79 Click to see details
GSE14794 Lymphoblastoid cells 0.051 3.2e-1 0.135 1.0e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.084 3.8e-1 -0.041 4.4e-1 16 Click to see details
GSE17306 Multiple myeloma 0.034 4.1e-1 0.033 4.1e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.044 4.2e-1 0.060 3.9e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.039 4.5e-1 0.147 3.2e-1 12 Click to see details
GSE28544 Breast cancer -0.012 4.8e-1 -0.294 8.2e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.008 4.8e-1 0.025 4.5e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.008 4.8e-1 0.025 4.5e-1 25 Click to see details
GSE21849 B cell lymphoma 0 5.0e-1 0.450 7.2e-3 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.918 0 -0.867 0 9 Click to see details
STAD -0.555 0 -0.575 0 32 Click to see details
KIRP -0.478 0 -0.495 0 32 Click to see details
HNSC -0.369 0.01 -0.387 0.01 42 Click to see details
THCA -0.297 0.01 -0.302 0.01 59 Click to see details
BLCA -0.53 0.01 -0.340 0.08 18 Click to see details
KICH -0.351 0.04 -0.242 0.12 25 Click to see details
LUAD 0.495 0.05 0.406 0.1 12 Click to see details
UCEC 0.368 0.06 0.261 0.14 19 Click to see details
PRAD 0.154 0.14 0.107 0.23 50 Click to see details
COAD -0.422 0.15 -0.571 0.07 8 Click to see details
LUSC -0.142 0.2 -0.171 0.15 38 Click to see details
LIHC -0.124 0.2 -0.038 0.4 49 Click to see details
BRCA -0.04 0.36 -0.032 0.39 84 Click to see details
PCPG -0.416 0.36 -0.500 0.33 3 Click to see details
PAAD 0.179 0.41 -0.400 0.3 4 Click to see details
KIRC 0.027 0.41 0.055 0.33 68 Click to see details
ESCA 0.015 0.48 -0.255 0.22 11 Click to see details
CESC 0.036 0.49 -0.500 0.33 3 Click to see details
CESC 0.036 0.49 -0.500 0.33 3 Click to see details
CESC 0.036 0.49 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 3 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448440 TLL1 tolloid like 1 2 2
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453754 CSNK1E casein kinase 1 epsilon 2 2
MIRT454970 TPM2 tropomyosin 2 2 2
MIRT456867 ZNF460 zinc finger protein 460 2 10
MIRT460224 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460438 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463167 ZNF367 zinc finger protein 367 2 10
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465165 TSC22D2 TSC22 domain family member 2 2 2
MIRT465570 TOB2 transducer of ERBB2, 2 2 2
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466008 TMEM189 transmembrane protein 189 2 8
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466436 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466917 STK38 serine/threonine kinase 38 2 10
MIRT467002 SSRP1 structure specific recognition protein 1 2 5
MIRT468052 SIK1 salt inducible kinase 1 2 3
MIRT468151 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469090 RNF168 ring finger protein 168 2 2
MIRT469415 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471038 PISD phosphatidylserine decarboxylase 2 10
MIRT471495 PDE4D phosphodiesterase 4D 2 4
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472263 NFIC nuclear factor I C 2 2
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474318 LAMC1 laminin subunit gamma 1 2 2
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475539 HOXA3 homeobox A3 2 8
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475843 HDGF heparin binding growth factor 2 4
MIRT476259 GNB1 G protein subunit beta 1 2 7
MIRT476276 GNAL G protein subunit alpha L 2 6
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479457 CDK6 cyclin dependent kinase 6 2 2
MIRT479988 CARD10 caspase recruitment domain family member 10 2 2
MIRT481181 AVL9 AVL9 cell migration associated 2 6
MIRT482370 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482581 ABHD2 abhydrolase domain containing 2 2 2
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487394 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494354 CASKIN1 CASK interacting protein 1 2 2
MIRT495146 ZNRF1 zinc and ring finger 1 2 2
MIRT496019 CD180 CD180 molecule 2 2
MIRT497776 KIAA0895 KIAA0895 2 2
MIRT498984 ORC4 origin recognition complex subunit 4 2 8
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500321 ZNF622 zinc finger protein 622 2 9
MIRT500425 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500580 USP53 ubiquitin specific peptidase 53 2 2
MIRT500860 SYPL1 synaptophysin like 1 2 8
MIRT500936 SRPR SRP receptor alpha subunit 2 7
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501089 SMAD7 SMAD family member 7 2 8
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502151 KIF5B kinesin family member 5B 2 9
MIRT502496 FAM122B family with sequence similarity 122B 2 8
MIRT502570 E2F7 E2F transcription factor 7 2 11
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502922 CDCA4 cell division cycle associated 4 4 9
MIRT502950 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503140 ATG9A autophagy related 9A 2 7
MIRT504338 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504540 ZNF620 zinc finger protein 620 2 6
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505116 YTHDC1 YTH domain containing 1 2 6
MIRT505349 TMEM245 transmembrane protein 245 2 6
MIRT505398 TMEM100 transmembrane protein 100 2 2
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505549 SNX16 sorting nexin 16 2 6
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505930 RCAN3 RCAN family member 3 2 4
MIRT506112 PPIG peptidylprolyl isomerase G 2 6
MIRT506138 PLRG1 pleiotropic regulator 1 2 4
MIRT506166 PLAG1 PLAG1 zinc finger 2 9
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506487 MYO5A myosin VA 2 7
MIRT506854 KIF23 kinesin family member 23 2 7
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507820 CDK1 cyclin dependent kinase 1 2 6
MIRT507853 CCNE2 cyclin E2 2 6
MIRT507877 CBX6 chromobox 6 2 2
MIRT508041 AXIN2 axin 2 2 6
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509368 DMPK DM1 protein kinase 2 11
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511847 GPATCH8 G-patch domain containing 8 2 5
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT514042 ATG14 autophagy related 14 2 2
MIRT518095 TRIM35 tripartite motif containing 35 2 2
MIRT518533 FLCN folliculin 2 6
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521055 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521207 SBNO1 strawberry notch homolog 1 2 6
MIRT521818 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522778 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537815 EFNB2 ephrin B2 2 4
MIRT539902 RPL14 ribosomal protein L14 2 4
MIRT540847 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541217 HOXA10 homeobox A10 2 2
MIRT541432 CBX4 chromobox 4 2 3
MIRT542810 PHC3 polyhomeotic homolog 3 2 3
MIRT542837 PDCD1 programmed cell death 1 2 7
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543310 ZNF585B zinc finger protein 585B 2 2
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543529 PRSS21 protease, serine 21 2 2
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543839 GSG1 germ cell associated 1 2 2
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544916 CLSPN claspin 2 2
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545351 CCDC83 coiled-coil domain containing 83 2 2
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546118 USP48 ubiquitin specific peptidase 48 2 4
MIRT546611 SALL1 spalt like transcription factor 1 2 4
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546640 RTN4 reticulon 4 2 2
MIRT547069 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547406 MKX mohawk homeobox 2 2
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547661 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547702 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT548001 HCFC2 host cell factor C2 2 4
MIRT548018 GRB2 growth factor receptor bound protein 2 2 4
MIRT548219 FKBP1A FK506 binding protein 1A 2 2
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548727 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548946 CDK17 cyclin dependent kinase 17 2 3
MIRT549076 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549123 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549389 AMOT angiomotin 2 2
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550619 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550827 FAM229B family with sequence similarity 229 member B 2 2
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551621 ZNF267 zinc finger protein 267 2 2
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552348 ZNF704 zinc finger protein 704 2 2
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553442 TPM3 tropomyosin 3 2 2
MIRT553565 TMEM161B transmembrane protein 161B 2 2
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553777 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554702 RNF149 ring finger protein 149 2 2
MIRT554965 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555035 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555278 PRDM4 PR/SET domain 4 2 2
MIRT555431 PPAP2B phospholipid phosphatase 3 2 2
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557484 GPR27 G protein-coupled receptor 27 2 4
MIRT558041 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558664 CNKSR3 CNKSR family member 3 2 2
MIRT559006 CA8 carbonic anhydrase 8 2 2
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560855 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561153 KRT33B keratin 33B 2 2
MIRT561404 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562031 LANCL1 LanC like 1 2 2
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562881 KIAA1456 KIAA1456 2 2
MIRT563090 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563507 DLGAP3 DLG associated protein 3 2 2
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564336 CCNT1 cyclin T1 2 2
MIRT564482 ZNF391 zinc finger protein 391 2 2
MIRT564556 CCDC80 coiled-coil domain containing 80 2 2
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564954 XKR7 XK related 7 2 2
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566122 RASEF RAS and EF-hand domain containing 2 2
MIRT566654 NCKAP1 NCK associated protein 1 2 2
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567017 KLHL15 kelch like family member 15 2 2
MIRT567450 GNG12 G protein subunit gamma 12 2 2
MIRT567482 FZD9 frizzled class receptor 9 2 2
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568143 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568477 ARMC12 armadillo repeat containing 12 2 2
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568621 ACVR2A activin A receptor type 2A 2 2
MIRT570464 TLK1 tousled like kinase 1 2 3
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571431 RIF1 replication timing regulatory factor 1 2 2
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571824 PHF19 PHD finger protein 19 5 2
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 2 3
MIRT574062 PROSC pyridoxal phosphate binding protein 2 2
MIRT574207 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574595 N4BP1 NEDD4 binding protein 1 2 3
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575928 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576100 Pdcd1 programmed cell death 1 2 5
MIRT576593 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614697 TRAK1 trafficking kinesin protein 1 2 2
MIRT616471 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640542 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645514 BSPRY B-box and SPRY domain containing 2 2
MIRT646599 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648788 KLHL40 kelch like family member 40 2 2
MIRT655815 NOTCH2 notch 2 2 3
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659260 CUL3 cullin 3 5 2
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682280 RS1 retinoschisin 1 2 2
MIRT682518 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691713 FLOT2 flotillin 2 2 3
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701510 NEGR1 neuronal growth regulator 1 2 2
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713423 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716436 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717465 ADORA3 adenosine A3 receptor 2 2
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725130 SYNRG synergin gamma 2 2
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14