miRTarBase - #MIRT682881 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SAR1A   
Synonyms SAR1, SARA1, Sara, masra2
Description secretion associated Ras related GTPase 1A
Transcript NM_001142648   
Other Transcripts NM_020150   
Expression
Putative miRNA Targets on SAR1A
3'UTR of SAR1A
(miRNA target sites are highlighted)
>SAR1A|NM_001142648|3'UTR
   1 TGTTTGGACGGTGAAAATAAAAGAGTTTTACTTCTCTGGACTGATCCTATTCACAGCTTCCTCATGAACTTTTCTAATAG
  81 AACAAGGAAAGCTCTCCAACCATGTCTGGCGTTGAGAAGCCAAGAGTCTCTGTCAACTCTCTCATTGCCCAGTGGTGACA
 161 TGTGCTCTTCTCCACACTGTTGGGAGGTAATGCTGCCCCACGTGCTGGTGCAGGTCAGTATCCTGGGACTTGGAAGCTGG
 241 CAGGATTTGCCGGGTAAAGCTGTATGCCATCATGGGGCACCTGAAAAGAAAAACACGTCTCACCACTGTGGTTGATTCAA
 321 AAGAAAGTGATTCTATTTTTTAAAGAAAGCGTTGTTAATGTAATTGGTATCCCTCCTAACTTTTTGAGTTCACAATTTAC
 401 TTGGTCCAGAGTTTTCTATTCTTTTTTTTTTTTAAACTAATGAATGACATTTAGATACTTCATAAAATTATGAACAGATA
 481 TGGAGGCCAGAGCTCATTTGGGTAAACTTACTCCTGCTGAGTTAGCAGGTTGGTGAGAGAAGCTCCCCTGAGCTCACCTG
 561 TCTCTCTGACTGCCTTGGAGTAGGTGGCATAACCTTGTGCACAGAGAACTAGAAAAGGGGCAGAACCCCGGCCTTGCAGT
 641 TGTGGCAGGTTTCCACTGTGGTAAGCTAGGTTCATTCCTCATCAAGGAATGTGTAGCAGATTGTTCACTGTGGAGGAGTT
 721 AATTATAGAATGGGTTATTGTTGTTATTCTTACTCATGAAGTTACAGATTTTAGCCAGTCTTTGCTTTTATACTTTTGTG
 801 AAATTTAATTTCTCTCTATAGCACCTTCCTTTTTCGTTTTCAGTTATCAAAAGTGACTTTGACCTCATAAAAGAGTTGAG
 881 AACATCTCTCGTGTCACATACTGCAGGTGCATCAGTTACTTTTGCACAGATTCTAGGGGGACATTTTTCTGAATAGGAAG
 961 ACAGGACAAAGTTAACAGCTTAAGGGCTCTTAATTCTGTGAGTTGAGGACTTAAAAGTATTGTAGCATTTGTTTGGATCC
1041 ATGAAAAATGTATTCAGTGGGCTTTAAAATTTCCATTTGCAGAATTTGGTCTCTCAGGCTGTTTGGGAGCTCTTTTTTTT
1121 ACATTTTTTCTCCTTTGACACCTATTTTATTGGTGTTTAAAGTAAAGGTTAACATCTGTAGCTTTTCCAGGTTTTTTTTT
1201 TTTTTTTTTTTTTTTTGGTATGAAATTGTCTTTCTCCATTGCAGAAATAAGCTAGGGAAACACTAACCCAAAAACTTTCT
1281 GTAGAGCTGTTCCTTTGGAGGCAGCATCACTTATTGGCAGTAAAGACTCAGTATAAAAGCACCGGCATCCCTACTTGGGT
1361 GATGGGGATTAATTTTATAGCATTCCATTTTCCTAGTGCCACATGTGAAATTGGATTTTGATGATCTTAATCTATATTCT
1441 ACCCTTATAATAAAAGATCAAAAGATATATCTCCTATGAACAGATTGGAGATAGGAGATGAAAAGTTGGGAGGATGTCTT
1521 TATTCTAATGTGAGGGTAGGGAAAATGTGGATAACATTACTGGGGTGAGGGAGGCATTGTTCTTTAGTTGGAGTTCTCAT
1601 TCTTATTCTCCAGTACTGACTTGTGGGGAAAGCATACTTTTTCACTGCCAGGTACTGAATGCAGAGGCTCAGTGAAGTAT
1681 ATATGTGGGAAGTGCATGCATTTCGTTTATTAGCAAACATAGCTGGATTAAGACAAAGTTGTTGGTTTGGAAAGGGGTTA
1761 AAGCCTTAAGTGAACAAATCTAGCTAACAGTGAATGAACTAGGTAATATAACTTGCATATTTTTAATTTCCTTTGGTTAA
1841 AGGTCCCCCATACTTCTCTGTTCGGAGACATGAGAAGTATGATTACTTCAGTGTTAGTTTTCTTAATTTTTTTTTTCCCC
1921 TATTTGTCCCTTGTCACTTTGTTGCAAGCTAGAAATCTGTGGGTTATACATAGGGCAGCTCTTTGTGAAAGTGGTTTATT
2001 CCACTGGAGAAAGGGGATTGAAAATCAGTTAGAACCAATGTATTTCTTGCCCCACGGAACACTATTCCTATAAGATAGCT
2081 GAAAGAAGCTGCTGTGAGGAGCTCAGCTCCAAACACAGGATCAGCACCTTGTATAGGAATTCCCATGAATTATGACTTCT
2161 CATTCTGTTTTATCAGAGTGCATATATGTCCTACTTCAGGAAAAGTAAAACAGTCATTTACGAAAGAAAGTCAATCTGTA
2241 TCCTAAGCATTTTAATAAAAAGTTAAAACAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||:: ||||   |:|||:| 
Target 5' tgAATGACATTTAGATACTTCa 3'
441 - 462 128.00 -10.00
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            | :| : || | :||:||| 
Target 5' ggATTAATTTTATAGCATTCCa 3'
1366 - 1387 120.00 -9.60
3
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                :|||| |:|: |||| 
Target 5' gagttcTCATTCTTATTCTCCa 3'
1591 - 1612 116.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26993751 9 COSMIC
COSN30450052 10 COSMIC
COSN26993750 22 COSMIC
COSN30472666 38 COSMIC
COSN30472345 43 COSMIC
COSN30459833 52 COSMIC
COSN31592100 66 COSMIC
COSN28889041 68 COSMIC
COSN31492723 71 COSMIC
COSN31586965 92 COSMIC
COSN30191221 124 COSMIC
COSN26438738 188 COSMIC
COSN31560926 240 COSMIC
COSN28634461 650 COSMIC
COSN31513978 737 COSMIC
COSN26565571 822 COSMIC
COSN31513139 836 COSMIC
COSN30172656 878 COSMIC
COSN29954783 943 COSMIC
COSN21427909 1082 COSMIC
COSN29456290 1112 COSMIC
COSN20092126 1155 COSMIC
COSN16916620 1602 COSMIC
COSN31583038 1608 COSMIC
COSN29541920 1622 COSMIC
COSN8719267 1878 COSMIC
COSN21407568 2094 COSMIC
COSN8719266 2104 COSMIC
COSN25059418 2276 COSMIC
COSN28930815 2285 COSMIC
COSN29126212 2296 COSMIC
COSN20946035 2333 COSMIC
COSN27233773 2906 COSMIC
COSN16750840 3064 COSMIC
COSN22148707 3950 COSMIC
COSN1499503 4057 COSMIC
COSN27835319 4390 COSMIC
COSN1499501 5002 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs192845228 3 dbSNP
rs767735411 6 dbSNP
rs201098455 9 dbSNP
rs377618523 10 dbSNP
rs201501880 12 dbSNP
rs369021499 20 dbSNP
rs1262325796 21 dbSNP
rs1440577132 22 dbSNP
rs761986593 23 dbSNP
rs774410285 26 dbSNP
rs369805009 28 dbSNP
rs754397713 36 dbSNP
rs1165560545 43 dbSNP
rs753785428 46 dbSNP
rs768816603 48 dbSNP
rs1171226979 54 dbSNP
rs1480915749 56 dbSNP
rs547893777 58 dbSNP
rs1176105270 59 dbSNP
rs111523525 62 dbSNP
rs1022545458 67 dbSNP
rs1453320519 72 dbSNP
rs529661908 73 dbSNP
rs1171752363 76 dbSNP
rs1354525127 78 dbSNP
rs562320849 81 dbSNP
rs1440827346 96 dbSNP
rs562753648 99 dbSNP
rs892111696 100 dbSNP
rs1052631822 109 dbSNP
rs1003261332 110 dbSNP
rs1282352219 111 dbSNP
rs1474625376 116 dbSNP
rs1216196733 127 dbSNP
rs906362395 135 dbSNP
rs1306888718 136 dbSNP
rs139903298 138 dbSNP
rs1271172173 139 dbSNP
rs1490564137 147 dbSNP
rs1198974408 150 dbSNP
rs780029863 151 dbSNP
rs1245291890 157 dbSNP
rs1486792580 163 dbSNP
rs1044916759 169 dbSNP
rs868134984 177 dbSNP
rs1419384843 179 dbSNP
rs543671435 183 dbSNP
rs1408763791 201 dbSNP
rs1166117881 208 dbSNP
rs920542433 213 dbSNP
rs1302161471 226 dbSNP
rs1343013956 229 dbSNP
rs1329062557 239 dbSNP
rs1432601326 240 dbSNP
rs1270602918 250 dbSNP
rs757331326 251 dbSNP
rs1361130038 252 dbSNP
rs1037564942 260 dbSNP
rs751606845 274 dbSNP
rs941379037 277 dbSNP
rs908513401 280 dbSNP
rs983276955 295 dbSNP
rs764329400 297 dbSNP
rs955443019 298 dbSNP
rs1216923820 300 dbSNP
rs374941344 310 dbSNP
rs531909816 318 dbSNP
rs1359534134 329 dbSNP
rs1269411699 333 dbSNP
rs564775237 335 dbSNP
rs56003427 342 dbSNP
rs922678100 350 dbSNP
rs569785087 351 dbSNP
rs1433560678 358 dbSNP
rs190297266 359 dbSNP
rs1402109257 362 dbSNP
rs572694170 369 dbSNP
rs1011138593 373 dbSNP
rs560543420 378 dbSNP
rs184545665 382 dbSNP
rs1030627954 395 dbSNP
rs1003618503 404 dbSNP
rs1383526348 408 dbSNP
rs906317802 410 dbSNP
rs1282544895 415 dbSNP
rs1353052137 418 dbSNP
rs1224572323 419 dbSNP
rs1419201184 433 dbSNP
rs1283918658 434 dbSNP
rs1461303614 434 dbSNP
rs1463834058 434 dbSNP
rs535832748 434 dbSNP
rs879875619 434 dbSNP
rs1186166082 438 dbSNP
rs1343074590 441 dbSNP
rs1366238695 444 dbSNP
rs1470922834 447 dbSNP
rs1158803466 452 dbSNP
rs1410847447 458 dbSNP
rs141640146 462 dbSNP
rs1338498953 470 dbSNP
rs1476417025 470 dbSNP
rs1255630429 479 dbSNP
rs1037597449 481 dbSNP
rs940582245 485 dbSNP
rs1337615953 494 dbSNP
rs887108091 500 dbSNP
rs1239960304 514 dbSNP
rs1279174788 521 dbSNP
rs541938314 522 dbSNP
rs1327425694 535 dbSNP
rs1225710906 541 dbSNP
rs1264170431 548 dbSNP
rs1323404117 549 dbSNP
rs1199252069 564 dbSNP
rs1253394228 565 dbSNP
rs1047095044 568 dbSNP
rs574911858 571 dbSNP
rs1250579265 575 dbSNP
rs1206493723 580 dbSNP
rs922709475 601 dbSNP
rs78341510 613 dbSNP
rs192493106 618 dbSNP
rs1233641897 627 dbSNP
rs942863762 629 dbSNP
rs796834274 630 dbSNP
rs1413805940 631 dbSNP
rs1307551008 635 dbSNP
rs1348805686 640 dbSNP
rs915383698 642 dbSNP
rs889081240 650 dbSNP
rs990142652 657 dbSNP
rs957017152 666 dbSNP
rs576679392 668 dbSNP
rs186633606 669 dbSNP
rs1166333635 670 dbSNP
rs981830030 676 dbSNP
rs533701815 689 dbSNP
rs1340738413 698 dbSNP
rs147479928 707 dbSNP
rs1416218600 716 dbSNP
rs1023361075 726 dbSNP
rs1201137879 737 dbSNP
rs1269260796 746 dbSNP
rs1432371777 746 dbSNP
rs1164409174 754 dbSNP
rs114346554 757 dbSNP
rs535957846 775 dbSNP
rs866617837 788 dbSNP
rs1175535064 796 dbSNP
rs1368793385 803 dbSNP
rs1016009287 821 dbSNP
rs1480372443 823 dbSNP
rs1303967162 824 dbSNP
rs1237490498 829 dbSNP
rs1005119177 836 dbSNP
rs766736305 847 dbSNP
rs1214313049 849 dbSNP
rs1336606323 850 dbSNP
rs1271045248 859 dbSNP
rs1227387641 864 dbSNP
rs753069094 866 dbSNP
rs1224148880 871 dbSNP
rs1317162378 873 dbSNP
rs1292045688 875 dbSNP
rs77159955 890 dbSNP
rs1308753146 891 dbSNP
rs1263621988 901 dbSNP
rs1428978493 901 dbSNP
rs796555442 909 dbSNP
rs1221539452 914 dbSNP
rs1372064833 919 dbSNP
rs765516231 924 dbSNP
rs1443765372 939 dbSNP
rs1349490100 941 dbSNP
rs1392650683 941 dbSNP
rs1456608275 958 dbSNP
rs1325679288 964 dbSNP
rs537112387 986 dbSNP
rs1319118472 1002 dbSNP
rs550263614 1010 dbSNP
rs1247497121 1019 dbSNP
rs1312871425 1040 dbSNP
rs1320698170 1046 dbSNP
rs72807054 1050 dbSNP
rs901150132 1074 dbSNP
rs1486063200 1084 dbSNP
rs1207948054 1087 dbSNP
rs1418567066 1088 dbSNP
rs564736129 1091 dbSNP
rs1039823923 1093 dbSNP
rs1194114088 1095 dbSNP
rs1413209570 1096 dbSNP
rs942727848 1096 dbSNP
rs552926044 1098 dbSNP
rs1364660629 1099 dbSNP
rs989699746 1101 dbSNP
rs1319012983 1105 dbSNP
rs1486092655 1108 dbSNP
rs774948968 1109 dbSNP
rs1408912416 1116 dbSNP
rs1186474071 1121 dbSNP
rs1454013642 1121 dbSNP
rs558121122 1122 dbSNP
rs1393848785 1123 dbSNP
rs1308687354 1127 dbSNP
rs924242157 1130 dbSNP
rs982749426 1130 dbSNP
rs1266029149 1132 dbSNP
rs1213284815 1137 dbSNP
rs1325547353 1140 dbSNP
rs1352261203 1141 dbSNP
rs1236921358 1144 dbSNP
rs1482311211 1149 dbSNP
rs1303505464 1150 dbSNP
rs1237090376 1165 dbSNP
rs369055968 1168 dbSNP
rs1472415911 1182 dbSNP
rs970382062 1186 dbSNP
rs1301236990 1189 dbSNP
rs1199462040 1190 dbSNP
rs1490704564 1191 dbSNP
rs1157336397 1192 dbSNP
rs1023224954 1194 dbSNP
rs1470556171 1195 dbSNP
rs1383123578 1197 dbSNP
rs1464076742 1198 dbSNP
rs1299430163 1199 dbSNP
rs1350672341 1202 dbSNP
rs1387667896 1202 dbSNP
rs990529496 1203 dbSNP
rs1287277031 1205 dbSNP
rs1347181513 1205 dbSNP
rs1453332217 1206 dbSNP
rs1376106972 1207 dbSNP
rs1175622646 1209 dbSNP
rs1452710236 1210 dbSNP
rs1393154671 1211 dbSNP
rs1198153295 1213 dbSNP
rs1428881190 1214 dbSNP
rs1263598981 1215 dbSNP
rs1219650717 1216 dbSNP
rs1491156379 1216 dbSNP
rs1180306451 1217 dbSNP
rs1191018507 1217 dbSNP
rs1206692075 1217 dbSNP
rs1275470720 1217 dbSNP
rs1277827193 1217 dbSNP
rs1370644731 1217 dbSNP
rs1412150420 1217 dbSNP
rs1423653432 1217 dbSNP
rs1479076497 1217 dbSNP
rs1480964347 1217 dbSNP
rs1482813291 1217 dbSNP
rs1491135303 1217 dbSNP
rs1491262369 1217 dbSNP
rs201493587 1217 dbSNP
rs201794022 1217 dbSNP
rs567347005 1217 dbSNP
rs1491117896 1218 dbSNP
rs2394643 1218 dbSNP
rs10999160 1219 dbSNP
rs1280661994 1219 dbSNP
rs796514422 1219 dbSNP
rs1212369880 1220 dbSNP
rs1386685970 1220 dbSNP
rs1345203180 1222 dbSNP
rs1405620583 1222 dbSNP
rs1322603209 1230 dbSNP
rs1347914635 1234 dbSNP
rs963135375 1235 dbSNP
rs772547335 1236 dbSNP
rs1016417423 1237 dbSNP
rs1004746624 1238 dbSNP
rs1228814721 1241 dbSNP
rs1317278813 1243 dbSNP
rs534803392 1249 dbSNP
rs1288102117 1252 dbSNP
rs1449087877 1253 dbSNP
rs776224146 1259 dbSNP
rs1030266396 1263 dbSNP
rs80028936 1264 dbSNP
rs1186071049 1267 dbSNP
rs148579056 1284 dbSNP
rs1238733401 1296 dbSNP
rs368586029 1303 dbSNP
rs777060382 1304 dbSNP
rs1411266518 1314 dbSNP
rs1356309795 1317 dbSNP
rs997813888 1322 dbSNP
rs901181435 1325 dbSNP
rs1387750015 1339 dbSNP
rs7919647 1344 dbSNP
rs563003200 1353 dbSNP
rs1338699867 1354 dbSNP
rs1341152672 1358 dbSNP
rs1447471613 1377 dbSNP
rs35893676 1377 dbSNP
rs1401653679 1378 dbSNP
rs1353162901 1401 dbSNP
rs1229375588 1416 dbSNP
rs1267920788 1423 dbSNP
rs1327653493 1433 dbSNP
rs1171870157 1440 dbSNP
rs555393787 1448 dbSNP
rs771542379 1449 dbSNP
rs1374540640 1456 dbSNP
rs893924451 1461 dbSNP
rs115340990 1468 dbSNP
rs1182579837 1476 dbSNP
rs1257777940 1477 dbSNP
rs182319933 1485 dbSNP
rs558400152 1488 dbSNP
rs1174237656 1496 dbSNP
rs1402913855 1497 dbSNP
rs760137976 1498 dbSNP
rs533812995 1501 dbSNP
rs935533502 1509 dbSNP
rs924077565 1513 dbSNP
rs1337707592 1516 dbSNP
rs772804104 1527 dbSNP
rs1410703159 1538 dbSNP
rs1189699347 1539 dbSNP
rs1349031673 1549 dbSNP
rs375596004 1555 dbSNP
rs1257068063 1556 dbSNP
rs192875305 1559 dbSNP
rs1199338576 1567 dbSNP
rs15801 1569 dbSNP
rs990478439 1572 dbSNP
rs568822485 1582 dbSNP
rs1342119802 1587 dbSNP
rs1471487494 1591 dbSNP
rs963000025 1597 dbSNP
rs1046747 1602 dbSNP
rs1477671959 1603 dbSNP
rs774143534 1612 dbSNP
rs1335997672 1613 dbSNP
rs983582332 1616 dbSNP
rs1372496069 1621 dbSNP
rs1430581102 1631 dbSNP
rs1295331284 1634 dbSNP
rs1368991493 1636 dbSNP
rs531922662 1640 dbSNP
rs950593195 1652 dbSNP
rs538610529 1659 dbSNP
rs1330987639 1661 dbSNP
rs187876606 1662 dbSNP
rs546379379 1667 dbSNP
rs1272511255 1670 dbSNP
rs997436896 1681 dbSNP
rs1329656363 1684 dbSNP
rs183339281 1689 dbSNP
rs1017519397 1698 dbSNP
rs1481898467 1700 dbSNP
rs1398507022 1704 dbSNP
rs1168532551 1705 dbSNP
rs1450895964 1709 dbSNP
rs569736135 1709 dbSNP
rs1196686466 1728 dbSNP
rs1392012667 1735 dbSNP
rs1006918426 1750 dbSNP
rs893787215 1764 dbSNP
rs527982098 1770 dbSNP
rs1053887761 1776 dbSNP
rs749088866 1777 dbSNP
rs1390476877 1784 dbSNP
rs1385506794 1785 dbSNP
rs1323130455 1786 dbSNP
rs1366615636 1806 dbSNP
rs1228470083 1813 dbSNP
rs902680949 1814 dbSNP
rs1474041769 1817 dbSNP
rs1236335598 1824 dbSNP
rs1265751347 1853 dbSNP
rs1047044604 1862 dbSNP
rs191421674 1863 dbSNP
rs548446064 1864 dbSNP
rs1249025751 1865 dbSNP
rs916861122 1868 dbSNP
rs1055287009 1869 dbSNP
rs530325939 1876 dbSNP
rs1469138180 1886 dbSNP
rs1165732088 1900 dbSNP
rs79535872 1902 dbSNP
rs544711780 1911 dbSNP
rs7653 1916 dbSNP
rs1319225674 1917 dbSNP
rs950480063 1917 dbSNP
rs983229217 1917 dbSNP
rs1359272791 1918 dbSNP
rs1280408553 1921 dbSNP
rs1241271166 1922 dbSNP
rs923037056 1937 dbSNP
rs1334119564 1938 dbSNP
rs1320796236 1939 dbSNP
rs1329153537 1940 dbSNP
rs564920088 1940 dbSNP
rs1329702820 1943 dbSNP
rs781255175 1949 dbSNP
rs975941605 1958 dbSNP
rs1266219905 1959 dbSNP
rs1484273248 1962 dbSNP
rs1182556048 1969 dbSNP
rs964521768 1970 dbSNP
rs1422309629 1973 dbSNP
rs1184740201 1984 dbSNP
rs1394900619 1994 dbSNP
rs1327699888 2013 dbSNP
rs1157572772 2014 dbSNP
rs777772626 2015 dbSNP
rs1412577186 2027 dbSNP
rs1017550255 2036 dbSNP
rs540269883 2039 dbSNP
rs1289918630 2045 dbSNP
rs1350866780 2051 dbSNP
rs1470869186 2055 dbSNP
rs1227629134 2056 dbSNP
rs1377959129 2058 dbSNP
rs758619884 2061 dbSNP
rs1178493698 2062 dbSNP
rs1255523572 2064 dbSNP
rs1455108095 2072 dbSNP
rs752979240 2075 dbSNP
rs111664341 2076 dbSNP
rs1252883586 2080 dbSNP
rs1472467461 2081 dbSNP
rs1451462964 2082 dbSNP
rs1285202611 2084 dbSNP
rs1427809356 2096 dbSNP
rs1207136611 2104 dbSNP
rs572756695 2109 dbSNP
rs368007297 2112 dbSNP
rs1176070792 2116 dbSNP
rs557757421 2122 dbSNP
rs1046906 2126 dbSNP
rs1309465131 2145 dbSNP
rs1370827017 2155 dbSNP
rs902633505 2160 dbSNP
rs1025003961 2161 dbSNP
rs138587798 2175 dbSNP
rs1305594087 2176 dbSNP
rs1434020194 2188 dbSNP
rs10586 2200 dbSNP
rs1318501394 2205 dbSNP
rs1055317553 2211 dbSNP
rs146624210 2211 dbSNP
rs183359025 2221 dbSNP
rs1482881063 2222 dbSNP
rs942253529 2234 dbSNP
rs1489060157 2237 dbSNP
rs1191109595 2249 dbSNP
rs887453322 2265 dbSNP
rs1451996076 2275 dbSNP
rs75294498 2275 dbSNP
rs757222161 2276 dbSNP
rs556606970 2279 dbSNP
rs1326535877 2281 dbSNP
rs1351422562 2283 dbSNP
rs888925813 2285 dbSNP
rs1437002715 2289 dbSNP
rs1292865783 2292 dbSNP
rs534602768 2296 dbSNP
rs1292360462 2297 dbSNP
rs1298460637 2297 dbSNP
rs1322687983 2297 dbSNP
rs200154693 2297 dbSNP
rs71691292 2297 dbSNP
rs910351218 2297 dbSNP
rs78160828 2298 dbSNP
rs1466654152 2299 dbSNP
rs1477871971 2301 dbSNP
rs1243061703 2302 dbSNP
rs1195546013 2306 dbSNP
rs1487445284 2309 dbSNP
rs997319337 2328 dbSNP
rs12573097 2329 dbSNP
rs1405707985 2333 dbSNP
rs74139278 2334 dbSNP
rs1437191938 2358 dbSNP
rs1321233627 2359 dbSNP
rs1364530093 2362 dbSNP
rs752459354 2366 dbSNP
rs1282360146 2367 dbSNP
rs1217417203 2371 dbSNP
rs1424976895 2378 dbSNP
rs1038324489 2382 dbSNP
rs569408366 2391 dbSNP
rs1432393104 2392 dbSNP
rs1228055574 2393 dbSNP
rs966719074 2402 dbSNP
rs1025034972 2415 dbSNP
rs1209924707 2418 dbSNP
rs887112120 2420 dbSNP
rs1045936767 2422 dbSNP
rs1445914111 2427 dbSNP
rs1013595856 2428 dbSNP
rs950341885 2431 dbSNP
rs916052435 2432 dbSNP
rs1472936589 2435 dbSNP
rs895327514 2441 dbSNP
rs1415410120 2444 dbSNP
rs1033771086 2448 dbSNP
rs1006386820 2463 dbSNP
rs1336267413 2467 dbSNP
rs1055992342 2469 dbSNP
rs141765904 2482 dbSNP
rs1174498050 2496 dbSNP
rs1352704038 2499 dbSNP
rs925727063 2502 dbSNP
rs1414431966 2503 dbSNP
rs1047957469 2506 dbSNP
rs532458067 2516 dbSNP
rs977178921 2518 dbSNP
rs1202805382 2535 dbSNP
rs1280169119 2549 dbSNP
rs901478923 2553 dbSNP
rs1040152958 2557 dbSNP
rs943058128 2565 dbSNP
rs910298729 2566 dbSNP
rs1182689604 2577 dbSNP
rs966996893 2591 dbSNP
rs148064783 2612 dbSNP
rs1468562695 2614 dbSNP
rs539433750 2621 dbSNP
rs1174325638 2623 dbSNP
rs528484489 2629 dbSNP
rs1425979654 2630 dbSNP
rs1434252518 2633 dbSNP
rs561000551 2637 dbSNP
rs774196909 2638 dbSNP
rs191198499 2642 dbSNP
rs1307834403 2645 dbSNP
rs1188987926 2651 dbSNP
rs1029238555 2656 dbSNP
rs1486658542 2662 dbSNP
rs1236083497 2672 dbSNP
rs1276020084 2681 dbSNP
rs1345105394 2682 dbSNP
rs1232978843 2684 dbSNP
rs924549703 2688 dbSNP
rs749066364 2690 dbSNP
rs1205555882 2706 dbSNP
rs977343766 2710 dbSNP
rs1435952078 2714 dbSNP
rs1200902879 2716 dbSNP
rs994711763 2720 dbSNP
rs774877942 2729 dbSNP
rs1273686169 2731 dbSNP
rs1016934467 2736 dbSNP
rs1004271293 2740 dbSNP
rs1453842342 2741 dbSNP
rs539655966 2747 dbSNP
rs1315905897 2752 dbSNP
rs1430682654 2753 dbSNP
rs1167637103 2754 dbSNP
rs1045760678 2755 dbSNP
rs1324747377 2756 dbSNP
rs1388954238 2756 dbSNP
rs1370971258 2757 dbSNP
rs1014903663 2758 dbSNP
rs745738625 2767 dbSNP
rs1056360374 2768 dbSNP
rs1356773759 2770 dbSNP
rs936151224 2773 dbSNP
rs1343770007 2777 dbSNP
rs926115342 2781 dbSNP
rs1446719588 2790 dbSNP
rs959488560 2804 dbSNP
rs531732254 2810 dbSNP
rs575483745 2811 dbSNP
rs114611136 2814 dbSNP
rs1423367239 2817 dbSNP
rs952223169 2818 dbSNP
rs1249988062 2819 dbSNP
rs1476325975 2822 dbSNP
rs1192737490 2826 dbSNP
rs1371592748 2832 dbSNP
rs1459746020 2836 dbSNP
rs1164221569 2837 dbSNP
rs1394337787 2838 dbSNP
rs1460342042 2839 dbSNP
rs145212954 2840 dbSNP
rs1366728403 2845 dbSNP
rs1382364368 2850 dbSNP
rs987192982 2851 dbSNP
rs748201351 2852 dbSNP
rs577765446 2857 dbSNP
rs1265849089 2858 dbSNP
rs1333992052 2859 dbSNP
rs1211759250 2867 dbSNP
rs1233380687 2871 dbSNP
rs1465376335 2873 dbSNP
rs1259850289 2884 dbSNP
rs973730445 2888 dbSNP
rs1188599033 2894 dbSNP
rs1417607823 2902 dbSNP
rs1456228446 2902 dbSNP
rs1257224627 2904 dbSNP
rs1396920569 2905 dbSNP
rs75860062 2906 dbSNP
rs1453827167 2907 dbSNP
rs963157571 2907 dbSNP
rs1310193372 2908 dbSNP
rs1287810096 2909 dbSNP
rs1382278833 2910 dbSNP
rs1227243412 2925 dbSNP
rs1397426432 2927 dbSNP
rs1293621545 2928 dbSNP
rs1201233611 2929 dbSNP
rs1215109202 2929 dbSNP
rs1257164481 2929 dbSNP
rs1259043738 2929 dbSNP
rs1290110586 2929 dbSNP
rs1317466564 2929 dbSNP
rs1354575464 2929 dbSNP
rs1460305456 2929 dbSNP
rs1484325429 2929 dbSNP
rs1484878717 2929 dbSNP
rs386371750 2929 dbSNP
rs60858134 2929 dbSNP
rs747585329 2929 dbSNP
rs901510031 2929 dbSNP
rs1372097795 2930 dbSNP
rs553112067 2936 dbSNP
rs1040100984 2937 dbSNP
rs1175978029 2949 dbSNP
rs1014722838 2950 dbSNP
rs4746971 2958 dbSNP
rs1270142697 2962 dbSNP
rs1434371176 2966 dbSNP
rs1007222689 2969 dbSNP
rs566005085 2975 dbSNP
rs1394056703 2982 dbSNP
rs1445214801 2986 dbSNP
rs1399969757 2988 dbSNP
rs1327018667 2992 dbSNP
rs7896472 2994 dbSNP
rs1348326378 3004 dbSNP
rs1441293728 3004 dbSNP
rs1296351389 3005 dbSNP
rs1369702749 3010 dbSNP
rs568101088 3014 dbSNP
rs1054195165 3043 dbSNP
rs951490508 3044 dbSNP
rs1345916460 3048 dbSNP
rs1230909855 3056 dbSNP
rs567276145 3059 dbSNP
rs185249491 3060 dbSNP
rs1014291598 3062 dbSNP
rs894476316 3064 dbSNP
rs1469327789 3068 dbSNP
rs1034570042 3071 dbSNP
rs1000469895 3079 dbSNP
rs140225421 3081 dbSNP
rs569488454 3107 dbSNP
rs58667031 3108 dbSNP
rs1323428506 3112 dbSNP
rs754170792 3113 dbSNP
rs1237546949 3114 dbSNP
rs138547526 3121 dbSNP
rs756542835 3123 dbSNP
rs571376094 3124 dbSNP
rs1461902279 3130 dbSNP
rs1325243674 3136 dbSNP
rs546715035 3137 dbSNP
rs959347305 3138 dbSNP
rs1051956956 3139 dbSNP
rs564215503 3151 dbSNP
rs931626502 3156 dbSNP
rs180983126 3157 dbSNP
rs552460092 3158 dbSNP
rs866691947 3160 dbSNP
rs1213133068 3161 dbSNP
rs751029667 3165 dbSNP
rs973315752 3167 dbSNP
rs1292471414 3171 dbSNP
rs1213601442 3175 dbSNP
rs1271901194 3175 dbSNP
rs1336027088 3175 dbSNP
rs1466725421 3178 dbSNP
rs926727426 3180 dbSNP
rs1242291848 3181 dbSNP
rs984863735 3189 dbSNP
rs1449493238 3191 dbSNP
rs952319384 3210 dbSNP
rs76907173 3212 dbSNP
rs907695548 3214 dbSNP
rs994068670 3218 dbSNP
rs549151121 3227 dbSNP
rs761450974 3229 dbSNP
rs1392254068 3235 dbSNP
rs751038710 3246 dbSNP
rs1024360244 3247 dbSNP
rs1293093598 3250 dbSNP
rs1454532275 3254 dbSNP
rs993327115 3255 dbSNP
rs1356500448 3256 dbSNP
rs958712263 3266 dbSNP
rs1034779821 3273 dbSNP
rs1291951794 3290 dbSNP
rs1000438846 3291 dbSNP
rs904814217 3295 dbSNP
rs530833204 3298 dbSNP
rs563577118 3299 dbSNP
rs1213199496 3301 dbSNP
rs1020453992 3303 dbSNP
rs572233217 3307 dbSNP
rs890620719 3310 dbSNP
rs1051498622 3314 dbSNP
rs931736311 3315 dbSNP
rs12254764 3319 dbSNP
rs1054628623 3325 dbSNP
rs900152925 3328 dbSNP
rs577927300 3333 dbSNP
rs1486001798 3338 dbSNP
rs1399097853 3339 dbSNP
rs1287775561 3340 dbSNP
rs941950658 3341 dbSNP
rs907831638 3348 dbSNP
rs1311478631 3349 dbSNP
rs1352797651 3350 dbSNP
rs1240405415 3352 dbSNP
rs983341169 3353 dbSNP
rs1349329465 3356 dbSNP
rs555290388 3360 dbSNP
rs1281998056 3367 dbSNP
rs1348187547 3370 dbSNP
rs949209148 3373 dbSNP
rs541102615 3380 dbSNP
rs1255146635 3383 dbSNP
rs200240357 3383 dbSNP
rs1182431949 3388 dbSNP
rs189538559 3393 dbSNP
rs992899117 3397 dbSNP
rs1468645617 3410 dbSNP
rs1301044505 3411 dbSNP
rs949880363 3427 dbSNP
rs1434345796 3436 dbSNP
rs555330393 3440 dbSNP
rs1172099106 3442 dbSNP
rs1399066943 3445 dbSNP
rs1392406877 3447 dbSNP
rs536693022 3452 dbSNP
rs1334565381 3453 dbSNP
rs1034350635 3454 dbSNP
rs112092294 3455 dbSNP
rs74829699 3456 dbSNP
rs112127439 3458 dbSNP
rs11392828 3458 dbSNP
rs397826358 3458 dbSNP
rs1277830002 3462 dbSNP
rs1341172595 3480 dbSNP
rs1196207783 3482 dbSNP
rs1055613884 3488 dbSNP
rs1376161217 3489 dbSNP
rs978789406 3490 dbSNP
rs1436042465 3495 dbSNP
rs1195507528 3501 dbSNP
rs938025777 3501 dbSNP
rs968713112 3505 dbSNP
rs1191985651 3510 dbSNP
rs1174115800 3515 dbSNP
rs1375046148 3517 dbSNP
rs1462798215 3526 dbSNP
rs926610296 3532 dbSNP
rs575855666 3533 dbSNP
rs778685163 3536 dbSNP
rs954870393 3540 dbSNP
rs557250383 3546 dbSNP
rs995920802 3548 dbSNP
rs1375668312 3549 dbSNP
rs1394567282 3553 dbSNP
rs1175060177 3556 dbSNP
rs1428939457 3559 dbSNP
rs1264873363 3563 dbSNP
rs1191135208 3565 dbSNP
rs952200341 3572 dbSNP
rs1269384408 3574 dbSNP
rs900289263 3582 dbSNP
rs1215473254 3589 dbSNP
rs1273808657 3590 dbSNP
rs972284036 3592 dbSNP
rs1037322038 3594 dbSNP
rs78014098 3603 dbSNP
rs1264070071 3607 dbSNP
rs756989301 3608 dbSNP
rs547328518 3624 dbSNP
rs79307220 3625 dbSNP
rs1047615263 3631 dbSNP
rs186211911 3654 dbSNP
rs144670091 3655 dbSNP
rs567701680 3656 dbSNP
rs75116230 3657 dbSNP
rs1320521786 3658 dbSNP
rs397789588 3658 dbSNP
rs769094736 3661 dbSNP
rs937432393 3662 dbSNP
rs927325512 3664 dbSNP
rs143041273 3668 dbSNP
rs1234953064 3682 dbSNP
rs1338143452 3682 dbSNP
rs1293811703 3683 dbSNP
rs1356121642 3685 dbSNP
rs1231491293 3686 dbSNP
rs1262577844 3686 dbSNP
rs1491379453 3686 dbSNP
rs199511016 3686 dbSNP
rs35980620 3686 dbSNP
rs754437105 3686 dbSNP
rs530818233 3690 dbSNP
rs1336267388 3695 dbSNP
rs1417724524 3697 dbSNP
rs1474514778 3704 dbSNP
rs552686267 3705 dbSNP
rs895623859 3708 dbSNP
rs978841945 3715 dbSNP
rs1055645722 3717 dbSNP
rs968681990 3720 dbSNP
rs913248647 3728 dbSNP
rs1302259601 3757 dbSNP
rs1313298070 3758 dbSNP
rs1354673544 3765 dbSNP
rs1465932734 3774 dbSNP
rs989048660 3777 dbSNP
rs1317557560 3779 dbSNP
rs1238482185 3780 dbSNP
rs1284085164 3781 dbSNP
rs1211959264 3814 dbSNP
rs1049092608 3817 dbSNP
rs930623911 3820 dbSNP
rs1179460786 3823 dbSNP
rs1168009660 3824 dbSNP
rs919370732 3825 dbSNP
rs1157764273 3828 dbSNP
rs972121210 3851 dbSNP
rs563538652 3853 dbSNP
rs1436208767 3854 dbSNP
rs1173938674 3863 dbSNP
rs879483714 3869 dbSNP
rs551720658 3873 dbSNP
rs149060060 3884 dbSNP
rs1033672742 3885 dbSNP
rs1307184165 3887 dbSNP
rs996783672 3889 dbSNP
rs964914979 3897 dbSNP
rs1188985674 3902 dbSNP
rs1440267048 3915 dbSNP
rs1279964701 3918 dbSNP
rs978479451 3919 dbSNP
rs1256055570 3931 dbSNP
rs556263576 3932 dbSNP
rs967430570 3933 dbSNP
rs1005945743 3936 dbSNP
rs539041924 3937 dbSNP
rs1176065042 3940 dbSNP
rs559569022 3941 dbSNP
rs776595601 3955 dbSNP
rs1020045486 3974 dbSNP
rs1335696157 3980 dbSNP
rs1394147696 4004 dbSNP
rs1431181352 4014 dbSNP
rs1286213109 4021 dbSNP
rs1013924720 4027 dbSNP
rs886080373 4028 dbSNP
rs1047416547 4029 dbSNP
rs1311845885 4030 dbSNP
rs1461431564 4032 dbSNP
rs1013488781 4033 dbSNP
rs1447429619 4051 dbSNP
rs1441788732 4058 dbSNP
rs1402139976 4061 dbSNP
rs896436268 4062 dbSNP
rs1055055391 4066 dbSNP
rs80061729 4069 dbSNP
rs895654774 4073 dbSNP
rs755687891 4075 dbSNP
rs536394798 4080 dbSNP
rs567201229 4089 dbSNP
rs1034185021 4090 dbSNP
rs573674359 4093 dbSNP
rs1043132919 4101 dbSNP
rs1164695766 4110 dbSNP
rs145790662 4114 dbSNP
rs543373790 4118 dbSNP
rs947481087 4119 dbSNP
rs575972522 4146 dbSNP
rs1419947829 4163 dbSNP
rs989257276 4165 dbSNP
rs1427771616 4167 dbSNP
rs1168412096 4168 dbSNP
rs1367390442 4170 dbSNP
rs1419998473 4173 dbSNP
rs954976590 4183 dbSNP
rs888396474 4205 dbSNP
rs1348292294 4215 dbSNP
rs1433176853 4216 dbSNP
rs923483742 4217 dbSNP
rs1361656780 4234 dbSNP
rs1217234387 4235 dbSNP
rs1295597133 4237 dbSNP
rs1336148444 4246 dbSNP
rs1233291233 4250 dbSNP
rs1288543206 4256 dbSNP
rs1449433133 4256 dbSNP
rs1217493023 4258 dbSNP
rs1442107172 4275 dbSNP
rs1487827691 4280 dbSNP
rs1191267913 4288 dbSNP
rs1259480293 4288 dbSNP
rs1475499357 4290 dbSNP
rs1162683863 4291 dbSNP
rs778996902 4293 dbSNP
rs1198369802 4302 dbSNP
rs964826515 4303 dbSNP
rs1160069276 4307 dbSNP
rs557362841 4308 dbSNP
rs1398494999 4309 dbSNP
rs1016402175 4310 dbSNP
rs1356595580 4313 dbSNP
rs984494414 4314 dbSNP
rs1414691866 4315 dbSNP
rs1208299191 4316 dbSNP
rs950497189 4318 dbSNP
rs181397134 4319 dbSNP
rs1261420397 4323 dbSNP
rs1013633879 4329 dbSNP
rs577959668 4332 dbSNP
rs544597332 4335 dbSNP
rs1033989934 4340 dbSNP
rs368576147 4346 dbSNP
rs1235708476 4347 dbSNP
rs903675151 4351 dbSNP
rs1043603081 4352 dbSNP
rs947449899 4354 dbSNP
rs534910626 4355 dbSNP
rs529095664 4356 dbSNP
rs1175823141 4363 dbSNP
rs944734982 4364 dbSNP
rs754708823 4365 dbSNP
rs1331488092 4366 dbSNP
rs1029400406 4367 dbSNP
rs555594825 4368 dbSNP
rs933279083 4371 dbSNP
rs1195219438 4376 dbSNP
rs1338072934 4377 dbSNP
rs1443694939 4390 dbSNP
rs911978725 4398 dbSNP
rs1375627069 4403 dbSNP
rs1403282077 4407 dbSNP
rs1282104565 4408 dbSNP
rs577228488 4409 dbSNP
rs1158698070 4412 dbSNP
rs1199681113 4414 dbSNP
rs1276366475 4424 dbSNP
rs1439493166 4431 dbSNP
rs537423766 4432 dbSNP
rs975372860 4433 dbSNP
rs943653840 4436 dbSNP
rs751186784 4441 dbSNP
rs866422269 4444 dbSNP
rs12570445 4445 dbSNP
rs979394319 4446 dbSNP
rs570043938 4447 dbSNP
rs1399183102 4448 dbSNP
rs1026442195 4449 dbSNP
rs912859345 4450 dbSNP
rs991939071 4451 dbSNP
rs1262742715 4452 dbSNP
rs1218881781 4453 dbSNP
rs1371314067 4456 dbSNP
rs113555380 4457 dbSNP
rs992450684 4462 dbSNP
rs1272871937 4463 dbSNP
rs34822420 4465 dbSNP
rs960621867 4466 dbSNP
rs1239339855 4468 dbSNP
rs959814020 4473 dbSNP
rs1033379367 4474 dbSNP
rs1002101705 4475 dbSNP
rs903811159 4478 dbSNP
rs1456482291 4493 dbSNP
rs1215659712 4494 dbSNP
rs1345399836 4496 dbSNP
rs1276415680 4497 dbSNP
rs1253822686 4502 dbSNP
rs1451258818 4510 dbSNP
rs1197132026 4511 dbSNP
rs1375130500 4522 dbSNP
rs768769665 4527 dbSNP
rs1422132383 4528 dbSNP
rs1463566636 4534 dbSNP
rs1009368857 4536 dbSNP
rs749596054 4544 dbSNP
rs1385857353 4545 dbSNP
rs1053590878 4550 dbSNP
rs1327977222 4551 dbSNP
rs1401297237 4556 dbSNP
rs1358090668 4558 dbSNP
rs1158502484 4559 dbSNP
rs1277420330 4566 dbSNP
rs933434912 4566 dbSNP
rs1235170174 4567 dbSNP
rs901829819 4574 dbSNP
rs1355788597 4583 dbSNP
rs1208254077 4585 dbSNP
rs1039060743 4586 dbSNP
rs1264203055 4587 dbSNP
rs943622919 4587 dbSNP
rs386745101 4588 dbSNP
rs909504882 4591 dbSNP
rs188743175 4598 dbSNP
rs533253248 4599 dbSNP
rs1166355228 4603 dbSNP
rs1368510478 4603 dbSNP
rs1476487912 4603 dbSNP
rs1477944397 4604 dbSNP
rs1161082358 4606 dbSNP
rs1457030744 4606 dbSNP
rs929450597 4609 dbSNP
rs1036405452 4612 dbSNP
rs1400311765 4626 dbSNP
rs1008895835 4632 dbSNP
rs919444068 4635 dbSNP
rs1416518355 4637 dbSNP
rs1196130529 4642 dbSNP
rs890574402 4651 dbSNP
rs992302511 4653 dbSNP
rs1257621820 4657 dbSNP
rs566023879 4660 dbSNP
rs960510300 4662 dbSNP
rs932188357 4669 dbSNP
rs1215740843 4673 dbSNP
rs1216286970 4676 dbSNP
rs1284297295 4677 dbSNP
rs1486882016 4684 dbSNP
rs926278661 4688 dbSNP
rs980467023 4694 dbSNP
rs967713960 4695 dbSNP
rs1365140693 4696 dbSNP
rs1419951544 4697 dbSNP
rs184494189 4703 dbSNP
rs1436423926 4704 dbSNP
rs913477780 4704 dbSNP
rs1394328785 4708 dbSNP
rs77177556 4710 dbSNP
rs1239658087 4711 dbSNP
rs956717394 4713 dbSNP
rs1029527529 4719 dbSNP
rs1255851886 4723 dbSNP
rs780127190 4727 dbSNP
rs756596086 4729 dbSNP
rs1177618383 4732 dbSNP
rs369673587 4737 dbSNP
rs543131770 4743 dbSNP
rs1007483310 4744 dbSNP
rs545995373 4746 dbSNP
rs568227079 4757 dbSNP
rs1299859002 4759 dbSNP
rs1401121275 4765 dbSNP
rs781772881 4767 dbSNP
rs1332833302 4772 dbSNP
rs1414204052 4778 dbSNP
rs531342342 4784 dbSNP
rs1373475524 4789 dbSNP
rs929587905 4795 dbSNP
rs1220137904 4800 dbSNP
rs1173040638 4802 dbSNP
rs1230218085 4803 dbSNP
rs1310861087 4803 dbSNP
rs997631415 4808 dbSNP
rs1259341469 4809 dbSNP
rs1423239198 4816 dbSNP
rs1197469975 4819 dbSNP
rs192447934 4830 dbSNP
rs1469557345 4832 dbSNP
rs919400549 4837 dbSNP
rs1056672886 4839 dbSNP
rs1473857331 4840 dbSNP
rs939090163 4841 dbSNP
rs1207957481 4848 dbSNP
rs879087003 4853 dbSNP
rs1172432501 4855 dbSNP
rs1460656231 4858 dbSNP
rs1019530397 4860 dbSNP
rs189442983 4862 dbSNP
rs980519533 4867 dbSNP
rs890438723 4869 dbSNP
rs1277252584 4870 dbSNP
rs1365920040 4878 dbSNP
rs1228381127 4880 dbSNP
rs1380726555 4881 dbSNP
rs1050507282 4892 dbSNP
rs17173584 4892 dbSNP
rs996624754 4903 dbSNP
rs1255582597 4905 dbSNP
rs904602582 4908 dbSNP
rs1447979778 4909 dbSNP
rs1245828798 4924 dbSNP
rs1487351325 4925 dbSNP
rs571232537 4925 dbSNP
rs966100829 4926 dbSNP
rs149828638 4927 dbSNP
rs1168506769 4931 dbSNP
rs185780883 4938 dbSNP
rs956674646 4942 dbSNP
rs1029909145 4946 dbSNP
rs938361338 4949 dbSNP
rs926930096 4954 dbSNP
rs998065206 4955 dbSNP
rs1299221278 4959 dbSNP
rs979881642 4963 dbSNP
rs1398664877 4975 dbSNP
rs541578617 4986 dbSNP
rs1017617076 4992 dbSNP
rs1380694195 4993 dbSNP
rs1411729077 4999 dbSNP
rs1007609575 5001 dbSNP
rs1288622038 5010 dbSNP
rs751043348 5011 dbSNP
rs763592404 5023 dbSNP
rs1218456272 5028 dbSNP
rs7087051 5032 dbSNP
rs1443959476 5036 dbSNP
rs1487861820 5038 dbSNP
rs867989129 5038 dbSNP
rs1191411313 5041 dbSNP
rs994152262 5043 dbSNP
rs1181354173 5045 dbSNP
rs555955954 5048 dbSNP
rs1456319625 5049 dbSNP
rs1057124878 5050 dbSNP
rs986687680 5052 dbSNP
rs954694918 5059 dbSNP
rs1315287473 5066 dbSNP
rs1418322194 5066 dbSNP
rs1029446146 5075 dbSNP
rs939496183 5079 dbSNP
rs1250353404 5080 dbSNP
rs1448073934 5081 dbSNP
rs1221851215 5082 dbSNP
rs996184497 5086 dbSNP
rs1376401137 5095 dbSNP
rs926802400 5096 dbSNP
rs1044809017 5098 dbSNP
rs752448867 5102 dbSNP
rs374006427 5104 dbSNP
rs1244663520 5107 dbSNP
rs1214190792 5116 dbSNP
rs1442962562 5123 dbSNP
rs1378252271 5126 dbSNP
rs1300863438 5131 dbSNP
rs1235779721 5137 dbSNP
rs1312188508 5143 dbSNP
rs1010836665 5150 dbSNP
rs764844409 5154 dbSNP
rs1445015197 5157 dbSNP
rs987846305 5160 dbSNP
rs935240126 5161 dbSNP
rs75775334 5167 dbSNP
rs1174711637 5168 dbSNP
rs977079820 5174 dbSNP
rs963881307 5181 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       ::|||||| 
Target 5' -----------acUGCACUCCa 3'
1 - 11
Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
CLIP-seq Support 1 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000373242.2 | 3UTR | ACUGCACUCCAGCCUGGGUGACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1