miRTarBase - #MIRT699909 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RUNDC1   
Synonyms -
Description RUN domain containing 1
Transcript NM_173079   
Putative miRNA Targets on RUNDC1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            || |:|| || |   :|||||| 
800 - 823 139.00 -15.50
             :|:||| |   :|||||| 
Target 5' atcGCGCCACT---GCACTCCa 3'
451 - 469 136.00 -17.50
              || ||  ||  |||:||| 
Target 5' tctcCAGCA-AGTAAACATTCCt 3'
1218 - 1239 129.00 -10.62
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30190356 3 COSMIC
COSN19703903 26 COSMIC
COSN30184370 26 COSMIC
COSN30488769 41 COSMIC
COSN30190094 69 COSMIC
COSN30503055 73 COSMIC
COSN31509848 107 COSMIC
COSN19336048 510 COSMIC
COSN18754148 876 COSMIC
COSN8836832 926 COSMIC
COSN30332363 1678 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1473576496 3 dbSNP
rs773251964 6 dbSNP
rs1325881966 8 dbSNP
rs1350119140 9 dbSNP
rs201943128 12 dbSNP
rs1280971531 14 dbSNP
rs771141494 16 dbSNP
rs1228449914 21 dbSNP
rs1490565944 26 dbSNP
rs866004705 30 dbSNP
rs776720498 33 dbSNP
rs542521733 37 dbSNP
rs368354222 38 dbSNP
rs764924991 40 dbSNP
rs116930490 43 dbSNP
rs764151999 53 dbSNP
rs76551330 55 dbSNP
rs1225992271 60 dbSNP
rs544725908 65 dbSNP
rs1287157337 72 dbSNP
rs148971671 77 dbSNP
rs533614478 81 dbSNP
rs1224988470 86 dbSNP
rs1267088330 87 dbSNP
rs1490282880 88 dbSNP
rs1435447369 105 dbSNP
rs1047878956 127 dbSNP
rs55857539 128 dbSNP
rs560629614 129 dbSNP
rs1158491596 132 dbSNP
rs1174917019 134 dbSNP
rs1427475210 141 dbSNP
rs895870657 143 dbSNP
rs1014427374 148 dbSNP
rs528009638 162 dbSNP
rs549386404 168 dbSNP
rs1463911714 172 dbSNP
rs142985946 173 dbSNP
rs1000877143 177 dbSNP
rs1325114572 178 dbSNP
rs1165050146 187 dbSNP
rs529433902 193 dbSNP
rs1218294345 202 dbSNP
rs780701582 212 dbSNP
rs1362301070 214 dbSNP
rs1033220580 221 dbSNP
rs543091773 222 dbSNP
rs1387753370 225 dbSNP
rs373428200 226 dbSNP
rs531194756 227 dbSNP
rs960323962 228 dbSNP
rs549893508 235 dbSNP
rs1414119498 242 dbSNP
rs988399772 242 dbSNP
rs571010920 250 dbSNP
rs1330878113 255 dbSNP
rs1448073152 257 dbSNP
rs1355008914 258 dbSNP
rs538304037 265 dbSNP
rs9892750 266 dbSNP
rs1483915111 268 dbSNP
rs1253734611 270 dbSNP
rs1289804818 271 dbSNP
rs1307692110 274 dbSNP
rs978842143 275 dbSNP
rs1225849371 281 dbSNP
rs926051214 282 dbSNP
rs1359034589 284 dbSNP
rs879853364 292 dbSNP
rs377702502 295 dbSNP
rs1436495228 296 dbSNP
rs913772858 303 dbSNP
rs1181719023 304 dbSNP
rs1244335226 307 dbSNP
rs1444689805 314 dbSNP
rs933286277 315 dbSNP
rs565510173 316 dbSNP
rs868085021 341 dbSNP
rs1170755319 343 dbSNP
rs1428149400 350 dbSNP
rs1184922829 356 dbSNP
rs745776650 357 dbSNP
rs929300612 361 dbSNP
rs1047723183 363 dbSNP
rs1180719188 369 dbSNP
rs895921775 380 dbSNP
rs1007302833 383 dbSNP
rs536576102 384 dbSNP
rs1037427479 392 dbSNP
rs1014727430 393 dbSNP
rs1341088958 395 dbSNP
rs1292227916 405 dbSNP
rs1247953492 414 dbSNP
rs1319832899 416 dbSNP
rs554549661 417 dbSNP
rs906063484 423 dbSNP
rs151103662 426 dbSNP
rs537849043 431 dbSNP
rs1328076146 432 dbSNP
rs1408219311 434 dbSNP
rs188431533 439 dbSNP
rs1025988902 441 dbSNP
rs578152182 442 dbSNP
rs1459785691 446 dbSNP
rs1406763377 448 dbSNP
rs545484827 449 dbSNP
rs1164696841 452 dbSNP
rs1419091513 453 dbSNP
rs1313020597 454 dbSNP
rs1023539700 455 dbSNP
rs970169272 456 dbSNP
rs1269218022 457 dbSNP
rs1272220512 460 dbSNP
rs892005756 467 dbSNP
rs1487401213 473 dbSNP
rs1337823625 476 dbSNP
rs1239703769 478 dbSNP
rs1264727121 478 dbSNP
rs978916855 479 dbSNP
rs560692552 480 dbSNP
rs1195634335 481 dbSNP
rs1264242250 483 dbSNP
rs1463075192 486 dbSNP
rs1009875901 489 dbSNP
rs1388817015 492 dbSNP
rs140940513 494 dbSNP
rs1441395129 495 dbSNP
rs112587618 497 dbSNP
rs1454756923 499 dbSNP
rs1471991596 499 dbSNP
rs879774243 499 dbSNP
rs955053209 499 dbSNP
rs77608010 500 dbSNP
rs1033016211 501 dbSNP
rs1431177751 507 dbSNP
rs1266397252 508 dbSNP
rs766532089 508 dbSNP
rs962897694 517 dbSNP
rs1266185701 520 dbSNP
rs973868931 523 dbSNP
rs1474276276 526 dbSNP
rs1328581210 527 dbSNP
rs956132256 532 dbSNP
rs543342483 533 dbSNP
rs1329634012 535 dbSNP
rs1436344417 538 dbSNP
rs1367914576 548 dbSNP
rs1319169250 549 dbSNP
rs1456188294 557 dbSNP
rs1406195111 561 dbSNP
rs1173884113 570 dbSNP
rs796369318 578 dbSNP
rs922666892 584 dbSNP
rs561415910 586 dbSNP
rs1470925585 591 dbSNP
rs987435295 592 dbSNP
rs1187862825 598 dbSNP
rs1334685699 599 dbSNP
rs531982840 601 dbSNP
rs1279417326 605 dbSNP
rs549518675 610 dbSNP
rs905911592 614 dbSNP
rs564503665 624 dbSNP
rs1229546967 625 dbSNP
rs1344764598 628 dbSNP
rs532098580 629 dbSNP
rs180796423 633 dbSNP
rs1037543423 635 dbSNP
rs1435001954 641 dbSNP
rs1054528969 643 dbSNP
rs892059364 645 dbSNP
rs1458623670 646 dbSNP
rs1010472864 652 dbSNP
rs146446897 656 dbSNP
rs898883812 658 dbSNP
rs929076558 660 dbSNP
rs1047849802 661 dbSNP
rs1006551320 664 dbSNP
rs1018448671 668 dbSNP
rs962452638 671 dbSNP
rs973923119 673 dbSNP
rs1326202481 675 dbSNP
rs1440802814 681 dbSNP
rs895509460 690 dbSNP
rs1213554022 699 dbSNP
rs1222206090 699 dbSNP
rs1025456571 706 dbSNP
rs1228184275 709 dbSNP
rs1357647526 714 dbSNP
rs185820028 715 dbSNP
rs1241899856 717 dbSNP
rs1482625551 718 dbSNP
rs1023191709 720 dbSNP
rs1339375231 723 dbSNP
rs906125724 730 dbSNP
rs1205229955 731 dbSNP
rs1411273064 734 dbSNP
rs1263356032 743 dbSNP
rs1444930991 747 dbSNP
rs1192598373 758 dbSNP
rs1415827463 759 dbSNP
rs189786 760 dbSNP
rs951183343 761 dbSNP
rs992101155 765 dbSNP
rs1204830975 768 dbSNP
rs917831780 768 dbSNP
rs776263536 769 dbSNP
rs528440293 773 dbSNP
rs1292571192 775 dbSNP
rs117577073 778 dbSNP
rs1454328376 779 dbSNP
rs1229748622 780 dbSNP
rs1287359736 782 dbSNP
rs1436852776 787 dbSNP
rs1030063450 791 dbSNP
rs569856056 794 dbSNP
rs955373784 798 dbSNP
rs985883680 800 dbSNP
rs1404694366 808 dbSNP
rs2667943 815 dbSNP
rs1399641316 818 dbSNP
rs1159976932 822 dbSNP
rs1304041483 825 dbSNP
rs1347769948 837 dbSNP
rs927386560 838 dbSNP
rs1403532547 840 dbSNP
rs1301160111 849 dbSNP
rs1318080695 852 dbSNP
rs1210012162 853 dbSNP
rs1219435894 853 dbSNP
rs1267033544 853 dbSNP
rs1269345592 853 dbSNP
rs1272829916 853 dbSNP
rs1322468151 853 dbSNP
rs1326467993 853 dbSNP
rs1365779887 853 dbSNP
rs1369370918 853 dbSNP
rs1428772285 853 dbSNP
rs1435563910 853 dbSNP
rs1458833468 853 dbSNP
rs578105215 853 dbSNP
rs1386523758 854 dbSNP
rs1158556295 856 dbSNP
rs1239059179 866 dbSNP
rs1415224855 869 dbSNP
rs1427585346 872 dbSNP
rs1261989116 873 dbSNP
rs1348000432 874 dbSNP
rs1189794254 875 dbSNP
rs1191069002 875 dbSNP
rs1215440080 875 dbSNP
rs943277017 875 dbSNP
rs1246880821 876 dbSNP
rs370572471 876 dbSNP
rs201072724 877 dbSNP
rs1313569613 878 dbSNP
rs973226681 879 dbSNP
rs920467385 880 dbSNP
rs1299618458 881 dbSNP
rs1054455690 883 dbSNP
rs946216793 884 dbSNP
rs556613702 895 dbSNP
rs1169462984 897 dbSNP
rs1448874949 901 dbSNP
rs929031850 910 dbSNP
rs1051817605 912 dbSNP
rs578052586 919 dbSNP
rs1362119690 928 dbSNP
rs539166346 935 dbSNP
rs867304149 937 dbSNP
rs1170948859 939 dbSNP
rs1006970423 941 dbSNP
rs1261703289 942 dbSNP
rs111518806 950 dbSNP
rs1039351092 961 dbSNP
rs1164417857 969 dbSNP
rs188773171 981 dbSNP
rs1209684587 985 dbSNP
rs1483215821 992 dbSNP
rs1276471770 995 dbSNP
rs995285771 996 dbSNP
rs949705022 998 dbSNP
rs1313388030 1004 dbSNP
rs141682294 1009 dbSNP
rs1025381642 1011 dbSNP
rs1301230588 1011 dbSNP
rs1381450359 1011 dbSNP
rs951226119 1011 dbSNP
rs1013389326 1013 dbSNP
rs1428249498 1022 dbSNP
rs1025311918 1023 dbSNP
rs1293313732 1027 dbSNP
rs1044046310 1029 dbSNP
rs1426132107 1030 dbSNP
rs1410984709 1031 dbSNP
rs1393634470 1036 dbSNP
rs1305583810 1038 dbSNP
rs1186650509 1052 dbSNP
rs1472699880 1070 dbSNP
rs1253549496 1073 dbSNP
rs980522524 1079 dbSNP
rs1480189776 1085 dbSNP
rs147053600 1088 dbSNP
rs1223657484 1090 dbSNP
rs561490761 1101 dbSNP
rs1238862790 1102 dbSNP
rs1232806825 1103 dbSNP
rs957349139 1106 dbSNP
rs990232377 1107 dbSNP
rs1408321135 1117 dbSNP
rs1396203275 1118 dbSNP
rs1000443307 1122 dbSNP
rs554739804 1132 dbSNP
rs551396470 1139 dbSNP
rs1459868535 1152 dbSNP
rs1348693507 1153 dbSNP
rs545133500 1153 dbSNP
rs692237 1160 dbSNP
rs946227944 1161 dbSNP
rs1264650167 1167 dbSNP
rs891992707 1171 dbSNP
rs1267786906 1175 dbSNP
rs1010834813 1193 dbSNP
rs543678669 1197 dbSNP
rs1487453003 1203 dbSNP
rs768972613 1203 dbSNP
rs764629162 1207 dbSNP
rs1213106346 1208 dbSNP
rs752146586 1209 dbSNP
rs955646944 1212 dbSNP
rs1006860112 1219 dbSNP
rs564567338 1222 dbSNP
rs912824757 1225 dbSNP
rs567977487 1234 dbSNP
rs964622514 1238 dbSNP
rs531965327 1241 dbSNP
rs1388906358 1245 dbSNP
rs550188103 1245 dbSNP
rs1325828108 1249 dbSNP
rs768015202 1256 dbSNP
rs1457255878 1257 dbSNP
rs1390186706 1261 dbSNP
rs1387243005 1266 dbSNP
rs1452566578 1269 dbSNP
rs1377894860 1279 dbSNP
rs547130518 1283 dbSNP
rs1431261995 1284 dbSNP
rs1164421867 1285 dbSNP
rs995170925 1290 dbSNP
rs973342939 1291 dbSNP
rs886817422 1294 dbSNP
rs1203519025 1299 dbSNP
rs1013853465 1301 dbSNP
rs1256840686 1311 dbSNP
rs753122429 1314 dbSNP
rs1463890941 1321 dbSNP
rs368088390 1323 dbSNP
rs1400247802 1324 dbSNP
rs1368023846 1325 dbSNP
rs1315589182 1326 dbSNP
rs138047102 1327 dbSNP
rs548094311 1328 dbSNP
rs1304235730 1330 dbSNP
rs569798228 1334 dbSNP
rs1394243558 1336 dbSNP
rs1169026131 1346 dbSNP
rs1451227825 1347 dbSNP
rs1191060845 1351 dbSNP
rs536969280 1353 dbSNP
rs1446503122 1355 dbSNP
rs1226243068 1358 dbSNP
rs1311649482 1359 dbSNP
rs1257050958 1361 dbSNP
rs181158419 1365 dbSNP
rs957403157 1372 dbSNP
rs1307827629 1377 dbSNP
rs1229400889 1381 dbSNP
rs990076463 1386 dbSNP
rs1268967465 1390 dbSNP
rs751019123 1390 dbSNP
rs1225980129 1395 dbSNP
rs149498383 1402 dbSNP
rs748408452 1422 dbSNP
rs936244329 1428 dbSNP
rs1412499469 1434 dbSNP
rs1374521360 1441 dbSNP
rs1308353075 1453 dbSNP
rs1204321643 1454 dbSNP
rs1054608437 1461 dbSNP
rs1245031613 1462 dbSNP
rs1460091469 1464 dbSNP
rs967411603 1467 dbSNP
rs1167274915 1470 dbSNP
rs1420558713 1473 dbSNP
rs377760386 1478 dbSNP
rs1189755938 1479 dbSNP
rs539027327 1481 dbSNP
rs187015312 1489 dbSNP
rs912761998 1495 dbSNP
rs1484245274 1496 dbSNP
rs1271435529 1504 dbSNP
rs1195722965 1507 dbSNP
rs1423443192 1511 dbSNP
rs1010365783 1514 dbSNP
rs1339335948 1519 dbSNP
rs191397823 1533 dbSNP
rs920139913 1534 dbSNP
rs1407647742 1539 dbSNP
rs184243517 1544 dbSNP
rs554884015 1557 dbSNP
rs886867975 1559 dbSNP
rs491519 1564 dbSNP
rs761187525 1567 dbSNP
rs905063548 1571 dbSNP
rs1459972158 1578 dbSNP
rs1317133822 1592 dbSNP
rs1417340598 1597 dbSNP
rs1018272544 1599 dbSNP
rs962735443 1600 dbSNP
rs1183182101 1605 dbSNP
rs1224045177 1605 dbSNP
rs1473730802 1606 dbSNP
rs866865817 1607 dbSNP
rs995522974 1639 dbSNP
rs1181596555 1640 dbSNP
rs1292677635 1643 dbSNP
rs1211202716 1644 dbSNP
rs1310498710 1646 dbSNP
rs1032229309 1648 dbSNP
rs1268275070 1650 dbSNP
rs144154500 1654 dbSNP
rs950698096 1656 dbSNP
rs983294644 1660 dbSNP
rs917108209 1663 dbSNP
rs1370777367 1666 dbSNP
rs1011550839 1668 dbSNP
rs1486972673 1669 dbSNP
rs1332718515 1670 dbSNP
rs1323813549 1675 dbSNP
rs971151763 1677 dbSNP
rs374502540 1680 dbSNP
rs1020214360 1691 dbSNP
rs1262901107 1704 dbSNP
rs1043281 1705 dbSNP
rs777051152 1707 dbSNP
rs986930434 1711 dbSNP
rs1248901505 1712 dbSNP
rs1192292319 1717 dbSNP
rs1468477722 1720 dbSNP
rs1179169257 1731 dbSNP
rs72826999 1738 dbSNP
rs1412217645 1739 dbSNP
rs1314714065 1745 dbSNP
rs935645952 1746 dbSNP
rs1174781955 1748 dbSNP
rs1283158659 1750 dbSNP
rs964280124 1751 dbSNP
rs1346880514 1752 dbSNP
rs1345356322 1764 dbSNP
rs975537608 1769 dbSNP
rs1432445719 1773 dbSNP
rs778204700 1783 dbSNP
rs576475552 1785 dbSNP
rs1043284 1795 dbSNP
rs1321241882 1805 dbSNP
rs1432990277 1809 dbSNP
rs913450991 1810 dbSNP
rs1317936614 1812 dbSNP
rs946327279 1814 dbSNP
rs186221579 1818 dbSNP
rs1405386830 1820 dbSNP
rs1172237258 1821 dbSNP
rs1285066035 1829 dbSNP
rs1365449050 1835 dbSNP
rs983016502 1836 dbSNP
rs908230526 1838 dbSNP
rs529769001 1840 dbSNP
rs1241108192 1844 dbSNP
rs1210356466 1845 dbSNP
rs949070072 1847 dbSNP
rs891313775 1850 dbSNP
rs1318869004 1856 dbSNP
rs1342708686 1857 dbSNP
rs1006969088 1858 dbSNP
rs1214716382 1875 dbSNP
rs691988 1898 dbSNP
rs691987 1902 dbSNP
rs1490608718 1925 dbSNP
rs1269716858 1932 dbSNP
rs1449026479 1934 dbSNP
rs904907717 1940 dbSNP
rs937862911 1942 dbSNP
rs1371668808 1951 dbSNP
rs1202068513 1953 dbSNP
rs1427308191 1960 dbSNP
rs1053527516 1961 dbSNP
rs898581750 1962 dbSNP
rs995470501 1963 dbSNP
rs1020811815 1965 dbSNP
rs1026099094 1967 dbSNP
rs1483275235 1975 dbSNP
rs1252907797 1978 dbSNP
rs761483690 1979 dbSNP
rs1008638750 1981 dbSNP
rs1477990738 1981 dbSNP
rs1228977066 1983 dbSNP
rs1357532741 1984 dbSNP
rs1019696823 1986 dbSNP
rs1414496436 1995 dbSNP
rs1351462082 1996 dbSNP
rs1005230551 1999 dbSNP
rs766982332 2000 dbSNP
rs1401980607 2001 dbSNP
rs971608710 2004 dbSNP
rs1462595057 2006 dbSNP
rs1415151844 2022 dbSNP
rs1156437662 2026 dbSNP
rs1186758919 2032 dbSNP
rs1472739034 2043 dbSNP
rs1359526770 2051 dbSNP
rs189852925 2061 dbSNP
rs1034021558 2064 dbSNP
rs957127806 2065 dbSNP
rs866717888 2066 dbSNP
rs148284237 2081 dbSNP
rs1214356735 2084 dbSNP
rs1347985644 2093 dbSNP
rs118132267 2094 dbSNP
rs182270488 2099 dbSNP
rs946304024 2104 dbSNP
rs576331157 2105 dbSNP
rs926412767 2106 dbSNP
rs1390038843 2107 dbSNP
rs937729111 2110 dbSNP
rs1294657189 2112 dbSNP
rs115164803 2115 dbSNP
rs1391615079 2118 dbSNP
rs1163668322 2128 dbSNP
rs1457432128 2132 dbSNP
rs553859472 2152 dbSNP
rs915102631 2152 dbSNP
rs1308735707 2153 dbSNP
rs1042322051 2157 dbSNP
rs1360476004 2160 dbSNP
rs1251208973 2167 dbSNP
rs1467113657 2167 dbSNP
rs912828800 2170 dbSNP
rs890337725 2172 dbSNP
rs1008245185 2175 dbSNP
rs942804569 2176 dbSNP
rs1041413511 2179 dbSNP
rs1316678045 2180 dbSNP
rs1288151675 2190 dbSNP
rs1237139400 2191 dbSNP
rs1369506006 2196 dbSNP
rs1039901664 2205 dbSNP
rs1205801321 2206 dbSNP
rs1386629847 2220 dbSNP
rs1235151939 2226 dbSNP
rs1440950735 2230 dbSNP
rs996955569 2231 dbSNP
rs1377957512 2235 dbSNP
rs691952 2239 dbSNP
rs566035596 2243 dbSNP
rs553006442 2247 dbSNP
rs202227460 2248 dbSNP
rs779919820 2252 dbSNP
rs1193009384 2264 dbSNP
rs1429227118 2275 dbSNP
rs1444882874 2280 dbSNP
rs519009 2286 dbSNP
rs8076539 2289 dbSNP
rs1013600344 2290 dbSNP
rs1281479694 2293 dbSNP
rs1024619068 2301 dbSNP
rs971364892 2302 dbSNP
rs570193634 2306 dbSNP
rs1329427121 2307 dbSNP
rs907132399 2312 dbSNP
rs1001289871 2314 dbSNP
rs537244735 2317 dbSNP
rs926311313 2319 dbSNP
rs186541513 2326 dbSNP
rs372821242 2327 dbSNP
rs554507161 2327 dbSNP
rs957116664 2333 dbSNP
rs1314419533 2336 dbSNP
rs990332021 2344 dbSNP
rs1374726969 2345 dbSNP
rs778887137 2349 dbSNP
rs1275669718 2354 dbSNP
rs1374863213 2355 dbSNP
rs1456825797 2360 dbSNP
rs967422337 2370 dbSNP
rs1191198382 2378 dbSNP
rs914986474 2379 dbSNP
rs1258494584 2381 dbSNP
rs945222154 2383 dbSNP
rs1042589163 2385 dbSNP
rs1280128669 2390 dbSNP
rs1196855244 2392 dbSNP
rs1342162975 2402 dbSNP
rs1249099218 2403 dbSNP
rs1226071460 2421 dbSNP
rs748318431 2422 dbSNP
rs1237023237 2423 dbSNP
rs912770871 2437 dbSNP
rs1261084120 2443 dbSNP
rs1461434267 2459 dbSNP
rs911825003 2463 dbSNP
rs1366406939 2469 dbSNP
rs944647251 2473 dbSNP
rs1038930663 2474 dbSNP
rs1394266695 2481 dbSNP
rs1166167209 2486 dbSNP
rs899869979 2490 dbSNP
rs1418787016 2496 dbSNP
rs1472316499 2498 dbSNP
rs1474372289 2503 dbSNP
rs577129973 2510 dbSNP
rs1183058134 2511 dbSNP
rs693538 2513 dbSNP
rs115371438 2516 dbSNP
rs1016149643 2520 dbSNP
rs144049207 2521 dbSNP
rs541597414 2526 dbSNP
rs1333778753 2553 dbSNP
rs1279863499 2556 dbSNP
rs1406880763 2562 dbSNP
rs970908217 2565 dbSNP
rs1328127383 2567 dbSNP
rs1441610947 2568 dbSNP
rs58940482 2569 dbSNP
rs1047556999 2573 dbSNP
rs1004226736 2574 dbSNP
rs1460059016 2578 dbSNP
rs563388378 2581 dbSNP
rs1340127868 2585 dbSNP
rs747126629 2586 dbSNP
rs543666652 2590 dbSNP
rs879714585 2602 dbSNP
rs75073872 2610 dbSNP
rs1001429904 2624 dbSNP
rs1211297147 2627 dbSNP
rs1022005078 2631 dbSNP
rs558257147 2633 dbSNP
rs1225210691 2640 dbSNP
rs1264353779 2642 dbSNP
rs1278778568 2646 dbSNP
rs1234924784 2653 dbSNP
rs1373172115 2658 dbSNP
rs1327940108 2662 dbSNP
rs893004159 2665 dbSNP
rs9911808 2668 dbSNP
rs1020411840 2670 dbSNP
rs1383260342 2679 dbSNP
rs117390055 2683 dbSNP
rs1008297611 2693 dbSNP
rs1397437613 2695 dbSNP
rs1191164337 2703 dbSNP
rs1441492428 2706 dbSNP
rs1453294309 2707 dbSNP
rs1019315680 2718 dbSNP
rs369347525 2720 dbSNP
rs921812073 2725 dbSNP
rs964288610 2726 dbSNP
rs1169844215 2727 dbSNP
rs1429932838 2733 dbSNP
rs975697718 2742 dbSNP
rs932640459 2750 dbSNP
rs1467611821 2760 dbSNP
rs2670850 2764 dbSNP
rs1401691330 2775 dbSNP
rs888545757 2776 dbSNP
rs565972717 2777 dbSNP
rs1270883878 2778 dbSNP
rs1300360139 2778 dbSNP
rs1338864940 2779 dbSNP
rs1399839039 2781 dbSNP
rs775835635 2790 dbSNP
rs1297903430 2798 dbSNP
rs761393653 2798 dbSNP
rs1284436059 2802 dbSNP
rs1347972929 2816 dbSNP
rs1234701116 2821 dbSNP
rs940116025 2825 dbSNP
rs1419604939 2829 dbSNP
rs1037100670 2838 dbSNP
rs530095148 2839 dbSNP
rs1262024803 2843 dbSNP
rs1188337618 2849 dbSNP
rs1003709185 2850 dbSNP
rs1486540125 2858 dbSNP
rs1343745047 2863 dbSNP
rs1210029357 2868 dbSNP
rs982989087 2870 dbSNP
rs1205321626 2874 dbSNP
rs746874644 2895 dbSNP
rs1034358055 2897 dbSNP
rs1216411946 2907 dbSNP
rs1487157153 2912 dbSNP
rs908591847 2930 dbSNP
rs949524639 2936 dbSNP
rs1010539916 2937 dbSNP
rs548441193 2939 dbSNP
rs749942023 2940 dbSNP
rs1215410745 2941 dbSNP
rs1196739063 2943 dbSNP
rs1377131784 2944 dbSNP
rs1171823086 2947 dbSNP
rs1470578941 2951 dbSNP
rs570136682 2955 dbSNP
rs1165163954 2957 dbSNP
rs1055601500 2975 dbSNP
rs190136524 2977 dbSNP
rs1419442879 2981 dbSNP
rs893054990 2984 dbSNP
rs1304137963 2985 dbSNP
rs1480881199 2988 dbSNP
rs1393442392 2992 dbSNP
rs966278227 2992 dbSNP
rs1206659674 3005 dbSNP
rs552369893 3006 dbSNP
rs570685220 3008 dbSNP
rs1316121937 3009 dbSNP
rs1257551469 3018 dbSNP
rs1011798685 3021 dbSNP
rs974562898 3030 dbSNP
rs1337295427 3033 dbSNP
rs1291755617 3036 dbSNP
rs544105210 3037 dbSNP
rs1395813362 3044 dbSNP
rs1041583374 3045 dbSNP
rs1301265077 3046 dbSNP
rs1374638164 3049 dbSNP
rs1329978484 3051 dbSNP
rs535013947 3052 dbSNP
rs1008017944 3053 dbSNP
rs984693063 3054 dbSNP
rs909909109 3055 dbSNP
rs1019284414 3056 dbSNP
rs1415219938 3062 dbSNP
rs963674849 3067 dbSNP
rs1163763940 3073 dbSNP
rs996517519 3076 dbSNP
rs1027217248 3078 dbSNP
rs953004634 3080 dbSNP
rs1037558598 3088 dbSNP
rs323508 3089 dbSNP
rs1298430177 3102 dbSNP
rs1469936042 3103 dbSNP
rs1215548928 3108 dbSNP
rs1244456480 3111 dbSNP
rs939520049 3125 dbSNP
rs908733051 3130 dbSNP
rs1222558000 3137 dbSNP
rs971216349 3138 dbSNP
rs982193605 3144 dbSNP
rs574392525 3145 dbSNP
rs1303416358 3147 dbSNP
rs1442508395 3157 dbSNP
rs535432353 3159 dbSNP
rs1292565072 3170 dbSNP
rs926715970 3171 dbSNP
rs150528280 3175 dbSNP
rs1053730525 3176 dbSNP
rs1266652009 3182 dbSNP
rs1055199275 3188 dbSNP
rs1438422340 3191 dbSNP
rs139361376 3195 dbSNP
rs752529892 3199 dbSNP
rs1378630435 3202 dbSNP
rs150025473 3209 dbSNP
rs1265413749 3211 dbSNP
rs1209429624 3212 dbSNP
rs1041941067 3216 dbSNP
rs564300604 3217 dbSNP
rs145339499 3224 dbSNP
rs943878005 3225 dbSNP
rs1040778947 3231 dbSNP
rs1304845125 3236 dbSNP
rs999165683 3242 dbSNP
rs1328817212 3243 dbSNP
rs1293406016 3245 dbSNP
rs899603261 3247 dbSNP
rs35349841 3248 dbSNP
rs796074463 3248 dbSNP
rs201535701 3249 dbSNP
rs200596856 3250 dbSNP
rs1363656080 3257 dbSNP
rs1286833697 3262 dbSNP
rs540198882 3263 dbSNP
rs996486366 3268 dbSNP
rs1026680347 3270 dbSNP
rs888677347 3271 dbSNP
rs1175414229 3274 dbSNP
rs1375990750 3277 dbSNP
rs1198317430 3278 dbSNP
rs754973630 3308 dbSNP
rs1191898997 3321 dbSNP
rs562011508 3322 dbSNP
rs1281548927 3323 dbSNP
rs778793357 3333 dbSNP
rs1213640174 3335 dbSNP
rs1016168990 3339 dbSNP
rs1374088565 3349 dbSNP
rs970885294 3350 dbSNP
rs1308851137 3371 dbSNP
rs982246043 3373 dbSNP
rs1399064935 3374 dbSNP
rs752597490 3377 dbSNP
rs116046045 3382 dbSNP
rs1264758194 3383 dbSNP
rs989424956 3392 dbSNP
rs1172033429 3394 dbSNP
rs984745418 3398 dbSNP
rs1491349472 3399 dbSNP
rs201247376 3400 dbSNP
rs373667913 3400 dbSNP
rs71663516 3400 dbSNP
rs199739107 3401 dbSNP
rs146896625 3402 dbSNP
rs201305273 3403 dbSNP
rs55724020 3404 dbSNP
rs1168759672 3405 dbSNP
rs961685747 3411 dbSNP
rs1258640183 3413 dbSNP
rs780254605 3417 dbSNP
rs1190531339 3418 dbSNP
rs1200545147 3426 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             |::|||||   :|||||| 
Target 5' aucAUGCCAUU---GCACUCCa 3'
4 - 22
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000361677.1 | 3UTR | AAGAUCAUGCCAUUGCACUCCAGCCUGGGCAACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*