miRTarBase - #MIRT701510 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NEGR1   
Synonyms DMML2433, IGLON4, KILON, Ntra
Description neuronal growth regulator 1
Transcript NM_173808   
Expression
Putative miRNA Targets on NEGR1
3'UTR of NEGR1
(miRNA target sites are highlighted)
>NEGR1|NM_173808|3'UTR
   1 ATTCAAAGACCCATAAAAGGCTTTTAAGGATTCTCTGAAAGTGCTGATGGCTGGATCCAATCTGGTACAGTTTGTTAAAA
  81 GCAGCGTGGGATATAATCAGCAGTGCTTACATGGGGATGATCGCCTTCTGTAGAATTGCTCATTATGTAAATACTTTAAT
 161 TCTACTCTTTTTTGATTAGCTACATTACCTTGTGAAGCAGTACACATTGTCCTTTTTTTAAGACGTGAAAGCTCTGAAAT
 241 TACTTTTAGAGGATATTAATTGTGATTTCATGTTTGTAATCTACAACTTTTCAAAAGCATTCAGTCATGGTCTGCTAGGT
 321 TGCAGGCTGTAGTTTACAAAAACGAATATTGCAGTGAATATGTGATTCTTTAAGGCTGCAATACAAGCATTCAGTTCCCT
 401 GTTTCAATAAGAGTCAATCCACATTTACAAAGATGCATTTTTTTCTTTTTTGATAAAAAAGCAAATAATATTGCCTTCAG
 481 ATTATTTCTTCAAAATATAACACATATCTAGATTTTTCTGCTCGCATGATATTCAGGTTTCAGGAATGAGCCTTGTAATA
 561 TAACTGGCTGTGCAGCTCTGCTTCTCTTTCCTGTAAGTTCAGCATGGGTGTGCCTTCATACAATAATATTTTTCTCTTTG
 641 TCTCCAACTAATATAAAATGTTTTGCTAAATCTTACAATTTGAAAGTAAAAATAAACCAGAGTGATCAAGTTAAACCATA
 721 CACTATCTCTAAGTAACGAAGGAGCTATTGGACTGTAAAAATCTCTTCCTGCACTGACAATGGGGTTTGAGAATTTTGCC
 801 CCACACTAACTCAGTTCTTGTGATGAGAGACAATTTAATAACAGTATAGTAAATATACCATATGATTTCTTTAGTTGTAG
 881 CTAAATGTTAGATCCACCGTGGGAAATCATTCCCTTTAAAATGACAGCACAGTCCACTCAAAGGATTGCCTAGCAATACA
 961 GCATCTTTTCCTTTCACTAGTCCAAGCCAAAAATTTTAAGATGATTTGTCAGAAAGGGCACAAAGTCCTATCACCTAATA
1041 TTACAAGAGTTGGTAAGCGCTCATCATTAATTTTATTTTGTGGCAGCTAAGTTAGTATGACAGAGGCAGTGCTCCTGTGG
1121 ACAGGAGCATTTTGCATATTTTCCATCTGAAAGTATCACTCAGTTGATAGTCTGGAATGCATGTTATATATTTTAAAACT
1201 TCCAAAATATATTATAACAAACATTCTATATCGGTATGTAGCAGACCAATCTCTAAAATAGCTAATTCTTCAATAAAATC
1281 TTTCTATATAGCCATTTCAGTGCAAACAAGTAAAATCAAAAAAGACCATCCTTTATTTTTCCTTACATGATATATGTAAG
1361 ATGCGATCAAATAAAGACAAAACACCAGTGATGAGAATATCTTAAGATAAGTAATTATCAAATTATTGTGAATGTTAAAT
1441 TATTTCTACTATAAAGAAGCAAAACTACATTTTTGAAGGAAAATGCTGTTACTCTAACATTAATTTACAGGAATAGTTTG
1521 ATGGTTTCACTCTTTACTAAAGAAAGGCCATCACCTTGAAAGCCATTTTACAGGTTTGATGAAGTTACCAATTTCAGTAC
1601 ACCTAAATTTCTACAAATAGTCCCCTTTTACAAGTTGTAACAACAAAGACCCTATAATAAAATTAGATACAAGAAATTTT
1681 GCAGTGGTTATACATATTTGAGATATCTAGTATGTTGCCCTAGCAGGGATGGCTTAAAAACTGTGATTTTTTTTCTTCAA
1761 GTAAAACTTAGTCCCAAAGTACATCATAAATCAATTTTAATTAGAAAAATGAATCTTAAATGAGGGGACATAAGTATACT
1841 CTTTCCACAAAATGGCAATAATAAGGCATAAAGCTAGTAAATCTACTAACTGTAATAAATGTATGACATTATTTTGATTG
1921 ATACATTAAAAAAGAGTTTTTAGAACAAATATGGCATTTAACTTTATTATTTATTTGCTTTTAAGAAATATTCTTTGTGG
2001 AATTGTTGAATAAACTATAAAATATTATTTTGTATTGCAGCTTTAAAGTGGCACACTCCATAATAATCTACTTACTAGAA
2081 ATAGTGGTGCTACCACAAAAAATGTTAACCATCAGTACCATTGTTTGGGAGAAAGAAACAGATCAAGAATGCATATTATT
2161 CAGTGACCGCTTTCCTAGAGTTAAAATACCTCCTCTTTGTAAGGTTTGTAGGTAAATTGAGGTATAAACTATGGATGAAC
2241 CAAATAATTAGTTCAAAGTGTTGTCATGATTCCAAATTTGTGGAGTCTGGTGTTTTTACCATAGAATGTGACAGAAGTAC
2321 AGTCATAGCTCAGTAGCTATATGTATTTGCCTTTATGTTAGAAGAGACTTTCTTGAGTGACATTTTTAAATAGAGGAGGT
2401 ATTCACTATGTTTTTCTGTATCACAGCAGCATTCCTAGTCCTTAGGCCCTCGGACAGAGTGAAATCATGAGTATTTATGA
2481 GTTCAATATTGTCAAATAAGGCTACAGTATTTGCTTTTTTGTGTGAATGTATTGCATATAATGTTCAAGTAGATGATTTT
2561 ACATTTATGGACATATAAAATGTCTGATTACCCCATTTTATCAGTCCTGACTGTACAAGATTGTTGCAATTTCAGAATAG
2641 CAGTTTTATAAATTGATTTATCTTTTAATCTATAACAATTTGTGTTAGCTGTTCATTTCAGGATTATATTTTCTACAAGT
2721 TCCACTTGTGGGACTCCTTTTGTTGCCCCTATTTTTTTTTAAAGAAGGAAGAAAGAAAAATAAGTAGCAGTTTAAAAATG
2801 AGAATGGAGAGAAAAGAAAAAGAATGAAAAGGAAAGGCAGTAAAGAGGGAAAAAAAGGAAGGATGGAAGGAATGAAGGAA
2881 GGAAGGGAGGAAGGGGAGAAGGTAGGAAGAAAGAAAGGATGAGAGGGAAGGAAGAATCAGAGTATTAGGGTAGTTAACTT
2961 ACACATTTGCATTCTTAGTTTAACTGCAAGTGGTGTAACTACGTTTTTCAATGATCGCATTTGAAACATAAGTCCTATTA
3041 TACCATTAAGTTCCTATTATGCAGCAATTATATAATAAAAAGTACTGCCCAAGTTATAGTAATGTGGGTGTTTTTGAGAC
3121 ACTAAAAGATTTGAGAGGGAGAATTTCAAACTTAAAGCCACTTTTGGGGGGTTTATAACTTAACTGAAAAATTAATGCTT
3201 CATCATAACATTTAAGCTATATCTAGAAAGTAGACTGGAGAACTGAGAAAATTACCCAGGTAATTCAGGGAAAAAAAAAA
3281 ATATATATATATATAAATACCCCTACATTTGAAGTCAGAAAACTCTGAAAAACTGAATTATCAAAGTCAATCATCTATAA
3361 TGATCAAATTTACTGAACAATTGTTAATTTATCCATTGTGCTTAGCTTTGTGACACAGCCAAAAGTTACCTATTTAATCT
3441 TTTCAATAAAAATTGTTTTTTGAAATCCAGAAATGATTTAAAAAGAGGTCAGGTTTTTAACTATTTATTGAAGTATGTGG
3521 ATGTACAGTATTTCAATAGATATGAATATGAATAAATGGTATGCCTTAAGATTCTTTGAATATGTATTTACTTTAAAGAC
3601 TGGAAAAAGCTCTTCCTGTCTTTTAGTAAAACATCCATATTTCATAACCTGATGTAAAATATGTTGTACTGTTTCCAATA
3681 GGTGAATATAAACTCAGTTTATCAATTAAAATATGTATTTGACTCATTTTAAAACTCTATTAGCTTAAGAGAAAGAAGGA
3761 AGAAATAATAATTTGAAGATATTTCTGCTATTCTCTTTATTTCCTGTATTACACTCATCTTTCTGCTTACTCTAAAGCAG
3841 TACAGGGTAAAAATTCTAGATGCTACAGTTTCAAATGACTCCACACTATATTCTTTCTTGCTGTTGCTGATTCCTAAAAG
3921 GTTTGATGAGCTGAACTACATCTAAACTAAAAATAAATTTTCTGGAAACATTTTATTATTAATTATTTAGAACCTTTACC
4001 TGGTAAAATACAGCAGAGTTAGCAACAGAGACTAAATATCCTGTTGATAAAATCCTGATGATCTTACAGGCTAAACAACT
4081 GAAAACTCAAACGCTTGTAAGAGCCAGGCAGAGTGTAATTTCTTAACAGCTGGGTATAAAACAACGGGCACCTGAAGGTA
4161 TTCAGATACAATTTCCTTAAAAATACCTTGGTTTCCAAGCAAAACACGTTATTTGGCTGAGAACCTTTAGTTTGTAAATA
4241 CCAAACCATAATATACAAATGAGATCTCAAGCCAAATGAATTTTTTAAGCCCTCTTTCCCATATCTGTTCATCTATGATA
4321 GTCAACTGAATAAATGAGAACAATGTGATAGATAAAACAACAAAGCATAAAAAAGATTCATGCTTGGTTTTATAAGCTAT
4401 TTTGAAATATAAGTATCATTGCTATTCTGAGAAATCTATATACACCAAAGCCCTCCCTCCACAAAAAAACTGGAAATGTT
4481 CTAATAAATGTCTGATTTCCCCCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA----AUA-CACGACGAu 5'
            || ||:||    | |  |||||:| 
Target 5' tcCACACTATATTCTTTCTTGCTGTTg 3'
3880 - 3906 134.00 -11.00
2
miRNA  3' gugUUUGGU---AAUAC--------ACGACGAu 5'
             ||||:|   || ||        |||||:| 
Target 5' gcaAAACTACATTTTTGAAGGAAAATGCTGTTa 3'
1459 - 1491 133.00 -10.40
3
miRNA  3' guGUUUGGUAAU---AC---ACGACGAu 5'
            :||| :||||   ||   ||| ||| 
Target 5' taTAAAATATTATTTTGTATTGCAGCTt 3'
2016 - 2043 128.00 -7.34
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30487303 8 COSMIC
COSN30184518 18 COSMIC
COSN30700173 19 COSMIC
COSN30492319 22 COSMIC
COSN30148398 24 COSMIC
COSN31583518 33 COSMIC
COSN30156752 43 COSMIC
COSN18726000 46 COSMIC
COSN30457049 50 COSMIC
COSN26986285 86 COSMIC
COSN30447995 88 COSMIC
COSN30452462 90 COSMIC
COSN31506176 92 COSMIC
COSN31607752 112 COSMIC
COSN30487568 115 COSMIC
COSN30150915 135 COSMIC
COSN30109966 141 COSMIC
COSN32063456 184 COSMIC
COSN8638660 204 COSMIC
COSN31575159 210 COSMIC
COSN31596743 330 COSMIC
COSN8638659 374 COSMIC
COSN29475991 437 COSMIC
COSN31484176 488 COSMIC
COSN31528052 488 COSMIC
COSN28062335 503 COSMIC
COSN8638658 503 COSMIC
COSN31583036 511 COSMIC
COSN31577750 528 COSMIC
COSN24297986 547 COSMIC
COSN31554910 609 COSMIC
COSN31546375 634 COSMIC
COSN7052375 641 COSMIC
COSN31516022 650 COSMIC
COSN31530970 666 COSMIC
COSN31484865 736 COSMIC
COSN31608992 748 COSMIC
COSN30538710 765 COSMIC
COSN31515681 817 COSMIC
COSN31571327 817 COSMIC
COSN29267321 897 COSMIC
COSN5743439 1005 COSMIC
COSN20090263 1010 COSMIC
COSN7279302 1013 COSMIC
COSN6043432 1036 COSMIC
COSN30176560 1406 COSMIC
COSN31608728 1438 COSMIC
COSN18849084 1475 COSMIC
COSN4751799 1489 COSMIC
COSN30542806 1585 COSMIC
COSN24753801 1604 COSMIC
COSN4751798 1654 COSMIC
COSN31520797 1673 COSMIC
COSN31569240 1707 COSMIC
COSN31522726 1744 COSMIC
COSN29811938 1891 COSMIC
COSN31528798 1943 COSMIC
COSN31597044 2061 COSMIC
COSN30541242 2151 COSMIC
COSN23227631 2290 COSMIC
COSN20090262 2330 COSMIC
COSN24627455 2414 COSMIC
COSN31538834 2451 COSMIC
COSN21827399 2455 COSMIC
COSN31547983 2570 COSMIC
COSN5204894 2582 COSMIC
COSN5375726 2589 COSMIC
COSN32065419 2649 COSMIC
COSN4751797 2678 COSMIC
COSN8506566 2722 COSMIC
COSN25894570 2728 COSMIC
COSN30544450 2761 COSMIC
COSN1454501 2774 COSMIC
COSN31566337 2822 COSMIC
COSN20094940 2849 COSMIC
COSN21550338 2936 COSMIC
COSN31534995 3016 COSMIC
COSN28040119 3017 COSMIC
COSN28631618 3054 COSMIC
COSN31570878 3057 COSMIC
COSN19655274 3096 COSMIC
COSN31520804 3128 COSMIC
COSN8914513 3180 COSMIC
COSN31528161 3198 COSMIC
COSN32061369 3271 COSMIC
COSN17409516 3278 COSMIC
COSN27015083 3279 COSMIC
COSN7471343 3280 COSMIC
COSN32064105 3339 COSMIC
COSN27056345 3370 COSMIC
COSN31595835 3372 COSMIC
COSN25324106 3404 COSMIC
COSN15151886 3547 COSMIC
COSN31565118 3574 COSMIC
COSN31524101 3585 COSMIC
COSN27030536 3619 COSMIC
COSN15035563 3683 COSMIC
COSN31565116 3731 COSMIC
COSN5204892 3734 COSMIC
COSN31584487 3762 COSMIC
COSN8638657 3786 COSMIC
COSN29141121 3924 COSMIC
COSN24548732 3969 COSMIC
COSN25035301 3988 COSMIC
COSN32008269 4002 COSMIC
COSN23873225 4081 COSMIC
COSN16634116 4209 COSMIC
COSN30330198 4280 COSMIC
COSN22851043 4369 COSMIC
COSN21237362 4511 COSMIC
COSN23749417 4667 COSMIC
COSN21240232 4684 COSMIC
COSN1107883 4791 COSMIC
COSN15778485 4794 COSMIC
COSN7279301 4911 COSMIC
COSN15683239 5214 COSMIC
COSN23559676 5258 COSMIC
COSN5169506 5270 COSMIC
COSN25929874 5283 COSMIC
COSN19219446 5285 COSMIC
COSN25935463 5301 COSMIC
COSN8506565 5345 COSMIC
COSN25893784 5396 COSMIC
COSN7279300 5567 COSMIC
COSN32036583 5643 COSMIC
COSN17093082 5734 COSMIC
COSN6043431 5768 COSMIC
COSN26039242 5777 COSMIC
COSN26346926 5817 COSMIC
COSN7279299 5842 COSMIC
COSN10052667 5852 COSMIC
COSN19111052 6087 COSMIC
COSN26470379 6216 COSMIC
COSN30405700 6228 COSMIC
COSN7279298 6382 COSMIC
COSN6043430 6561 COSMIC
COSN21778993 6594 COSMIC
COSN27304163 6781 COSMIC
COSN21183664 6868 COSMIC
COSN25077585 6923 COSMIC
COSN23713302 6925 COSMIC
COSN20140070 6960 COSMIC
COSN25082877 6978 COSMIC
COSN28932830 6993 COSMIC
COSN27295709 6994 COSMIC
COSN7471342 7023 COSMIC
COSN29370901 7097 COSMIC
COSN17022112 7204 COSMIC
COSN6043429 7275 COSMIC
COSN22635432 7385 COSMIC
COSN17421658 7400 COSMIC
COSN27058126 7413 COSMIC
COSN8506564 7544 COSMIC
COSN10052666 7590 COSMIC
COSN1454500 7686 COSMIC
COSN29037790 8158 COSMIC
COSN22084867 8764 COSMIC
COSN19158806 8913 COSMIC
COSN9026561 9060 COSMIC
COSN8506563 9202 COSMIC
COSN24674984 9392 COSMIC
COSN16968058 9524 COSMIC
COSN24050143 9555 COSMIC
COSN6043428 9578 COSMIC
COSN8914512 9625 COSMIC
COSN1454499 9897 COSMIC
COSN6043427 10041 COSMIC
COSN6043426 10065 COSMIC
COSN23111186 10111 COSMIC
COSN1107882 10282 COSMIC
COSN1107881 10284 COSMIC
COSN8143877 10363 COSMIC
COSN8143876 10418 COSMIC
COSN10052665 10455 COSMIC
COSN25127355 10736 COSMIC
COSN29989513 10792 COSMIC
COSN24723735 10794 COSMIC
COSN16627552 10884 COSMIC
COSN1107880 10915 COSMIC
COSN25269931 11153 COSMIC
COSN1107879 11371 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs146327229 1 dbSNP
rs1373567551 10 dbSNP
rs1395183590 11 dbSNP
rs749013935 12 dbSNP
rs770731172 14 dbSNP
rs200756916 16 dbSNP
rs748750163 19 dbSNP
rs1165627252 20 dbSNP
rs755709503 21 dbSNP
rs745746041 30 dbSNP
rs1159007795 33 dbSNP
rs781281162 40 dbSNP
rs1411536262 43 dbSNP
rs1164881753 44 dbSNP
rs1364632791 45 dbSNP
rs757332708 49 dbSNP
rs779511800 60 dbSNP
rs755451334 62 dbSNP
rs1346366390 66 dbSNP
rs915015516 73 dbSNP
rs566959737 77 dbSNP
rs547227191 86 dbSNP
rs954263088 98 dbSNP
rs1279826324 112 dbSNP
rs946587524 113 dbSNP
rs1190656503 114 dbSNP
rs1246883623 116 dbSNP
rs1449472258 119 dbSNP
rs1189959472 121 dbSNP
rs1438068624 122 dbSNP
rs749323197 123 dbSNP
rs533467819 135 dbSNP
rs1288454290 136 dbSNP
rs1211281138 142 dbSNP
rs1040381782 157 dbSNP
rs1030233574 160 dbSNP
rs1274337529 166 dbSNP
rs1228369409 169 dbSNP
rs1364747133 176 dbSNP
rs1435840545 181 dbSNP
rs1299950536 189 dbSNP
rs977010100 190 dbSNP
rs961607433 199 dbSNP
rs1049114967 200 dbSNP
rs1281668121 201 dbSNP
rs142268959 205 dbSNP
rs1203763566 209 dbSNP
rs919752566 209 dbSNP
rs527744200 211 dbSNP
rs1267036727 212 dbSNP
rs1465087688 218 dbSNP
rs1210015778 220 dbSNP
rs796980896 220 dbSNP
rs374025888 224 dbSNP
rs1199567783 227 dbSNP
rs199745842 236 dbSNP
rs530844979 249 dbSNP
rs1379302482 253 dbSNP
rs958618312 255 dbSNP
rs928509325 270 dbSNP
rs561846006 271 dbSNP
rs1395378616 274 dbSNP
rs1165526233 276 dbSNP
rs1388129684 278 dbSNP
rs1457999885 281 dbSNP
rs1013411103 282 dbSNP
rs542001605 284 dbSNP
rs1322612013 290 dbSNP
rs1456669009 290 dbSNP
rs1388736768 295 dbSNP
rs967425779 306 dbSNP
rs1405460654 308 dbSNP
rs1333350728 309 dbSNP
rs1226895837 312 dbSNP
rs1020057240 316 dbSNP
rs1329385598 322 dbSNP
rs573742027 328 dbSNP
rs1229905005 355 dbSNP
rs1011319936 360 dbSNP
rs560108705 363 dbSNP
rs1209926041 368 dbSNP
rs540483714 375 dbSNP
rs577984580 376 dbSNP
rs1269316642 379 dbSNP
rs939135090 383 dbSNP
rs1436039840 396 dbSNP
rs187465365 398 dbSNP
rs1029165525 400 dbSNP
rs35841137 400 dbSNP
rs902443742 407 dbSNP
rs1042304350 409 dbSNP
rs1245764247 413 dbSNP
rs1412496556 416 dbSNP
rs946426463 417 dbSNP
rs1473032669 431 dbSNP
rs1161731350 433 dbSNP
rs760127992 438 dbSNP
rs902104382 439 dbSNP
rs1004907035 445 dbSNP
rs561597048 445 dbSNP
rs914877522 449 dbSNP
rs886425245 456 dbSNP
rs549674265 461 dbSNP
rs537837000 468 dbSNP
rs1208603487 469 dbSNP
rs1310063495 472 dbSNP
rs749887081 474 dbSNP
rs932388749 475 dbSNP
rs1244832111 479 dbSNP
rs922315701 484 dbSNP
rs916625302 486 dbSNP
rs1339943776 491 dbSNP
rs1315680022 494 dbSNP
rs1252265426 497 dbSNP
rs1055562189 498 dbSNP
rs752339611 505 dbSNP
rs961502793 508 dbSNP
rs1254286938 511 dbSNP
rs937142799 519 dbSNP
rs1165534967 522 dbSNP
rs183133505 523 dbSNP
rs1428370531 526 dbSNP
rs1168588620 547 dbSNP
rs1301501168 559 dbSNP
rs1443436093 589 dbSNP
rs1431961886 604 dbSNP
rs1377947995 608 dbSNP
rs1396295938 610 dbSNP
rs1362483692 611 dbSNP
rs984326202 612 dbSNP
rs952780156 613 dbSNP
rs1023385762 618 dbSNP
rs1012881536 627 dbSNP
rs1275200347 629 dbSNP
rs1371768258 630 dbSNP
rs767564385 637 dbSNP
rs1320000601 653 dbSNP
rs1207714303 660 dbSNP
rs1035747612 672 dbSNP
rs945784869 685 dbSNP
rs1182721386 703 dbSNP
rs1483036186 703 dbSNP
rs1003394322 705 dbSNP
rs796146619 720 dbSNP
rs1245042128 728 dbSNP
rs912991997 738 dbSNP
rs989772807 740 dbSNP
rs902327588 750 dbSNP
rs1042354507 751 dbSNP
rs1359002694 752 dbSNP
rs1466224092 754 dbSNP
rs1434204461 762 dbSNP
rs1011232819 773 dbSNP
rs1343369735 774 dbSNP
rs74911746 776 dbSNP
rs966714964 785 dbSNP
rs1401060828 787 dbSNP
rs774342412 804 dbSNP
rs1367235761 806 dbSNP
rs1217455683 812 dbSNP
rs1300317114 815 dbSNP
rs1312627955 835 dbSNP
rs1211980604 838 dbSNP
rs1265176681 843 dbSNP
rs932300717 848 dbSNP
rs1005470858 854 dbSNP
rs74605084 856 dbSNP
rs1455327908 859 dbSNP
rs1476664859 860 dbSNP
rs1190043005 862 dbSNP
rs922376243 863 dbSNP
rs1253023875 869 dbSNP
rs1179064278 877 dbSNP
rs1409264301 892 dbSNP
rs149926418 894 dbSNP
rs1027693357 896 dbSNP
rs994916093 898 dbSNP
rs1484648227 899 dbSNP
rs1434207846 903 dbSNP
rs1244325599 914 dbSNP
rs1368234110 927 dbSNP
rs1220697751 933 dbSNP
rs1286269991 939 dbSNP
rs567027590 943 dbSNP
rs1228076114 944 dbSNP
rs1055071841 961 dbSNP
rs1448738582 967 dbSNP
rs908707742 973 dbSNP
rs1278679906 976 dbSNP
rs984431488 980 dbSNP
rs937249398 982 dbSNP
rs953081356 986 dbSNP
rs916133684 987 dbSNP
rs1348887550 988 dbSNP
rs546894235 994 dbSNP
rs1250130939 1002 dbSNP
rs907126411 1016 dbSNP
rs1159531411 1026 dbSNP
rs1409715396 1027 dbSNP
rs539679350 1032 dbSNP
rs945871317 1033 dbSNP
rs991913490 1035 dbSNP
rs1350364825 1037 dbSNP
rs913106470 1042 dbSNP
rs17091167 1043 dbSNP
rs1349711541 1046 dbSNP
rs190227616 1052 dbSNP
rs530807290 1056 dbSNP
rs561948850 1058 dbSNP
rs966565388 1059 dbSNP
rs974828917 1060 dbSNP
rs966287729 1062 dbSNP
rs1019617582 1066 dbSNP
rs983760669 1074 dbSNP
rs1482895778 1081 dbSNP
rs1364242194 1084 dbSNP
rs1183372597 1086 dbSNP
rs1290533514 1090 dbSNP
rs1431440283 1098 dbSNP
rs1471627915 1099 dbSNP
rs1020797409 1101 dbSNP
rs1180747502 1116 dbSNP
rs1413961326 1123 dbSNP
rs1010699684 1125 dbSNP
rs1358316033 1131 dbSNP
rs1166560561 1135 dbSNP
rs1369885663 1136 dbSNP
rs893721231 1152 dbSNP
rs1430108970 1153 dbSNP
rs1330670735 1154 dbSNP
rs756275657 1163 dbSNP
rs1049636620 1164 dbSNP
rs1380065892 1166 dbSNP
rs1027807012 1170 dbSNP
rs373170890 1175 dbSNP
rs1436128135 1184 dbSNP
rs548633652 1187 dbSNP
rs750621452 1188 dbSNP
rs776747333 1194 dbSNP
rs1275609590 1215 dbSNP
rs895252304 1217 dbSNP
rs900834562 1230 dbSNP
rs1040806878 1231 dbSNP
rs771135107 1232 dbSNP
rs1003960371 1233 dbSNP
rs907077783 1238 dbSNP
rs139160967 1246 dbSNP
rs747065278 1249 dbSNP
rs1049049080 1251 dbSNP
rs946016267 1254 dbSNP
rs1399877972 1256 dbSNP
rs1412982262 1259 dbSNP
rs891618375 1279 dbSNP
rs931471103 1280 dbSNP
rs1407131383 1283 dbSNP
rs879764403 1284 dbSNP
rs777905822 1288 dbSNP
rs1486241745 1289 dbSNP
rs935709069 1293 dbSNP
rs921688916 1304 dbSNP
rs1274172116 1307 dbSNP
rs1202752340 1310 dbSNP
rs1309297525 1311 dbSNP
rs1296422593 1316 dbSNP
rs1215033954 1317 dbSNP
rs1343232990 1320 dbSNP
rs1200248954 1323 dbSNP
rs559829931 1331 dbSNP
rs1462398752 1338 dbSNP
rs1182032748 1342 dbSNP
rs944369470 1347 dbSNP
rs1246936505 1350 dbSNP
rs377738734 1351 dbSNP
rs938691320 1353 dbSNP
rs1291439385 1356 dbSNP
rs1465284034 1362 dbSNP
rs150737326 1364 dbSNP
rs984095841 1365 dbSNP
rs772625479 1366 dbSNP
rs950991273 1367 dbSNP
rs1430199456 1384 dbSNP
rs1471105831 1410 dbSNP
rs138454934 1412 dbSNP
rs967457700 1430 dbSNP
rs1382851570 1431 dbSNP
rs1320780463 1434 dbSNP
rs973554099 1435 dbSNP
rs1232934572 1446 dbSNP
rs577957491 1459 dbSNP
rs1460180963 1467 dbSNP
rs1226256117 1471 dbSNP
rs1355725951 1483 dbSNP
rs1170550375 1487 dbSNP
rs1266937876 1492 dbSNP
rs1329163364 1495 dbSNP
rs1034181334 1496 dbSNP
rs959413796 1496 dbSNP
rs1450999912 1523 dbSNP
rs1021677647 1525 dbSNP
rs1003668371 1528 dbSNP
rs1270851121 1530 dbSNP
rs989731373 1532 dbSNP
rs564363955 1535 dbSNP
rs1416326974 1538 dbSNP
rs1411519438 1547 dbSNP
rs1454331719 1551 dbSNP
rs1160400284 1552 dbSNP
rs1389163513 1553 dbSNP
rs1028688867 1560 dbSNP
rs1475726069 1571 dbSNP
rs1486304887 1578 dbSNP
rs544526081 1581 dbSNP
rs759073094 1583 dbSNP
rs1010548545 1584 dbSNP
rs1287263137 1589 dbSNP
rs1317170543 1602 dbSNP
rs185856226 1606 dbSNP
rs555092380 1613 dbSNP
rs891732465 1618 dbSNP
rs1054257384 1622 dbSNP
rs1000033849 1635 dbSNP
rs1223218480 1639 dbSNP
rs900376734 1653 dbSNP
rs1039187495 1654 dbSNP
rs868441638 1655 dbSNP
rs1251305500 1662 dbSNP
rs1220927406 1683 dbSNP
rs944501462 1694 dbSNP
rs1366854189 1695 dbSNP
rs900886754 1696 dbSNP
rs541876098 1698 dbSNP
rs1019244879 1699 dbSNP
rs1164701344 1719 dbSNP
rs1235106542 1723 dbSNP
rs1428168987 1740 dbSNP
rs1355810106 1743 dbSNP
rs1306054229 1745 dbSNP
rs572835714 1754 dbSNP
rs1309946501 1755 dbSNP
rs911528680 1755 dbSNP
rs1246088279 1760 dbSNP
rs1003802940 1761 dbSNP
rs1389264651 1762 dbSNP
rs886874097 1766 dbSNP
rs1317010097 1811 dbSNP
rs748632539 1814 dbSNP
rs1375080463 1825 dbSNP
rs1298457898 1829 dbSNP
rs931495766 1830 dbSNP
rs1460454723 1838 dbSNP
rs1391710220 1839 dbSNP
rs1167692524 1842 dbSNP
rs1251721189 1858 dbSNP
rs1481073410 1861 dbSNP
rs1197849040 1878 dbSNP
rs1254343515 1883 dbSNP
rs894628321 1892 dbSNP
rs1444023539 1894 dbSNP
rs1184318544 1903 dbSNP
rs1047409693 1914 dbSNP
rs1462454231 1917 dbSNP
rs929530625 1918 dbSNP
rs920852804 1927 dbSNP
rs1463853780 1929 dbSNP
rs1401077251 1934 dbSNP
rs142338861 1934 dbSNP
rs1452678235 1934 dbSNP
rs1316584958 1937 dbSNP
rs1362915184 1946 dbSNP
rs1421032432 1949 dbSNP
rs959527630 1952 dbSNP
rs1296023645 1965 dbSNP
rs1308969327 1973 dbSNP
rs1230811103 1976 dbSNP
rs1254435306 1977 dbSNP
rs553061302 1982 dbSNP
rs1056482591 1996 dbSNP
rs926842917 1998 dbSNP
rs1245096596 1999 dbSNP
rs1463926510 2000 dbSNP
rs767768483 2003 dbSNP
rs1186374911 2005 dbSNP
rs938910528 2006 dbSNP
rs928832832 2008 dbSNP
rs41289152 2010 dbSNP
rs1376686002 2014 dbSNP
rs1021347089 2015 dbSNP
rs1009579925 2018 dbSNP
rs946001758 2019 dbSNP
rs914658734 2024 dbSNP
rs1433721247 2025 dbSNP
rs1289319588 2038 dbSNP
rs1467172647 2045 dbSNP
rs1364017422 2052 dbSNP
rs1254999964 2054 dbSNP
rs1215435306 2057 dbSNP
rs1335406585 2060 dbSNP
rs1300384294 2068 dbSNP
rs1323066843 2069 dbSNP
rs570754620 2070 dbSNP
rs1259863067 2078 dbSNP
rs1224417830 2088 dbSNP
rs1265234077 2089 dbSNP
rs1236608100 2103 dbSNP
rs1318561824 2114 dbSNP
rs755371042 2125 dbSNP
rs1487160051 2139 dbSNP
rs1189819722 2150 dbSNP
rs201451487 2155 dbSNP
rs1000147979 2156 dbSNP
rs1368096778 2165 dbSNP
rs754184535 2168 dbSNP
rs1327353844 2169 dbSNP
rs1442201583 2170 dbSNP
rs975178168 2175 dbSNP
rs1159235769 2188 dbSNP
rs965274998 2204 dbSNP
rs879300225 2207 dbSNP
rs1017460878 2211 dbSNP
rs1456377485 2221 dbSNP
rs1019464310 2223 dbSNP
rs867156436 2228 dbSNP
rs1345989620 2241 dbSNP
rs1483039278 2260 dbSNP
rs1003853902 2268 dbSNP
rs886761378 2270 dbSNP
rs575729092 2275 dbSNP
rs1384874664 2276 dbSNP
rs1406556158 2277 dbSNP
rs1157400819 2278 dbSNP
rs1348893682 2280 dbSNP
rs1223260012 2289 dbSNP
rs1285105403 2297 dbSNP
rs1455654424 2301 dbSNP
rs1009039354 2306 dbSNP
rs1027178926 2309 dbSNP
rs1047812354 2337 dbSNP
rs995256625 2342 dbSNP
rs1202073520 2344 dbSNP
rs1249114330 2354 dbSNP
rs779590115 2355 dbSNP
rs1177255225 2357 dbSNP
rs1409601192 2361 dbSNP
rs139791066 2363 dbSNP
rs1037907437 2366 dbSNP
rs1055970789 2381 dbSNP
rs938292671 2382 dbSNP
rs1194346207 2383 dbSNP
rs190788451 2385 dbSNP
rs1368921962 2397 dbSNP
rs568406145 2405 dbSNP
rs1280203685 2410 dbSNP
rs1375537943 2411 dbSNP
rs548270688 2416 dbSNP
rs372130137 2418 dbSNP
rs1203367085 2419 dbSNP
rs1225145569 2422 dbSNP
rs766385677 2424 dbSNP
rs1436853344 2435 dbSNP
rs1041967856 2436 dbSNP
rs578207528 2439 dbSNP
rs982317513 2441 dbSNP
rs949466689 2445 dbSNP
rs1182476421 2447 dbSNP
rs187254287 2451 dbSNP
rs762771851 2452 dbSNP
rs1418609536 2455 dbSNP
rs1410326643 2456 dbSNP
rs1345305113 2457 dbSNP
rs1329719106 2459 dbSNP
rs1356517218 2460 dbSNP
rs1304904463 2462 dbSNP
rs1450493038 2465 dbSNP
rs988264755 2466 dbSNP
rs1384156291 2467 dbSNP
rs958018220 2475 dbSNP
rs1032372678 2479 dbSNP
rs978657053 2495 dbSNP
rs548852794 2496 dbSNP
rs1215543630 2498 dbSNP
rs1274622773 2505 dbSNP
rs964676941 2510 dbSNP
rs145940621 2511 dbSNP
rs1243281102 2515 dbSNP
rs1384455505 2519 dbSNP
rs1054987982 2530 dbSNP
rs372225693 2537 dbSNP
rs1372443389 2542 dbSNP
rs932087812 2544 dbSNP
rs1169460232 2549 dbSNP
rs1421878056 2552 dbSNP
rs1433022822 2553 dbSNP
rs890161214 2559 dbSNP
rs1407016822 2564 dbSNP
rs1174563351 2567 dbSNP
rs1316787780 2569 dbSNP
rs1326387083 2574 dbSNP
rs1026016055 2577 dbSNP
rs1431890005 2577 dbSNP
rs921979265 2582 dbSNP
rs1222595287 2586 dbSNP
rs1263377908 2587 dbSNP
rs993239847 2595 dbSNP
rs898819650 2599 dbSNP
rs975232199 2613 dbSNP
rs182173809 2616 dbSNP
rs1479578758 2624 dbSNP
rs912504116 2628 dbSNP
rs1430258710 2630 dbSNP
rs1263556523 2635 dbSNP
rs982649367 2640 dbSNP
rs905453016 2642 dbSNP
rs1046963478 2649 dbSNP
rs1209888728 2650 dbSNP
rs949577827 2653 dbSNP
rs1343952764 2660 dbSNP
rs1404732196 2666 dbSNP
rs914092036 2670 dbSNP
rs951153012 2672 dbSNP
rs1236216066 2676 dbSNP
rs1259681954 2716 dbSNP
rs1351297232 2723 dbSNP
rs1206900234 2732 dbSNP
rs1287652285 2733 dbSNP
rs1490109891 2745 dbSNP
rs1199914316 2749 dbSNP
rs1281997979 2759 dbSNP
rs1481567437 2761 dbSNP
rs988210891 2761 dbSNP
rs1179732834 2770 dbSNP
rs1338139108 2782 dbSNP
rs1267924878 2783 dbSNP
rs1230468010 2784 dbSNP
rs936763390 2788 dbSNP
rs1364274680 2795 dbSNP
rs1424377729 2802 dbSNP
rs1026646498 2804 dbSNP
rs1367027145 2805 dbSNP
rs925250476 2805 dbSNP
rs1389378100 2807 dbSNP
rs995538954 2810 dbSNP
rs34238558 2819 dbSNP
rs1305671491 2825 dbSNP
rs1335768364 2837 dbSNP
rs544491454 2840 dbSNP
rs1312775976 2841 dbSNP
rs1327534572 2845 dbSNP
rs1034071351 2847 dbSNP
rs1358685850 2847 dbSNP
rs112922657 2849 dbSNP
rs1413308174 2850 dbSNP
rs397722476 2850 dbSNP
rs1377699274 2854 dbSNP
rs113594891 2857 dbSNP
rs35441647 2857 dbSNP
rs79600862 2857 dbSNP
rs975423491 2858 dbSNP
rs1383895340 2860 dbSNP
rs1444615502 2866 dbSNP
rs755722543 2870 dbSNP
rs907351212 2872 dbSNP
rs368958020 2873 dbSNP
rs1010490699 2877 dbSNP
rs1409640590 2877 dbSNP
rs1297191922 2878 dbSNP
rs1396799917 2886 dbSNP
rs1392589325 2887 dbSNP
rs1394363031 2887 dbSNP
rs562050242 2898 dbSNP
rs1334173887 2900 dbSNP
rs1381924266 2901 dbSNP
rs1017523049 2905 dbSNP
rs987832213 2909 dbSNP
rs796864062 2918 dbSNP
rs893339946 2918 dbSNP
rs1054469224 2922 dbSNP
rs1481104559 2924 dbSNP
rs368918794 2925 dbSNP
rs1169733427 2931 dbSNP
rs374661950 2935 dbSNP
rs1200581795 2949 dbSNP
rs993187424 2950 dbSNP
rs931949166 2951 dbSNP
rs541440130 2956 dbSNP
rs1424240226 2964 dbSNP
rs1055357982 2970 dbSNP
rs1040419210 2974 dbSNP
rs1427060984 2979 dbSNP
rs372163155 2982 dbSNP
rs1170233017 2986 dbSNP
rs912385795 2991 dbSNP
rs982700438 2993 dbSNP
rs1173624697 2997 dbSNP
rs12123586 3002 dbSNP
rs927819337 3009 dbSNP
rs1187759044 3016 dbSNP
rs1338568056 3017 dbSNP
rs919804035 3028 dbSNP
rs973778648 3029 dbSNP
rs15559 3043 dbSNP
rs958591668 3047 dbSNP
rs1034123723 3051 dbSNP
rs1197032358 3057 dbSNP
rs1220767512 3058 dbSNP
rs1261503586 3063 dbSNP
rs1322843287 3064 dbSNP
rs1339556762 3071 dbSNP
rs892619785 3082 dbSNP
rs1002616921 3086 dbSNP
rs1485203646 3087 dbSNP
rs767118845 3094 dbSNP
rs971596051 3096 dbSNP
rs1479008643 3102 dbSNP
rs1196759681 3105 dbSNP
rs1232042248 3106 dbSNP
rs866772850 3109 dbSNP
rs1428190806 3110 dbSNP
rs1357712187 3118 dbSNP
rs1178016459 3119 dbSNP
rs1343340484 3126 dbSNP
rs1453042963 3128 dbSNP
rs1294314284 3132 dbSNP
rs578209146 3133 dbSNP
rs925366859 3138 dbSNP
rs1039686575 3142 dbSNP
rs769467042 3148 dbSNP
rs1345153713 3153 dbSNP
rs867738741 3166 dbSNP
rs1224171643 3167 dbSNP
rs1303566602 3168 dbSNP
rs1315649857 3172 dbSNP
rs1334204750 3179 dbSNP
rs942713801 3179 dbSNP
rs912586550 3185 dbSNP
rs987391139 3186 dbSNP
rs1480586748 3192 dbSNP
rs954808263 3192 dbSNP
rs1020467085 3210 dbSNP
rs919067029 3215 dbSNP
rs1010787432 3217 dbSNP
rs1418005101 3218 dbSNP
rs552786522 3219 dbSNP
rs1393894218 3227 dbSNP
rs1164083468 3249 dbSNP
rs1362403804 3252 dbSNP
rs963061666 3252 dbSNP
rs1015966236 3253 dbSNP
rs972427749 3255 dbSNP
rs1419691101 3260 dbSNP
rs893404316 3262 dbSNP
rs545504826 3264 dbSNP
rs1405846960 3266 dbSNP
rs1033658135 3267 dbSNP
rs1163628088 3271 dbSNP
rs35863813 3271 dbSNP
rs996217223 3271 dbSNP
rs1025085367 3277 dbSNP
rs576980066 3278 dbSNP
rs531945272 3279 dbSNP
rs1227678052 3280 dbSNP
rs950873 3280 dbSNP
rs1223227464 3281 dbSNP
rs201512378 3281 dbSNP
rs1039780773 3282 dbSNP
rs1177308594 3282 dbSNP
rs1230834337 3282 dbSNP
rs1491568967 3282 dbSNP
rs57144811 3282 dbSNP
rs200295471 3283 dbSNP
rs1441525753 3284 dbSNP
rs568635537 3284 dbSNP
rs1298868423 3285 dbSNP
rs929770235 3291 dbSNP
rs1379744639 3292 dbSNP
rs764037040 3293 dbSNP
rs1230412138 3296 dbSNP
rs1451183537 3296 dbSNP
rs555187320 3296 dbSNP
rs1270402767 3297 dbSNP
rs912544336 3299 dbSNP
rs919872156 3306 dbSNP
rs1459592349 3308 dbSNP
rs1212310592 3315 dbSNP
rs555287399 3318 dbSNP
rs974377880 3323 dbSNP
rs575625832 3324 dbSNP
rs1473632260 3327 dbSNP
rs1165979839 3341 dbSNP
rs1417608016 3344 dbSNP
rs933206501 3346 dbSNP
rs919181539 3350 dbSNP
rs1450562364 3351 dbSNP
rs534698735 3356 dbSNP
rs1349052926 3358 dbSNP
rs937050278 3368 dbSNP
rs17091166 3370 dbSNP
rs761889890 3393 dbSNP
rs1450599600 3398 dbSNP
rs981066314 3416 dbSNP
rs969562435 3420 dbSNP
rs971144080 3429 dbSNP
rs1443246476 3433 dbSNP
rs1370280561 3452 dbSNP
rs1024615296 3457 dbSNP
rs992241881 3485 dbSNP
rs1020017376 3486 dbSNP
rs564943166 3488 dbSNP
rs989015095 3502 dbSNP
rs1444112437 3507 dbSNP
rs1190740614 3516 dbSNP
rs369312368 3519 dbSNP
rs957755117 3523 dbSNP
rs1031255307 3527 dbSNP
rs1194585537 3528 dbSNP
rs1323990980 3529 dbSNP
rs1033296967 3539 dbSNP
rs552655980 3543 dbSNP
rs996826109 3583 dbSNP
rs142402159 3586 dbSNP
rs1018903120 3590 dbSNP
rs1324193092 3596 dbSNP
rs751511700 3602 dbSNP
rs1416711312 3605 dbSNP
rs554282301 3637 dbSNP
rs904007501 3645 dbSNP
rs1399874993 3648 dbSNP
rs1401011126 3658 dbSNP
rs1279650517 3662 dbSNP
rs1008816655 3663 dbSNP
rs886538600 3665 dbSNP
rs1343295272 3674 dbSNP
rs1405574116 3677 dbSNP
rs1274986222 3678 dbSNP
rs1159895299 3679 dbSNP
rs1203241218 3684 dbSNP
rs1283494004 3687 dbSNP
rs1048252702 3697 dbSNP
rs1393896351 3716 dbSNP
rs570627899 3722 dbSNP
rs929848831 3725 dbSNP
rs891215964 3730 dbSNP
rs1051067948 3735 dbSNP
rs1479608982 3749 dbSNP
rs1198777948 3763 dbSNP
rs1247783140 3772 dbSNP
rs898308808 3778 dbSNP
rs1289031609 3789 dbSNP
rs1038330013 3792 dbSNP
rs1445604697 3799 dbSNP
rs1479053420 3803 dbSNP
rs766139626 3806 dbSNP
rs1157287679 3819 dbSNP
rs927161550 3822 dbSNP
rs1384907432 3833 dbSNP
rs1420656085 3845 dbSNP
rs1241077664 3846 dbSNP
rs981118502 3860 dbSNP
rs897198307 3872 dbSNP
rs949679196 3881 dbSNP
rs1301607940 3885 dbSNP
rs913011675 3886 dbSNP
rs550780835 3892 dbSNP
rs981026372 3901 dbSNP
rs1354276684 3903 dbSNP
rs1242077506 3907 dbSNP
rs957596617 3909 dbSNP
rs1222108513 3913 dbSNP
rs1268295758 3916 dbSNP
rs1033590866 3923 dbSNP
rs1179705865 3925 dbSNP
rs974898440 3941 dbSNP
rs1440789770 3943 dbSNP
rs964936583 3955 dbSNP
rs868394662 3956 dbSNP
rs1008870726 3958 dbSNP
rs1424410161 3965 dbSNP
rs530761069 3970 dbSNP
rs561832236 3974 dbSNP
rs1392393255 3982 dbSNP
rs139010918 3985 dbSNP
rs1327542350 3987 dbSNP
rs995322750 4007 dbSNP
rs1377568077 4010 dbSNP
rs917660735 4011 dbSNP
rs899210571 4016 dbSNP
rs1312822802 4021 dbSNP
rs1358532290 4033 dbSNP
rs1245211625 4044 dbSNP
rs1038620111 4050 dbSNP
rs1374467931 4051 dbSNP
rs775568173 4060 dbSNP
rs1237575130 4068 dbSNP
rs1030699398 4069 dbSNP
rs1386864336 4073 dbSNP
rs764080604 4079 dbSNP
rs1455175033 4080 dbSNP
rs1425307735 4088 dbSNP
rs1165877778 4091 dbSNP
rs905797587 4092 dbSNP
rs376044735 4093 dbSNP
rs1166811658 4097 dbSNP
rs968305490 4107 dbSNP
rs762677591 4108 dbSNP
rs1334663038 4113 dbSNP
rs912883234 4116 dbSNP
rs1007474326 4117 dbSNP
rs558928235 4134 dbSNP
rs545466877 4136 dbSNP
rs1314542357 4138 dbSNP
rs535954523 4145 dbSNP
rs1225605569 4146 dbSNP
rs1257649811 4153 dbSNP
rs1278431888 4156 dbSNP
rs572001847 4159 dbSNP
rs994242428 4169 dbSNP
rs35646005 4184 dbSNP
rs897144821 4184 dbSNP
rs1182818002 4199 dbSNP
rs1038354336 4200 dbSNP
rs1272402416 4204 dbSNP
rs776380309 4207 dbSNP
rs925690116 4208 dbSNP
rs118030345 4223 dbSNP
rs941924410 4230 dbSNP
rs1280091633 4240 dbSNP
rs1173572824 4249 dbSNP
rs1405283009 4252 dbSNP
rs1466429033 4257 dbSNP
rs964823385 4261 dbSNP
rs771126770 4265 dbSNP
rs1400363190 4274 dbSNP
rs987669107 4280 dbSNP
rs1277847341 4286 dbSNP
rs1354632662 4287 dbSNP
rs1341317148 4293 dbSNP
rs1044865644 4298 dbSNP
rs947876760 4304 dbSNP
rs917792325 4306 dbSNP
rs991894499 4319 dbSNP
rs1258267551 4334 dbSNP
rs1359181013 4342 dbSNP
rs1216300018 4343 dbSNP
rs950752322 4345 dbSNP
rs1478566730 4353 dbSNP
rs770726963 4367 dbSNP
rs1196660454 4372 dbSNP
rs1423940038 4375 dbSNP
rs935090056 4375 dbSNP
rs553957051 4380 dbSNP
rs979103947 4383 dbSNP
rs994815599 4400 dbSNP
rs963809254 4401 dbSNP
rs1298528827 4409 dbSNP
rs543649216 4410 dbSNP
rs1402005266 4418 dbSNP
rs1001395163 4420 dbSNP
rs905683289 4422 dbSNP
rs1045714166 4426 dbSNP
rs1367063693 4428 dbSNP
rs1014179126 4436 dbSNP
rs985766743 4438 dbSNP
rs773330032 4445 dbSNP
rs1287109557 4458 dbSNP
rs1475068167 4460 dbSNP
rs1219873180 4461 dbSNP
rs1053204538 4462 dbSNP
rs772111505 4468 dbSNP
rs961455358 4470 dbSNP
rs1016857068 4472 dbSNP
rs1005510641 4480 dbSNP
rs538423690 4481 dbSNP
rs1045377624 4486 dbSNP
rs1422497638 4488 dbSNP
rs1163004270 4496 dbSNP
rs1202520114 4503 dbSNP
rs1349481558 4504 dbSNP
rs1437314877 4506 dbSNP
rs925709564 4508 dbSNP
rs1038740974 4524 dbSNP
rs1259882792 4527 dbSNP
rs1310616105 4529 dbSNP
rs896288879 4532 dbSNP
rs1244199656 4542 dbSNP
rs1056327508 4546 dbSNP
rs1219213626 4547 dbSNP
rs935037914 4553 dbSNP
rs923692118 4559 dbSNP
rs1249042123 4569 dbSNP
rs1043536822 4572 dbSNP
rs1179239337 4578 dbSNP
rs946368414 4579 dbSNP
rs779421235 4584 dbSNP
rs1413367922 4593 dbSNP
rs17091164 4594 dbSNP
rs986100261 4600 dbSNP
rs1398279208 4616 dbSNP
rs1465150967 4618 dbSNP
rs543569733 4623 dbSNP
rs1297314431 4628 dbSNP
rs912053082 4635 dbSNP
rs987721559 4639 dbSNP
rs1379708393 4644 dbSNP
rs951043499 4645 dbSNP
rs1450943318 4646 dbSNP
rs919489667 4651 dbSNP
rs1439368236 4654 dbSNP
rs922744273 4655 dbSNP
rs554923165 4667 dbSNP
rs1229742111 4674 dbSNP
rs1270426329 4676 dbSNP
rs1316807748 4691 dbSNP
rs1401896560 4691 dbSNP
rs184332721 4696 dbSNP
rs1461400746 4698 dbSNP
rs181682905 4720 dbSNP
rs1209174617 4729 dbSNP
rs1237910924 4731 dbSNP
rs1473650298 4750 dbSNP
rs1183869149 4752 dbSNP
rs1167556045 4764 dbSNP
rs1477554674 4766 dbSNP
rs972884289 4766 dbSNP
rs961403783 4783 dbSNP
rs1413195878 4787 dbSNP
rs1334077950 4788 dbSNP
rs1360165512 4789 dbSNP
rs1034210790 4790 dbSNP
rs980845589 4791 dbSNP
rs572320196 4792 dbSNP
rs1218728994 4797 dbSNP
rs1279472424 4805 dbSNP
rs1320797571 4808 dbSNP
rs1005668454 4809 dbSNP
rs1279220556 4815 dbSNP
rs1024150178 4824 dbSNP
rs1014060978 4826 dbSNP
rs891717424 4830 dbSNP
rs1031562018 4838 dbSNP
rs1000291024 4842 dbSNP
rs1488053509 4843 dbSNP
rs1194482789 4856 dbSNP
rs1425955066 4857 dbSNP
rs1199138393 4859 dbSNP
rs904175093 4863 dbSNP
rs1467983047 4873 dbSNP
rs1271272763 4887 dbSNP
rs1246705258 4895 dbSNP
rs550079675 4897 dbSNP
rs1296681521 4898 dbSNP
rs1322156234 4899 dbSNP
rs1305813738 4916 dbSNP
rs559008834 4920 dbSNP
rs1299638429 4934 dbSNP
rs149609412 4935 dbSNP
rs1231852509 4938 dbSNP
rs1331454867 4943 dbSNP
rs890169917 4944 dbSNP
rs1237705760 4947 dbSNP
rs774859253 4951 dbSNP
rs566178444 4952 dbSNP
rs570143150 4954 dbSNP
rs865936081 4957 dbSNP
rs1295860921 4963 dbSNP
rs973669242 4972 dbSNP
rs1458710337 4975 dbSNP
rs550344645 4976 dbSNP
rs946513208 4978 dbSNP
rs1479255023 4988 dbSNP
rs555990062 5001 dbSNP
rs138285265 5002 dbSNP
rs1420671665 5005 dbSNP
rs1421130147 5007 dbSNP
rs1380927454 5014 dbSNP
rs1385755608 5026 dbSNP
rs1049418856 5027 dbSNP
rs1193082925 5030 dbSNP
rs1467244124 5036 dbSNP
rs1251036140 5041 dbSNP
rs1211610979 5044 dbSNP
rs1488664313 5047 dbSNP
rs576281193 5051 dbSNP
rs1242006494 5057 dbSNP
rs1262744254 5062 dbSNP
rs1354446512 5065 dbSNP
rs77658348 5066 dbSNP
rs4650108 5071 dbSNP
rs970808071 5075 dbSNP
rs1025032539 5078 dbSNP
rs972998578 5080 dbSNP
rs940184141 5081 dbSNP
rs1238075006 5083 dbSNP
rs548139107 5088 dbSNP
rs528411144 5089 dbSNP
rs1366368672 5095 dbSNP
rs559255091 5104 dbSNP
rs1309614547 5106 dbSNP
rs984593212 5109 dbSNP
rs1368203695 5110 dbSNP
rs970184302 5121 dbSNP
rs1463585913 5124 dbSNP
rs1330638249 5126 dbSNP
rs1377494345 5127 dbSNP
rs17091160 5128 dbSNP
rs1032033964 5134 dbSNP
rs150420572 5145 dbSNP
rs960572584 5150 dbSNP
rs140504324 5153 dbSNP
rs999473719 5154 dbSNP
rs1284981716 5155 dbSNP
rs1337100513 5160 dbSNP
rs1287499020 5161 dbSNP
rs902332441 5162 dbSNP
rs1258005056 5166 dbSNP
rs755776159 5181 dbSNP
rs1197933672 5182 dbSNP
rs1007151253 5183 dbSNP
rs1423584606 5185 dbSNP
rs370609951 5190 dbSNP
rs889551652 5194 dbSNP
rs1476572335 5209 dbSNP
rs1169277549 5213 dbSNP
rs1400955844 5215 dbSNP
rs1452624989 5218 dbSNP
rs890222033 5224 dbSNP
rs1051443645 5239 dbSNP
rs567672062 5240 dbSNP
rs1433717550 5252 dbSNP
rs1216890483 5256 dbSNP
rs543512568 5261 dbSNP
rs1318692419 5262 dbSNP
rs897987079 5264 dbSNP
rs549350618 5272 dbSNP
rs1483151284 5274 dbSNP
rs1201348488 5280 dbSNP
rs756116547 5283 dbSNP
rs942302092 5291 dbSNP
rs1487068811 5297 dbSNP
rs910029221 5301 dbSNP
rs926830662 5308 dbSNP
rs1423797235 5309 dbSNP
rs984316898 5312 dbSNP
rs1173919412 5320 dbSNP
rs948777901 5321 dbSNP
rs980779473 5322 dbSNP
rs949338325 5339 dbSNP
rs771270714 5341 dbSNP
rs918028999 5361 dbSNP
rs993359899 5363 dbSNP
rs1257265196 5366 dbSNP
rs960017547 5367 dbSNP
rs988228072 5376 dbSNP
rs1297808034 5387 dbSNP
rs1341259899 5392 dbSNP
rs1031702190 5400 dbSNP
rs1299859351 5401 dbSNP
rs956100423 5402 dbSNP
rs1402215873 5403 dbSNP
rs1282827331 5413 dbSNP
rs1351951207 5419 dbSNP
rs924464858 5422 dbSNP
rs1022514774 5423 dbSNP
rs1210770449 5424 dbSNP
rs1188902819 5425 dbSNP
rs978962124 5430 dbSNP
rs1010742276 5432 dbSNP
rs1433634672 5436 dbSNP
rs968619356 5440 dbSNP
rs1175436442 5442 dbSNP
rs1378317924 5443 dbSNP
rs889657390 5444 dbSNP
rs1312462113 5457 dbSNP
rs1017451760 5461 dbSNP
rs561551313 5469 dbSNP
rs954365348 5471 dbSNP
rs1173240942 5478 dbSNP
rs997918344 5489 dbSNP
rs1306250396 5500 dbSNP
rs541327787 5508 dbSNP
rs900828033 5513 dbSNP
rs993259818 5532 dbSNP
rs1036673933 5533 dbSNP
rs188389703 5535 dbSNP
rs756859326 5546 dbSNP
rs34806241 5552 dbSNP
rs41289150 5555 dbSNP
rs560348367 5556 dbSNP
rs200971518 5572 dbSNP
rs1236252216 5581 dbSNP
rs1438885541 5582 dbSNP
rs781346956 5583 dbSNP
rs1409001807 5586 dbSNP
rs905459136 5588 dbSNP
rs1484492856 5590 dbSNP
rs1162937419 5594 dbSNP
rs1045322504 5598 dbSNP
rs764139597 5599 dbSNP
rs539031580 5601 dbSNP
rs916095038 5611 dbSNP
rs917915389 5616 dbSNP
rs1446529920 5622 dbSNP
rs1310363109 5631 dbSNP
rs1375979726 5643 dbSNP
rs1226318335 5654 dbSNP
rs1311546636 5661 dbSNP
rs1321835677 5664 dbSNP
rs1338238466 5666 dbSNP
rs1052987580 5669 dbSNP
rs1221037613 5670 dbSNP
rs758353984 5672 dbSNP
rs1234458139 5680 dbSNP
rs1318985055 5680 dbSNP
rs184787387 5681 dbSNP
rs1180385383 5684 dbSNP
rs938769250 5685 dbSNP
rs1475591252 5700 dbSNP
rs1167127149 5711 dbSNP
rs924580170 5712 dbSNP
rs1465621352 5713 dbSNP
rs1293080319 5718 dbSNP
rs757487361 5719 dbSNP
rs1356694673 5721 dbSNP
rs1446238443 5722 dbSNP
rs551983491 5737 dbSNP
rs1379380797 5744 dbSNP
rs536757743 5755 dbSNP
rs1335167447 5757 dbSNP
rs763796284 5769 dbSNP
rs1390865846 5770 dbSNP
rs978636883 5774 dbSNP
rs1219231639 5775 dbSNP
rs1274997742 5785 dbSNP
rs915160582 5789 dbSNP
rs1209105662 5796 dbSNP
rs968505338 5797 dbSNP
rs910499164 5801 dbSNP
rs1394466799 5814 dbSNP
rs953889412 5817 dbSNP
rs1261199546 5819 dbSNP
rs1477524662 5820 dbSNP
rs1169039814 5824 dbSNP
rs1028597505 5825 dbSNP
rs192616694 5828 dbSNP
rs1175724984 5831 dbSNP
rs965113108 5832 dbSNP
rs1416310242 5834 dbSNP
rs1295943538 5840 dbSNP
rs954418852 5842 dbSNP
rs1015177570 5846 dbSNP
rs1271882828 5848 dbSNP
rs1003835558 5849 dbSNP
rs868694260 5852 dbSNP
rs1163950298 5854 dbSNP
rs548383511 5856 dbSNP
rs1471722141 5863 dbSNP
rs752542419 5863 dbSNP
rs1369817875 5868 dbSNP
rs993539432 5870 dbSNP
rs765249076 5871 dbSNP
rs1213353292 5875 dbSNP
rs1048630408 5879 dbSNP
rs961836981 5890 dbSNP
rs1016402503 5899 dbSNP
rs187650688 5910 dbSNP
rs1006416033 5912 dbSNP
rs905346236 5913 dbSNP
rs1193928191 5926 dbSNP
rs1045374412 5930 dbSNP
rs1477287714 5932 dbSNP
rs565633038 5934 dbSNP
rs1458612329 5942 dbSNP
rs1273186381 5951 dbSNP
rs896699445 5959 dbSNP
rs552090228 5965 dbSNP
rs1052454620 5967 dbSNP
rs935305500 5977 dbSNP
rs759064963 5979 dbSNP
rs1044187666 5981 dbSNP
rs947257458 5985 dbSNP
rs1319645927 5986 dbSNP
rs1334007301 5989 dbSNP
rs200056276 5992 dbSNP
rs910384574 6009 dbSNP
rs533340758 6012 dbSNP
rs933249084 6013 dbSNP
rs923155027 6015 dbSNP
rs1237643700 6018 dbSNP
rs1041864811 6022 dbSNP
rs971771939 6024 dbSNP
rs914584958 6037 dbSNP
rs1286512907 6038 dbSNP
rs367717540 6039 dbSNP
rs1415735286 6047 dbSNP
rs767680344 6064 dbSNP
rs1469325585 6071 dbSNP
rs1377880079 6077 dbSNP
rs1016042506 6079 dbSNP
rs1455877791 6081 dbSNP
rs1177101748 6095 dbSNP
rs989394307 6099 dbSNP
rs202157522 6104 dbSNP
rs969582892 6105 dbSNP
rs549581878 6114 dbSNP
rs1013727720 6126 dbSNP
rs1015292412 6137 dbSNP
rs1444321459 6139 dbSNP
rs896747336 6142 dbSNP
rs1308170018 6144 dbSNP
rs1031652739 6146 dbSNP
rs1336119434 6157 dbSNP
rs778676186 6167 dbSNP
rs1291064257 6176 dbSNP
rs999561751 6179 dbSNP
rs1281468378 6186 dbSNP
rs375046694 6187 dbSNP
rs1354380166 6188 dbSNP
rs529810890 6189 dbSNP
rs1003951778 6192 dbSNP
rs146347904 6193 dbSNP
rs1013141812 6198 dbSNP
rs541592986 6199 dbSNP
rs1043856946 6219 dbSNP
rs1438734720 6223 dbSNP
rs184614847 6228 dbSNP
rs1057282088 6229 dbSNP
rs1003040851 6244 dbSNP
rs1164932668 6247 dbSNP
rs1419941562 6260 dbSNP
rs1302537516 6263 dbSNP
rs1242536231 6266 dbSNP
rs1434242935 6268 dbSNP
rs202243014 6273 dbSNP
rs1397007288 6278 dbSNP
rs1392886293 6293 dbSNP
rs757992580 6298 dbSNP
rs1323978182 6320 dbSNP
rs1399966054 6354 dbSNP
rs1331165481 6366 dbSNP
rs1358220339 6371 dbSNP
rs879449144 6379 dbSNP
rs1160134321 6381 dbSNP
rs1337025668 6386 dbSNP
rs1217389929 6387 dbSNP
rs117057400 6391 dbSNP
rs1340542402 6396 dbSNP
rs1393985038 6398 dbSNP
rs545727948 6399 dbSNP
rs1050236809 6400 dbSNP
rs933134284 6402 dbSNP
rs923234843 6403 dbSNP
rs562872829 6411 dbSNP
rs1259072001 6412 dbSNP
rs893111798 6412 dbSNP
rs1050869871 6413 dbSNP
rs972375941 6426 dbSNP
rs1169927439 6427 dbSNP
rs932550828 6428 dbSNP
rs576461564 6430 dbSNP
rs1247588117 6431 dbSNP
rs1192914437 6435 dbSNP
rs976675123 6438 dbSNP
rs370330824 6449 dbSNP
rs1357497932 6452 dbSNP
rs1398187930 6454 dbSNP
rs1295531822 6455 dbSNP
rs908411046 6465 dbSNP
rs940400691 6481 dbSNP
rs1217664675 6482 dbSNP
rs982474449 6486 dbSNP
rs1211212098 6488 dbSNP
rs1281982183 6489 dbSNP
rs1487040075 6495 dbSNP
rs1185379670 6497 dbSNP
rs1347181279 6501 dbSNP
rs573957268 6508 dbSNP
rs1430307571 6517 dbSNP
rs952584422 6520 dbSNP
rs908866655 6524 dbSNP
rs556544037 6530 dbSNP
rs1174536556 6536 dbSNP
rs984415610 6542 dbSNP
rs1369641776 6543 dbSNP
rs1288297482 6545 dbSNP
rs542722460 6549 dbSNP
rs1370765613 6550 dbSNP
rs574056107 6557 dbSNP
rs1350976235 6559 dbSNP
rs992345336 6567 dbSNP
rs1338192830 6571 dbSNP
rs192448780 6576 dbSNP
rs1400246932 6583 dbSNP
rs903334003 6589 dbSNP
rs1374261685 6598 dbSNP
rs1020481754 6612 dbSNP
rs1454569137 6624 dbSNP
rs1011632712 6628 dbSNP
rs893218673 6635 dbSNP
rs1050408385 6639 dbSNP
rs188071304 6647 dbSNP
rs182998149 6648 dbSNP
rs1426466374 6669 dbSNP
rs377709250 6671 dbSNP
rs1022262153 6675 dbSNP
rs1006819096 6676 dbSNP
rs1194585586 6678 dbSNP
rs889889093 6680 dbSNP
rs1051107625 6681 dbSNP
rs866846324 6682 dbSNP
rs1212323638 6684 dbSNP
rs558383725 6685 dbSNP
rs1036320024 6686 dbSNP
rs545894379 6689 dbSNP
rs1236196149 6694 dbSNP
rs940605846 6695 dbSNP
rs909096877 6696 dbSNP
rs1048772068 6697 dbSNP
rs1279868897 6700 dbSNP
rs947677787 6707 dbSNP
rs916363584 6711 dbSNP
rs958603264 6715 dbSNP
rs547402901 6718 dbSNP
rs1162807882 6719 dbSNP
rs991901065 6737 dbSNP
rs1035380900 6749 dbSNP
rs960944743 6752 dbSNP
rs372998458 6753 dbSNP
rs1328493042 6763 dbSNP
rs1353165265 6764 dbSNP
rs1377983449 6766 dbSNP
rs1300774924 6776 dbSNP
rs61777357 6778 dbSNP
rs1449552459 6779 dbSNP
rs1359270506 6780 dbSNP
rs527566223 6781 dbSNP
rs5775058 6781 dbSNP
rs1292212443 6792 dbSNP
rs549734265 6793 dbSNP
rs1235109229 6794 dbSNP
rs1306735509 6794 dbSNP
rs1362641321 6794 dbSNP
rs542012711 6794 dbSNP
rs779433120 6794 dbSNP
rs1464532932 6795 dbSNP
rs1186069863 6797 dbSNP
rs1012162020 6798 dbSNP
rs1475559868 6799 dbSNP
rs142361283 6803 dbSNP
rs567352403 6812 dbSNP
rs748648089 6815 dbSNP
rs1171488767 6817 dbSNP
rs547217634 6823 dbSNP
rs1356638883 6831 dbSNP
rs542231509 6832 dbSNP
rs527848482 6843 dbSNP
rs1355584501 6860 dbSNP
rs1416043004 6863 dbSNP
rs901831895 6866 dbSNP
rs190664687 6879 dbSNP
rs1456390360 6880 dbSNP
rs1274933130 6883 dbSNP
rs545691012 6914 dbSNP
rs1209046771 6920 dbSNP
rs1006871513 6925 dbSNP
rs954031219 6926 dbSNP
rs887031076 6930 dbSNP
rs1047016710 6932 dbSNP
rs1029734282 6933 dbSNP
rs188069921 6940 dbSNP
rs1055934097 6941 dbSNP
rs1172655725 6949 dbSNP
rs897197510 6951 dbSNP
rs937093439 6952 dbSNP
rs1307905259 6958 dbSNP
rs1375622126 6959 dbSNP
rs1436056970 6985 dbSNP
rs1444028503 6987 dbSNP
rs1344085818 6990 dbSNP
rs1403073755 6991 dbSNP
rs563076223 6993 dbSNP
rs74776187 6994 dbSNP
rs116477313 6996 dbSNP
rs1233230712 6999 dbSNP
rs1302968458 7004 dbSNP
rs1282321890 7005 dbSNP
rs1446481349 7005 dbSNP
rs200240543 7005 dbSNP
rs373308326 7005 dbSNP
rs77125170 7005 dbSNP
rs967583158 7005 dbSNP
rs1217180227 7007 dbSNP
rs1348529827 7007 dbSNP
rs536128112 7011 dbSNP
rs1452985122 7012 dbSNP
rs199985295 7012 dbSNP
rs1424625618 7014 dbSNP
rs1455359806