miRTarBase - #MIRT686061 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KCNA7   
Synonyms HAK6, KV1.7
Description potassium voltage-gated channel subfamily A member 7
Transcript NM_031886   
Putative miRNA Targets on KCNA7
3'UTR of KCNA7
(miRNA target sites are highlighted)
2641 TATTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :||||| |   :|||||| 
Target 5' attGCACCACT---GCACTCCa 3'
1685 - 1703 140.00 -17.90
             :|:||| |   :|||||| 
Target 5' attGCGCCACT---GCACTCCa 3'
2098 - 2116 136.00 -17.50
            ::|| ||  |  ||||||: 
2120 - 2141 136.00 -12.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28794772 31 COSMIC
COSN31508933 32 COSMIC
COSN1217351 37 COSMIC
COSN30461747 41 COSMIC
COSN30192620 48 COSMIC
COSN30487778 50 COSMIC
COSN26980974 52 COSMIC
COSN24390800 64 COSMIC
COSN30181137 69 COSMIC
COSN30514934 77 COSMIC
COSN28688996 79 COSMIC
COSN30103332 88 COSMIC
COSN31556838 95 COSMIC
COSN13819240 119 COSMIC
COSN17371817 489 COSMIC
COSN17509296 881 COSMIC
COSN8754057 900 COSMIC
COSN27495065 1018 COSMIC
COSN5438794 1194 COSMIC
COSN21940069 1658 COSMIC
COSN8974546 1684 COSMIC
COSN20596643 1818 COSMIC
COSN20595578 1819 COSMIC
COSN22879315 1822 COSMIC
COSN20596642 1824 COSMIC
COSN8974545 2206 COSMIC
COSN24956520 2350 COSMIC
COSN17490704 2480 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs58259114 6 dbSNP
rs764627605 8 dbSNP
rs1348242817 14 dbSNP
rs1253127104 15 dbSNP
rs761166864 18 dbSNP
rs376020507 20 dbSNP
rs771452572 22 dbSNP
rs546265870 23 dbSNP
rs1266500590 24 dbSNP
rs939634781 26 dbSNP
rs572360689 28 dbSNP
rs1201251873 30 dbSNP
rs1429774339 31 dbSNP
rs774582553 34 dbSNP
rs1477272496 35 dbSNP
rs771254385 36 dbSNP
rs980458921 38 dbSNP
rs1480782256 39 dbSNP
rs747993638 42 dbSNP
rs781127194 49 dbSNP
rs1256211422 51 dbSNP
rs1462110937 53 dbSNP
rs1292438599 55 dbSNP
rs1054383308 57 dbSNP
rs947763680 60 dbSNP
rs1389137822 63 dbSNP
rs1407325841 64 dbSNP
rs554063947 68 dbSNP
rs903234792 74 dbSNP
rs117399970 75 dbSNP
rs983921501 76 dbSNP
rs1369689490 79 dbSNP
rs1489827737 81 dbSNP
rs568262365 84 dbSNP
rs1324034437 94 dbSNP
rs1269303190 113 dbSNP
rs11083959 114 dbSNP
rs986319607 116 dbSNP
rs1428766352 118 dbSNP
rs186760468 119 dbSNP
rs920878472 121 dbSNP
rs973030348 122 dbSNP
rs965697269 130 dbSNP
rs1360281395 131 dbSNP
rs779475690 132 dbSNP
rs1015063959 133 dbSNP
rs1472605673 139 dbSNP
rs1018922181 146 dbSNP
rs1362861693 151 dbSNP
rs1007526203 154 dbSNP
rs182155047 162 dbSNP
rs1023449952 182 dbSNP
rs1012074410 188 dbSNP
rs1483044734 193 dbSNP
rs551747785 198 dbSNP
rs757872442 199 dbSNP
rs1224152434 201 dbSNP
rs76646140 202 dbSNP
rs1010983260 210 dbSNP
rs892630094 214 dbSNP
rs36060191 215 dbSNP
rs1003781427 216 dbSNP
rs1331287006 217 dbSNP
rs1485970003 218 dbSNP
rs906799198 236 dbSNP
rs548089938 247 dbSNP
rs1446000441 250 dbSNP
rs141788019 256 dbSNP
rs1380160033 257 dbSNP
rs903204457 263 dbSNP
rs1042137795 264 dbSNP
rs764819856 267 dbSNP
rs1346200185 270 dbSNP
rs944789523 271 dbSNP
rs1044725025 278 dbSNP
rs1335037300 287 dbSNP
rs1385082222 292 dbSNP
rs890573230 300 dbSNP
rs947710401 303 dbSNP
rs1376002866 307 dbSNP
rs3810186 308 dbSNP
rs1349868522 310 dbSNP
rs1286053643 312 dbSNP
rs543890063 313 dbSNP
rs932146015 316 dbSNP
rs1275374198 318 dbSNP
rs796506423 333 dbSNP
rs929744083 335 dbSNP
rs1260785406 336 dbSNP
rs1462384380 345 dbSNP
rs918408090 352 dbSNP
rs565989915 365 dbSNP
rs1438276359 372 dbSNP
rs1347929686 377 dbSNP
rs1322426522 380 dbSNP
rs973668333 390 dbSNP
rs1469026118 409 dbSNP
rs940321246 416 dbSNP
rs1414328047 427 dbSNP
rs907522509 433 dbSNP
rs977008323 441 dbSNP
rs1408498250 443 dbSNP
rs982210284 449 dbSNP
rs970501659 452 dbSNP
rs547019331 459 dbSNP
rs1156403477 467 dbSNP
rs866253075 468 dbSNP
rs531839018 469 dbSNP
rs990581413 474 dbSNP
rs763549119 490 dbSNP
rs3810185 491 dbSNP
rs1325190564 492 dbSNP
rs1203949415 500 dbSNP
rs1022288325 504 dbSNP
rs1435628281 509 dbSNP
rs1032198296 510 dbSNP
rs546202785 517 dbSNP
rs999413664 523 dbSNP
rs868832649 530 dbSNP
rs1224523273 534 dbSNP
rs1477997182 535 dbSNP
rs572496187 540 dbSNP
rs567858467 541 dbSNP
rs1431948286 546 dbSNP
rs1480870967 549 dbSNP
rs1170298769 553 dbSNP
rs1031146867 555 dbSNP
rs116835540 559 dbSNP
rs867401026 564 dbSNP
rs542117226 565 dbSNP
rs776779735 589 dbSNP
rs574502199 605 dbSNP
rs1404286786 606 dbSNP
rs115519627 615 dbSNP
rs888099108 616 dbSNP
rs1347221387 617 dbSNP
rs537692562 620 dbSNP
rs1220909559 621 dbSNP
rs996322345 625 dbSNP
rs1215758097 629 dbSNP
rs1273125009 632 dbSNP
rs1490318479 634 dbSNP
rs370138761 640 dbSNP
rs1274081987 643 dbSNP
rs189585441 648 dbSNP
rs138664779 650 dbSNP
rs566475219 653 dbSNP
rs940935637 654 dbSNP
rs867110954 663 dbSNP
rs1476524532 666 dbSNP
rs1168523440 681 dbSNP
rs369281563 689 dbSNP
rs1367221815 691 dbSNP
rs1413211142 698 dbSNP
rs1318138143 704 dbSNP
rs908159584 705 dbSNP
rs1367202433 706 dbSNP
rs1405258231 708 dbSNP
rs943869861 710 dbSNP
rs1324270897 712 dbSNP
rs538842150 716 dbSNP
rs911091583 723 dbSNP
rs1358172030 728 dbSNP
rs1244410516 743 dbSNP
rs985334205 745 dbSNP
rs547731050 746 dbSNP
rs1360805827 747 dbSNP
rs1443274915 755 dbSNP
rs968637240 760 dbSNP
rs916295253 764 dbSNP
rs1236962412 769 dbSNP
rs1442925656 770 dbSNP
rs990548730 772 dbSNP
rs4802547 773 dbSNP
rs568706958 774 dbSNP
rs956786849 779 dbSNP
rs1157740381 787 dbSNP
rs1031513410 789 dbSNP
rs1451726855 789 dbSNP
rs1246358205 792 dbSNP
rs550387187 797 dbSNP
rs1449753542 798 dbSNP
rs1483598912 819 dbSNP
rs978367104 822 dbSNP
rs1384128735 827 dbSNP
rs1320390707 836 dbSNP
rs982263644 838 dbSNP
rs1239330937 839 dbSNP
rs1259307029 843 dbSNP
rs966642578 846 dbSNP
rs766610802 848 dbSNP
rs1262672388 851 dbSNP
rs1279525764 853 dbSNP
rs531975134 856 dbSNP
rs1205589192 859 dbSNP
rs1243859989 859 dbSNP
rs150167720 860 dbSNP
rs59756469 863 dbSNP
rs1012485757 867 dbSNP
rs888718733 869 dbSNP
rs1026621519 872 dbSNP
rs527645938 876 dbSNP
rs771384410 877 dbSNP
rs896861784 880 dbSNP
rs1406230248 887 dbSNP
rs186463935 889 dbSNP
rs531792511 893 dbSNP
rs1446454425 894 dbSNP
rs570997547 894 dbSNP
rs541907821 900 dbSNP
rs763090471 901 dbSNP
rs1240133021 902 dbSNP
rs1283069069 903 dbSNP
rs1431965281 904 dbSNP
rs1388741853 906 dbSNP
rs574669923 908 dbSNP
rs1263807587 923 dbSNP
rs562676760 937 dbSNP
rs1480383769 944 dbSNP
rs889605377 946 dbSNP
rs1195154240 952 dbSNP
rs369918928 958 dbSNP
rs1248250076 963 dbSNP
rs1168169776 974 dbSNP
rs1054750104 975 dbSNP
rs1049574944 985 dbSNP
rs936419590 986 dbSNP
rs543983100 1002 dbSNP
rs1178212944 1007 dbSNP
rs1424669227 1011 dbSNP
rs75685238 1024 dbSNP
rs989463076 1025 dbSNP
rs935333142 1028 dbSNP
rs1399197932 1029 dbSNP
rs912456597 1033 dbSNP
rs924004983 1036 dbSNP
rs1344078466 1043 dbSNP
rs558193275 1054 dbSNP
rs987133855 1062 dbSNP
rs533648658 1064 dbSNP
rs181104526 1073 dbSNP
rs953972810 1081 dbSNP
rs549991295 1082 dbSNP
rs1253176218 1086 dbSNP
rs1341344683 1100 dbSNP
rs974780993 1103 dbSNP
rs1023785805 1104 dbSNP
rs1267898635 1109 dbSNP
rs990997772 1111 dbSNP
rs1205818334 1112 dbSNP
rs963450011 1115 dbSNP
rs748394902 1129 dbSNP
rs1027240483 1138 dbSNP
rs375097380 1139 dbSNP
rs1272271387 1146 dbSNP
rs994466744 1156 dbSNP
rs1430931100 1162 dbSNP
rs896805271 1164 dbSNP
rs776344897 1180 dbSNP
rs1016769988 1183 dbSNP
rs1226223189 1184 dbSNP
rs1019303844 1185 dbSNP
rs1008376485 1192 dbSNP
rs1364101463 1194 dbSNP
rs140859881 1195 dbSNP
rs1049524328 1197 dbSNP
rs768472866 1199 dbSNP
rs947231561 1208 dbSNP
rs1380780893 1214 dbSNP
rs746956626 1218 dbSNP
rs1053442598 1227 dbSNP
rs535908092 1231 dbSNP
rs1229042575 1244 dbSNP
rs886626511 1246 dbSNP
rs1357206400 1255 dbSNP
rs1224374676 1267 dbSNP
rs779926566 1267 dbSNP
rs1184457909 1268 dbSNP
rs1263205083 1270 dbSNP
rs1449618533 1279 dbSNP
rs982152224 1282 dbSNP
rs949418359 1293 dbSNP
rs1226062853 1307 dbSNP
rs1427140627 1309 dbSNP
rs1165887024 1312 dbSNP
rs1345017501 1314 dbSNP
rs757925467 1318 dbSNP
rs1451874767 1332 dbSNP
rs745322885 1334 dbSNP
rs1366205461 1336 dbSNP
rs1309126213 1340 dbSNP
rs895439023 1344 dbSNP
rs1380438528 1348 dbSNP
rs990946948 1349 dbSNP
rs936347524 1352 dbSNP
rs952851614 1357 dbSNP
rs920139238 1360 dbSNP
rs973380119 1361 dbSNP
rs11673003 1363 dbSNP
rs1307873255 1368 dbSNP
rs1202436007 1373 dbSNP
rs1458602258 1382 dbSNP
rs191618879 1383 dbSNP
rs1042548773 1389 dbSNP
rs1162970269 1391 dbSNP
rs945200252 1392 dbSNP
rs912372117 1403 dbSNP
rs1182784445 1411 dbSNP
rs1473564842 1418 dbSNP
rs1249342263 1427 dbSNP
rs1469510716 1430 dbSNP
rs1334749422 1439 dbSNP
rs1019676345 1442 dbSNP
rs538407917 1444 dbSNP
rs571066275 1446 dbSNP
rs1488693841 1447 dbSNP
rs186954665 1453 dbSNP
rs552658214 1454 dbSNP
rs932553679 1455 dbSNP
rs182226694 1458 dbSNP
rs560423994 1459 dbSNP
rs1011320596 1462 dbSNP
rs1349258100 1472 dbSNP
rs796854851 1475 dbSNP
rs1222572163 1477 dbSNP
rs528014781 1486 dbSNP
rs1387655155 1489 dbSNP
rs1052988362 1492 dbSNP
rs1291966414 1495 dbSNP
rs999154010 1498 dbSNP
rs753517854 1505 dbSNP
rs950861169 1509 dbSNP
rs1025547631 1511 dbSNP
rs1046795006 1526 dbSNP
rs1413212117 1531 dbSNP
rs560619432 1549 dbSNP
rs1013739515 1556 dbSNP
rs1174625217 1560 dbSNP
rs767821219 1561 dbSNP
rs1328290583 1562 dbSNP
rs1415047521 1562 dbSNP
rs895365311 1569 dbSNP
rs1409588011 1576 dbSNP
rs1439976766 1578 dbSNP
rs916621029 1589 dbSNP
rs1033894110 1594 dbSNP
rs1055205597 1600 dbSNP
rs1000462682 1617 dbSNP
rs903529075 1642 dbSNP
rs931413186 1643 dbSNP
rs1269251490 1655 dbSNP
rs150934762 1660 dbSNP
rs945101052 1662 dbSNP
rs920067829 1664 dbSNP
rs1207304317 1674 dbSNP
rs143429839 1675 dbSNP
rs1252973541 1676 dbSNP
rs1490308068 1677 dbSNP
rs972945708 1679 dbSNP
rs1197721676 1682 dbSNP
rs890917741 1686 dbSNP
rs1478493488 1687 dbSNP
rs1051363247 1705 dbSNP
rs1417512800 1709 dbSNP
rs1408123179 1713 dbSNP
rs753049117 1716 dbSNP
rs1170480451 1717 dbSNP
rs562411406 1720 dbSNP
rs1404042125 1723 dbSNP
rs912823913 1727 dbSNP
rs544113161 1728 dbSNP
rs1209988697 1751 dbSNP
rs1326482788 1753 dbSNP
rs35430308 1754 dbSNP
rs1027979796 1759 dbSNP
rs1275894951 1761 dbSNP
rs941982795 1765 dbSNP
rs35203905 1768 dbSNP
rs1452377390 1789 dbSNP
rs957168014 1790 dbSNP
rs1031892047 1794 dbSNP
rs1333165998 1801 dbSNP
rs1476392697 1803 dbSNP
rs998706294 1814 dbSNP
rs1440439657 1822 dbSNP
rs1423965971 1836 dbSNP
rs1161407144 1840 dbSNP
rs959548380 1841 dbSNP
rs907075569 1844 dbSNP
rs1405579908 1862 dbSNP
rs148817658 1864 dbSNP
rs1033862958 1867 dbSNP
rs1012871223 1868 dbSNP
rs1432929114 1871 dbSNP
rs895132741 1872 dbSNP
rs1055152123 1873 dbSNP
rs1466533723 1874 dbSNP
rs867804426 1879 dbSNP
rs1204917789 1880 dbSNP
rs1379145446 1883 dbSNP
rs1466438085 1892 dbSNP
rs968352535 1893 dbSNP
rs62127899 1895 dbSNP
rs1181738473 1902 dbSNP
rs554402206 1911 dbSNP
rs1472966154 1912 dbSNP
rs1037575016 1914 dbSNP
rs11666224 1921 dbSNP
rs1405285948 1922 dbSNP
rs1458519979 1925 dbSNP
rs140089220 1927 dbSNP
rs189400792 1928 dbSNP
rs1451085881 1931 dbSNP
rs147920079 1942 dbSNP
rs1238716844 1943 dbSNP
rs149856050 1947 dbSNP
rs899682016 1948 dbSNP
rs1038241086 1949 dbSNP
rs989786970 1950 dbSNP
rs941259537 1953 dbSNP
rs1460089255 1954 dbSNP
rs761715580 1961 dbSNP
rs552797202 1962 dbSNP
rs1442959255 1965 dbSNP
rs1180777781 1967 dbSNP
rs1031422672 1969 dbSNP
rs1300049164 1972 dbSNP
rs1159524746 1973 dbSNP
rs977613088 1978 dbSNP
rs929323370 1980 dbSNP
rs917969839 1997 dbSNP
rs751512769 2000 dbSNP
rs374512738 2002 dbSNP
rs1012819567 2003 dbSNP
rs1396536662 2006 dbSNP
rs894413248 2007 dbSNP
rs1311011873 2008 dbSNP
rs926773374 2009 dbSNP
rs534164172 2014 dbSNP
rs1033653684 2015 dbSNP
rs995530099 2018 dbSNP
rs566938425 2019 dbSNP
rs1037118586 2021 dbSNP
rs1187555904 2024 dbSNP
rs940135209 2026 dbSNP
rs1200414987 2029 dbSNP
rs956393440 2029 dbSNP
rs1377649883 2038 dbSNP
rs1021215372 2039 dbSNP
rs1009608276 2053 dbSNP
rs891282133 2059 dbSNP
rs201098222 2063 dbSNP
rs996586331 2064 dbSNP
rs548418714 2065 dbSNP
rs530066986 2070 dbSNP
rs562549894 2074 dbSNP
rs1302096914 2077 dbSNP
rs1277275556 2078 dbSNP
rs1226607174 2085 dbSNP
rs550411591 2087 dbSNP
rs1272469503 2088 dbSNP
rs1226443592 2089 dbSNP
rs1205663045 2090 dbSNP
rs989734921 2094 dbSNP
rs1339061892 2095 dbSNP
rs1285012088 2096 dbSNP
rs1427478410 2099 dbSNP
rs1247015027 2100 dbSNP
rs532268020 2103 dbSNP
rs1450603358 2105 dbSNP
rs924306325 2106 dbSNP
rs1163376301 2110 dbSNP
rs1348447972 2116 dbSNP
rs1005389996 2118 dbSNP
rs564876042 2123 dbSNP
rs1384515826 2124 dbSNP
rs540405364 2125 dbSNP
rs528303352 2126 dbSNP
rs886983320 2130 dbSNP
rs1228997276 2131 dbSNP
rs561010319 2133 dbSNP
rs542368134 2135 dbSNP
rs1046990728 2136 dbSNP
rs1309690219 2140 dbSNP
rs1485327835 2141 dbSNP
rs1408004415 2145 dbSNP
rs74182033 2146 dbSNP
rs929268506 2149 dbSNP
rs111964178 2152 dbSNP
rs71179079 2153 dbSNP
rs1425991221 2154 dbSNP
rs1415077326 2155 dbSNP
rs771298506 2156 dbSNP
rs1165907473 2157 dbSNP
rs563257561 2157 dbSNP
rs1302263154 2161 dbSNP
rs1376869242 2167 dbSNP
rs1229870111 2168 dbSNP
rs113434270 2172 dbSNP
rs1313121000 2172 dbSNP
rs180944499 2181 dbSNP
rs1464900291 2197 dbSNP
rs557968894 2200 dbSNP
rs1024119273 2205 dbSNP
rs17206784 2207 dbSNP
rs958579741 2209 dbSNP
rs1250201882 2213 dbSNP
rs1161561468 2215 dbSNP
rs979536558 2215 dbSNP
rs946907990 2217 dbSNP
rs1027578184 2224 dbSNP
rs761987243 2225 dbSNP
rs898489072 2230 dbSNP
rs1016039916 2238 dbSNP
rs914117798 2240 dbSNP
rs1450079877 2242 dbSNP
rs1171313073 2246 dbSNP
rs1292805315 2252 dbSNP
rs577599042 2253 dbSNP
rs1004283500 2265 dbSNP
rs1350961032 2270 dbSNP
rs1289900770 2275 dbSNP
rs1290151930 2287 dbSNP
rs988425380 2288 dbSNP
rs1275853247 2303 dbSNP
rs1439688723 2304 dbSNP
rs1436228585 2310 dbSNP
rs1211373362 2316 dbSNP
rs1334979994 2319 dbSNP
rs1251113967 2320 dbSNP
rs775221604 2322 dbSNP
rs1323773849 2324 dbSNP
rs1252873668 2338 dbSNP
rs1406787703 2350 dbSNP
rs559322629 2365 dbSNP
rs1163666799 2367 dbSNP
rs1457318377 2374 dbSNP
rs1427295645 2383 dbSNP
rs1414763890 2385 dbSNP
rs45483292 2388 dbSNP
rs1427642655 2402 dbSNP
rs1309594310 2404 dbSNP
rs1469914351 2408 dbSNP
rs1247702568 2409 dbSNP
rs932823775 2411 dbSNP
rs139958903 2419 dbSNP
rs1201258969 2430 dbSNP
rs900049312 2431 dbSNP
rs555004534 2435 dbSNP
rs1054705505 2441 dbSNP
rs188093058 2442 dbSNP
rs1274626662 2443 dbSNP
rs1340632210 2447 dbSNP
rs1272785651 2456 dbSNP
rs924280026 2458 dbSNP
rs768367205 2459 dbSNP
rs1269896999 2463 dbSNP
rs746768021 2473 dbSNP
rs563428910 2479 dbSNP
rs1185988255 2483 dbSNP
rs917012000 2489 dbSNP
rs1005771939 2491 dbSNP
rs1170281517 2494 dbSNP
rs569053859 2495 dbSNP
rs1370881348 2502 dbSNP
rs991283807 2506 dbSNP
rs375476347 2509 dbSNP
rs1321254907 2512 dbSNP
rs1351246603 2514 dbSNP
rs111459507 2515 dbSNP
rs1436636266 2515 dbSNP
rs1363683235 2519 dbSNP
rs1438165784 2528 dbSNP
rs920462448 2532 dbSNP
rs1368250986 2536 dbSNP
rs1447582919 2542 dbSNP
rs1356006673 2546 dbSNP
rs550550883 2571 dbSNP
rs1292357389 2579 dbSNP
rs1452378895 2589 dbSNP
rs553644793 2608 dbSNP
rs895776538 2614 dbSNP
rs1390249263 2616 dbSNP
rs1463503267 2622 dbSNP
rs4802546 2634 dbSNP
rs778454238 2650 dbSNP
rs938020805 2653 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :||||| |   :|||||| 
Target 5' auuGCACCACU---GCACUCCa 3'
3 - 21
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048188
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000221444.1 | 3UTR | UGAUUGCACCACUGCACUCCAGCCUGGGCAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*