miRTarBase - #MIRT693890 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C3orf62   
Synonyms -
Description chromosome 3 open reading frame 62
Transcript NM_198562   
Expression
Putative miRNA Targets on C3orf62
3'UTR of C3orf62
(miRNA target sites are highlighted)
>C3orf62|NM_198562|3'UTR
   1 GGACAGTTATCTAAGCTTTGATTCCTTACAGCAGGAGGCTGCCCTTGAGCCTGAGCAGAAGCAGCTACAATGGCCGTCAG
  81 GGGCCACATTTCTCAAAAGGTTGGCAGAACCTGAATTACCAGACCCTTTTTAAATCCCAGTTGTGTCCCTTTTTAAGCTG
 161 TGAGACCAGTTTTTTGAATTCCATTGCTTTGAAATGTTTCCTATTACTGATTTTTTTTTTTAACTTTCCTTGACATCTTG
 241 AATGTGTTTTTTTGATTGATGTTCAATATACCCAGTACCCATGGTAGGTGTGGGTCATGGGCCTCTGCTGTGTCTCTTAG
 321 TGTTCTTTTCCACGGGCCCCTAAAAAAGTACAGGAGTGGCCAGGCACAGTGGCTCACGTCTGTAATCCCAGCACTTTGGG
 401 AGGCCAAGGCGAGTGGATCACTTGAGGTTAGGAGTTTGAGACCAGCCTGGCCAACATGGCGAAACCCCATCTCCACTAAA
 481 AATACAAAAATTAGCCAGGAGTGGTGGTGTGCACCTGTAGTCCCAGCTACTTTGGAGGCTGAGGTAGGAGAATTGCTTGA
 561 ACCTGGAGGCGGAGGTTGCAATGAGCCGAGATGGCACCGCTCCCCTCCATCCTGAGTGACAGAGCAAGACTCTGTCTCAA
 641 AAAAATAATAATTTAGCTGGTCATGGTGGTTCGTGCCTGTAGTTCCAGCTACTTGGGTAGGGACTGAGGCGAAAGGATCA
 721 CTTGAGGCCAGGAGGCAGAGATTGCAGTGAGCTGAGATCACGCCACTGCACTCCAGCATGAGTGACAGAGTGAGACCCTG
 801 TCTCAAAAAAAAAAAGAAAAAAAAAGGGAAGAAAGGAAACTGAATCTCAGGGAAGTGCCCACCTCCTGAGCTAATAAGAG
 881 GAAGGAATATGGGGGTGAGGCAGAGCTGGCAAAAGGCTGTTTTTTGTTTTGATTGTTTTTAAAGACCAAGTGAAGTATAG
 961 TATAAGAAGTGGGGAAGGAGTGGAACAAGGAGTTAGATCTGTAACTGTGAGTAGTCAATTGAGATAACTCAATACCTTTG
1041 GACCTGATTGTTTTTAAAGACTGAGGGTAGTATAAGAAGAGGGGAAGGAGTAGAACAAGGAGTTAGATCTGAAACTGTGA
1121 GTAGTCGATTGAGATAACTCACTACCTTTGGACCAGCCAGGGCTGTTTATAAGTGCTAAAGCCCGAACAAACCAAAGAGT
1201 TGGGGAGAAAGGCCTAACTAACAGCTGAGTGATTGTCTAACAGACTGTCTTTTAGGCCAGTGACTCTGGCATAGGGCAGG
1281 CTGCATAGCCAGCAACATCCCTTACCACAGGTCTAGTGATTCCTCTGGGCTCAAATGTGGAGGCTACACACCCACTCCTT
1361 AGCAGAGGTTGGCCTGGCACCTGCTGGTGCCCCAAGAACTATGGCATGGTTAGACCCTGGCCACTTGATTGCATGTGCCT
1441 CCCCAGTGGGCGTGCCCTGGTTCCCAACCAGTTGTGGCCACTGCCACTGCCCTGCCTGGGGCAGGAGTTGAGGTTAAGGC
1521 TAACTACAGGCTCCTTCCAGGCCACCTACCACTCAGACCCTGCAGGAGGTAGCACAAAGCATTCACAGCCTGTGGAGTCA
1601 GAGGCCAATTTCTTCTCCCTGAGCAAGAAGAATGGAAGCAAATGAAAAGTGCTCACAGTATGCTCAACTGCCCCTGCTCA
1681 GGTGAAGAATAGCCTGTCTGGATGGAGAGATGTCAGGCTACTTGATACTCAGAAAAACAGGTCTCAAAACAGTGCCTTCC
1761 AAATAATACATGTGGATGTGGACACTCTTCTATAGACGAGGTGGAGCTTAATTCCTGTCCTTACCCCCATATTCCCACCT
1841 CATTACCACCCTTTGAAGGTGAACTAGACTTAATGATACTTCCCACGACTAAAGTAGGGAAAGGGAAAAGTCACAAACTT
1921 ATAGTGGGGAAGCCTGGCAGACACCTAACCAAGTGATGTCATGTATATGTCATGAGAGGGGTGCATCACTTCCCTGGTAT
2001 TCCTACCAAAAACCCAAATTCCCAGTGTATGATCTTGAGACAAATGTTAGACAAATCCAGACGTGGGGTACATTCTACAA
2081 GATACCTGGCCAGAACTCAAGACTGTTGAGATGGCCGGGTGCAGTGGCTCATGCCTATAATCCCCGACACTTTGGGAGGC
2161 TGAGGCGGGCAGATCACTTGAGGTCAGAAGTTCGAGACCAGCCTGGCAAACATGGTGAAACCCCATCTCTGCTAAAAATA
2241 CAAAAATTAGCCAGGCATCATGGCATGTGCCTTTAGTCATAGCTACACAGGAGGCTGAGGCAGGAGAATTGCTTGAACCC
2321 AGGAGGTGGAGGTTGCAGTGAGCCAAGATCGCATCACTGCACTCCAGCCTGGGCAACAAGCAAGACTCCACCTCAAAAAG
2401 AAAAAAAAAGACTGTTGAGGTCATGAAAAATAAGGAAAGACTCAAAAACTATCAACAGACCACTAAAGACCAAGAAGACA
2481 CAATGGCTAAATGCAACATGGAATCCTGGAGTGCATCCTGGAAGAGAAAGAGAACATTATTGGAAAAACTGATAAAACTT
2561 GAATAAAAACTAGTGTTTAATGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:||| |   :|||||| 
Target 5' atcACGCCACT---GCACTCCa 3'
757 - 775 140.00 -18.10
2
miRNA  3' guUUGUG-GUA---ACA-GUGUGAGGu 5'
            ||:|| ::|   |||  ||||||: 
Target 5' atAATACATGTGGATGTGGACACTCTt 3'
1763 - 1789 136.00 -10.00
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||:|| |   :|||||| 
Target 5' atcGCATCACT---GCACTCCa 3'
2348 - 2366 136.00 -15.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30501221 73 COSMIC
COSN30452511 76 COSMIC
COSN30180183 118 COSMIC
COSN14070235 127 COSMIC
COSN15997546 141 COSMIC
COSN17294857 181 COSMIC
COSN27202072 211 COSMIC
COSN6769446 334 COSMIC
COSN17183729 408 COSMIC
COSN25662660 484 COSMIC
COSN22981883 711 COSMIC
COSN30442643 1690 COSMIC
COSN1278012 1766 COSMIC
COSN28893049 1981 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768758168 1 dbSNP
rs1303321996 6 dbSNP
rs760509674 8 dbSNP
rs775374041 11 dbSNP
rs552018660 12 dbSNP
rs746104541 24 dbSNP
rs377448076 28 dbSNP
rs770983130 29 dbSNP
rs749419668 31 dbSNP
rs1257338626 35 dbSNP
rs539474343 38 dbSNP
rs1479931536 44 dbSNP
rs756638064 46 dbSNP
rs1322274571 56 dbSNP
rs868362670 58 dbSNP
rs1204360632 70 dbSNP
rs1442715196 73 dbSNP
rs1007386943 75 dbSNP
rs914889789 76 dbSNP
rs889061736 85 dbSNP
rs754873789 86 dbSNP
rs536809501 88 dbSNP
rs923810982 98 dbSNP
rs981929829 99 dbSNP
rs971229294 103 dbSNP
rs1241944774 117 dbSNP
rs1403197955 124 dbSNP
rs765426839 125 dbSNP
rs1023692104 134 dbSNP
rs1320796191 138 dbSNP
rs551129883 144 dbSNP
rs1410954749 160 dbSNP
rs1041362660 164 dbSNP
rs1303101927 166 dbSNP
rs1329960333 167 dbSNP
rs529397636 176 dbSNP
rs757483526 176 dbSNP
rs1026934375 183 dbSNP
rs994417260 202 dbSNP
rs897365680 221 dbSNP
rs1008364578 222 dbSNP
rs1041616473 222 dbSNP
rs1307292117 223 dbSNP
rs1229809399 224 dbSNP
rs1349022958 240 dbSNP
rs890218316 246 dbSNP
rs1378351782 254 dbSNP
rs1475192279 254 dbSNP
rs561115619 255 dbSNP
rs914314379 258 dbSNP
rs931704609 259 dbSNP
rs1457454869 261 dbSNP
rs893512718 261 dbSNP
rs1345818997 266 dbSNP
rs1054390956 268 dbSNP
rs938173950 271 dbSNP
rs1161557120 284 dbSNP
rs926759847 299 dbSNP
rs1433873683 300 dbSNP
rs548912831 316 dbSNP
rs1409552064 331 dbSNP
rs982398711 333 dbSNP
rs527446074 334 dbSNP
rs1228884277 335 dbSNP
rs1264701800 352 dbSNP
rs923848550 356 dbSNP
rs1269346000 364 dbSNP
rs982367079 370 dbSNP
rs919263353 376 dbSNP
rs754166845 377 dbSNP
rs963466432 378 dbSNP
rs1186864623 382 dbSNP
rs1250136261 391 dbSNP
rs1450411383 392 dbSNP
rs560208865 394 dbSNP
rs1163322847 411 dbSNP
rs1260733421 415 dbSNP
rs916382877 440 dbSNP
rs990893811 443 dbSNP
rs952795315 448 dbSNP
rs1016290696 456 dbSNP
rs1456254980 458 dbSNP
rs1318055697 460 dbSNP
rs986395012 461 dbSNP
rs1224474826 463 dbSNP
rs953259126 465 dbSNP
rs1030552569 466 dbSNP
rs1299854294 476 dbSNP
rs997442420 479 dbSNP
rs545266548 498 dbSNP
rs972673796 511 dbSNP
rs1265990465 519 dbSNP
rs903097465 530 dbSNP
rs1362763029 533 dbSNP
rs1328487493 544 dbSNP
rs1206914652 545 dbSNP
rs1019994484 550 dbSNP
rs1465510177 555 dbSNP
rs961941421 556 dbSNP
rs1011233177 557 dbSNP
rs1425947461 563 dbSNP
rs577250090 568 dbSNP
rs1363744890 569 dbSNP
rs185733885 570 dbSNP
rs543948087 571 dbSNP
rs1390259477 575 dbSNP
rs1457425774 578 dbSNP
rs112370052 581 dbSNP
rs905367842 587 dbSNP
rs555401706 588 dbSNP
rs534146492 591 dbSNP
rs573358669 598 dbSNP
rs1313266244 599 dbSNP
rs144694808 603 dbSNP
rs919502523 604 dbSNP
rs141330633 607 dbSNP
rs1290255740 613 dbSNP
rs1329981730 636 dbSNP
rs566276166 646 dbSNP
rs1432470000 653 dbSNP
rs1261891828 662 dbSNP
rs1254515815 664 dbSNP
rs893522906 672 dbSNP
rs146603295 673 dbSNP
rs368066415 679 dbSNP
rs1251634197 683 dbSNP
rs1463301809 688 dbSNP
rs1471881025 702 dbSNP
rs1267079193 710 dbSNP
rs934984701 711 dbSNP
rs1472652523 716 dbSNP
rs180688401 717 dbSNP
rs1375582953 740 dbSNP
rs11130187 741 dbSNP
rs1369761119 749 dbSNP
rs953555108 761 dbSNP
rs1254567402 762 dbSNP
rs1407897956 767 dbSNP
rs916454006 769 dbSNP
rs1351136123 778 dbSNP
rs1030201241 788 dbSNP
rs1233229177 796 dbSNP
rs1327522800 804 dbSNP
rs1207874470 816 dbSNP
rs1234293845 816 dbSNP
rs1314160080 816 dbSNP
rs1482294088 816 dbSNP
rs879389086 816 dbSNP
rs1299964920 819 dbSNP
rs1264731211 826 dbSNP
rs551648533 826 dbSNP
rs771064466 826 dbSNP
rs990573077 826 dbSNP
rs1173932806 828 dbSNP
rs188480367 843 dbSNP
rs967315631 847 dbSNP
rs1020194027 852 dbSNP
rs547041582 856 dbSNP
rs973160745 892 dbSNP
rs751734752 894 dbSNP
rs892819241 898 dbSNP
rs1486110747 901 dbSNP
rs1170336340 909 dbSNP
rs1364484811 915 dbSNP
rs1371075144 920 dbSNP
rs1034395875 926 dbSNP
rs1435757220 927 dbSNP
rs1291828569 930 dbSNP
rs1020018370 936 dbSNP
rs987103133 955 dbSNP
rs954441092 956 dbSNP
rs1204507619 958 dbSNP
rs1028499775 960 dbSNP
rs1397938456 963 dbSNP
rs1011720430 970 dbSNP
rs527518719 982 dbSNP
rs1220054072 992 dbSNP
rs1244450792 992 dbSNP
rs1489187144 995 dbSNP
rs1193835733 998 dbSNP
rs768013000 1002 dbSNP
rs759984571 1007 dbSNP
rs1465545562 1008 dbSNP
rs1190268175 1010 dbSNP
rs773812309 1017 dbSNP
rs893574785 1018 dbSNP
rs1169997096 1032 dbSNP
rs1351651229 1033 dbSNP
rs1462039689 1039 dbSNP
rs1320077281 1046 dbSNP
rs949544066 1048 dbSNP
rs898106956 1067 dbSNP
rs1036593599 1070 dbSNP
rs999664294 1072 dbSNP
rs771909248 1073 dbSNP
rs1378959732 1079 dbSNP
rs865907097 1099 dbSNP
rs1227055301 1112 dbSNP
rs1292679135 1121 dbSNP
rs1322931448 1122 dbSNP
rs1447160366 1126 dbSNP
rs1213784623 1127 dbSNP
rs770467932 1137 dbSNP
rs1246802559 1154 dbSNP
rs902207256 1155 dbSNP
rs1187827253 1165 dbSNP
rs1463244575 1166 dbSNP
rs942260123 1184 dbSNP
rs909225072 1185 dbSNP
rs1472363354 1191 dbSNP
rs145829132 1194 dbSNP
rs1415896564 1198 dbSNP
rs551427045 1202 dbSNP
rs1158510739 1204 dbSNP
rs1262249412 1207 dbSNP
rs1277423523 1212 dbSNP
rs1013505423 1220 dbSNP
rs764396186 1223 dbSNP
rs932117113 1230 dbSNP
rs1319251576 1245 dbSNP
rs1226785633 1249 dbSNP
rs149007013 1272 dbSNP
rs117198029 1273 dbSNP
rs1446285775 1278 dbSNP
rs1315749930 1285 dbSNP
rs748916659 1286 dbSNP
rs543815877 1304 dbSNP
rs967220936 1307 dbSNP
rs1247334124 1308 dbSNP
rs1054897314 1311 dbSNP
rs1287135498 1323 dbSNP
rs931123283 1329 dbSNP
rs919739668 1331 dbSNP
rs573267905 1336 dbSNP
rs1441579621 1348 dbSNP
rs990073783 1352 dbSNP
rs1207745530 1362 dbSNP
rs957476202 1388 dbSNP
rs1239051648 1391 dbSNP
rs1034058120 1392 dbSNP
rs772906056 1399 dbSNP
rs1395218716 1414 dbSNP
rs1370890822 1415 dbSNP
rs1473631046 1433 dbSNP
rs532443066 1434 dbSNP
rs1424739516 1435 dbSNP
rs561651373 1444 dbSNP
rs1413038747 1446 dbSNP
rs1336523664 1450 dbSNP
rs747907660 1451 dbSNP
rs540301702 1452 dbSNP
rs1389073346 1455 dbSNP
rs573394263 1465 dbSNP
rs1473596351 1471 dbSNP
rs912605116 1483 dbSNP
rs1343842372 1484 dbSNP
rs1186338301 1487 dbSNP
rs184147448 1490 dbSNP
rs1217153171 1494 dbSNP
rs1280444162 1498 dbSNP
rs1483604283 1500 dbSNP
rs1204300078 1505 dbSNP
rs546568707 1511 dbSNP
rs1484043896 1513 dbSNP
rs1182601263 1517 dbSNP
rs1246241711 1518 dbSNP
rs1477150155 1534 dbSNP
rs1036457786 1537 dbSNP
rs1006433458 1542 dbSNP
rs1174560040 1545 dbSNP
rs1203652221 1549 dbSNP
rs954287824 1551 dbSNP
rs1483008774 1559 dbSNP
rs921489335 1562 dbSNP
rs576013795 1566 dbSNP
rs1392553205 1568 dbSNP
rs1328907598 1569 dbSNP
rs1211687176 1573 dbSNP
rs1330048866 1579 dbSNP
rs748042703 1582 dbSNP
rs1354575229 1584 dbSNP
rs957549889 1588 dbSNP
rs1348243756 1593 dbSNP
rs1227409509 1594 dbSNP
rs557650867 1606 dbSNP
rs1031831127 1612 dbSNP
rs1239986714 1616 dbSNP
rs778874860 1619 dbSNP
rs780860186 1633 dbSNP
rs1196362320 1638 dbSNP
rs1050477142 1643 dbSNP
rs1449972424 1646 dbSNP
rs191893248 1649 dbSNP
rs1289963881 1654 dbSNP
rs1449159135 1665 dbSNP
rs999317925 1670 dbSNP
rs114753442 1673 dbSNP
rs1462922430 1681 dbSNP
rs768585446 1693 dbSNP
rs1013641800 1694 dbSNP
rs1371260389 1696 dbSNP
rs895084451 1696 dbSNP
rs1369836815 1697 dbSNP
rs1295101452 1721 dbSNP
rs1328004050 1722 dbSNP
rs1054988381 1725 dbSNP
rs1323699984 1727 dbSNP
rs995368190 1738 dbSNP
rs898366885 1750 dbSNP
rs1215625026 1753 dbSNP
rs1037267566 1757 dbSNP
rs1040493369 1759 dbSNP
rs1464592287 1763 dbSNP
rs1207110877 1771 dbSNP
rs1387900922 1778 dbSNP
rs1429510491 1785 dbSNP
rs940124431 1787 dbSNP
rs1474091415 1792 dbSNP
rs754782496 1792 dbSNP
rs913072135 1797 dbSNP
rs912606091 1798 dbSNP
rs989980347 1801 dbSNP
rs932617160 1802 dbSNP
rs921247676 1808 dbSNP
rs1311815164 1813 dbSNP
rs1338625791 1824 dbSNP
rs990430022 1828 dbSNP
rs1328606502 1829 dbSNP
rs1226752571 1839 dbSNP
rs957602407 1847 dbSNP
rs553222019 1848 dbSNP
rs1486363745 1864 dbSNP
rs924844011 1865 dbSNP
rs1254594465 1870 dbSNP
rs1486922544 1875 dbSNP
rs1189299895 1880 dbSNP
rs957345019 1884 dbSNP
rs1414726481 1886 dbSNP
rs535108868 1887 dbSNP
rs966499164 1893 dbSNP
rs1472575131 1903 dbSNP
rs1025121208 1910 dbSNP
rs1247780533 1914 dbSNP
rs1313437707 1916 dbSNP
rs1013267877 1919 dbSNP
rs979817472 1922 dbSNP
rs1408092700 1924 dbSNP
rs1309316404 1930 dbSNP
rs971490727 1933 dbSNP
rs959057294 1934 dbSNP
rs1224366863 1938 dbSNP
rs1449974616 1943 dbSNP
rs1289160915 1949 dbSNP
rs566596215 1952 dbSNP
rs993887689 1956 dbSNP
rs1212141883 1959 dbSNP
rs961074883 1966 dbSNP
rs1331472463 1969 dbSNP
rs551163912 1971 dbSNP
rs779118130 1980 dbSNP
rs1174972659 1983 dbSNP
rs1033297312 1996 dbSNP
rs1226319374 2005 dbSNP
rs1349596807 2009 dbSNP
rs1275397433 2013 dbSNP
rs995420683 2017 dbSNP
rs1436356027 2031 dbSNP
rs1174118501 2035 dbSNP
rs1006785567 2037 dbSNP
rs1015436619 2040 dbSNP
rs1004427470 2045 dbSNP
rs1038247919 2057 dbSNP
rs1386387480 2057 dbSNP
rs888057221 2061 dbSNP
rs1051133825 2062 dbSNP
rs1373573887 2063 dbSNP
rs1235466521 2065 dbSNP
rs190155519 2066 dbSNP
rs996419941 2068 dbSNP
rs1274458563 2072 dbSNP
rs1322291765 2081 dbSNP
rs1207307904 2083 dbSNP
rs1051639790 2088 dbSNP
rs1480689188 2101 dbSNP
rs1190202867 2102 dbSNP
rs535860926 2104 dbSNP
rs932710562 2112 dbSNP
rs1390347233 2116 dbSNP
rs901844589 2117 dbSNP
rs1389368293 2124 dbSNP
rs1408118504 2142 dbSNP
rs1457069215 2145 dbSNP
rs371636254 2149 dbSNP
rs1426268348 2150 dbSNP
rs528910844 2159 dbSNP
rs1193433787 2166 dbSNP
rs1477316329 2167 dbSNP
rs1396952244 2173 dbSNP
rs1441965699 2180 dbSNP
rs757471916 2193 dbSNP
rs1363488895 2194 dbSNP
rs868454772 2198 dbSNP
rs149761192 2223 dbSNP
rs936245168 2235 dbSNP
rs1307511025 2239 dbSNP
rs924828022 2248 dbSNP
rs754111794 2254 dbSNP
rs753656715 2256 dbSNP
rs1469510406 2265 dbSNP
rs376854522 2269 dbSNP
rs935818760 2271 dbSNP
rs1247131591 2278 dbSNP
rs1474306458 2287 dbSNP
rs571601429 2293 dbSNP
rs927118802 2297 dbSNP
rs539996339 2300 dbSNP
rs1188139883 2303 dbSNP
rs917408701 2310 dbSNP
rs991902222 2313 dbSNP
rs1162839212 2320 dbSNP
rs185064542 2323 dbSNP
rs1246446285 2326 dbSNP
rs1320174989 2333 dbSNP
rs1343737577 2334 dbSNP
rs34780694 2335 dbSNP
rs193171374 2337 dbSNP
rs756306403 2340 dbSNP
rs1379078991 2344 dbSNP
rs962672929 2348 dbSNP
rs972361972 2350 dbSNP
rs961138015 2351 dbSNP
rs1233481796 2358 dbSNP
rs1267116711 2362 dbSNP
rs1444980977 2365 dbSNP
rs1217671022 2373 dbSNP
rs1015905537 2381 dbSNP
rs1004116864 2386 dbSNP
rs890982454 2391 dbSNP
rs1220933374 2392 dbSNP
rs1342780949 2393 dbSNP
rs1273775433 2394 dbSNP
rs1435163482 2400 dbSNP
rs1029489972 2405 dbSNP
rs546433704 2408 dbSNP
rs1406049873 2410 dbSNP
rs996973698 2410 dbSNP
rs1160251272 2426 dbSNP
rs1016628021 2434 dbSNP
rs1413424502 2437 dbSNP
rs1315396232 2438 dbSNP
rs1356751251 2458 dbSNP
rs1414849686 2464 dbSNP
rs899879556 2496 dbSNP
rs983860510 2501 dbSNP
rs757491243 2515 dbSNP
rs952332450 2540 dbSNP
rs575876695 2553 dbSNP
rs996840873 2557 dbSNP
rs751653129 2558 dbSNP
rs1042389107 2560 dbSNP
rs1485993884 2563 dbSNP
rs1413303265 2565 dbSNP
rs1018995691 2566 dbSNP
rs1010222054 2570 dbSNP
rs1471269231 2571 dbSNP
rs891913643 2576 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||:|| |   :|||||| 
Target 5' aucGCAUCACU---GCACUCCa 3'
2 - 20
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000343010.3 | 3UTR | GAUCGCAUCACUGCACUCCAGCCUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*