miRTarBase - #MIRT680986 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DCAF17   
Synonyms C20orf37, C2orf37
Description DDB1 and CUL4 associated factor 17
Transcript NM_001164821   
Other Transcripts NM_025000   
Putative miRNA Targets on DCAF17
3'UTR of DCAF17
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guguuugguaauACACGACGAu 5'
Target 5' atttctggtcccTGTGTTGCTa 3'
3138 - 3159 134.00 -12.60
              ||| || || ||||| | 
Target 5' cagcAACAATCAT-TGCTGATt 3'
1168 - 1188 129.00 -9.02
miRNA  3' guguuUGGUAAUAC-----ACGACGAu 5'
               ||::|||||      |||||| 
3895 - 3921 129.00 -13.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
332273 16 ClinVar
332274 49 ClinVar
332275 106 ClinVar
332276 127 ClinVar
894111 154 ClinVar
332277 189 ClinVar
894112 212 ClinVar
332278 351 ClinVar
894506 379 ClinVar
894507 424 ClinVar
894508 433 ClinVar
332279 531 ClinVar
332280 571 ClinVar
332281 677 ClinVar
332282 678 ClinVar
332283 809 ClinVar
893083 865 ClinVar
893084 877 ClinVar
893085 927 ClinVar
332284 1006 ClinVar
893086 1035 ClinVar
893087 1121 ClinVar
893088 1125 ClinVar
332285 1166 ClinVar
332286 1249 ClinVar
893291 1371 ClinVar
332287 1485 ClinVar
893292 1522 ClinVar
332288 1532 ClinVar
893293 1541 ClinVar
332289 1555 ClinVar
893294 1558 ClinVar
893295 1693 ClinVar
332290 1748 ClinVar
332291 1842 ClinVar
894138 1966 ClinVar
332292 2067 ClinVar
894139 2114 ClinVar
332293 2184 ClinVar
332294 2203 ClinVar
894140 2242 ClinVar
332295 2293 ClinVar
894141 2304 ClinVar
332296 2313 ClinVar
894546 2319 ClinVar
332297 2341 ClinVar
332298 2349 ClinVar
332299 2381 ClinVar
332300 2426 ClinVar
332301 2430 ClinVar
332302 2474 ClinVar
893118 2536 ClinVar
893119 2592 ClinVar
332303 2624 ClinVar
332304 2748 ClinVar
332305 2776 ClinVar
332306 2796 ClinVar
893120 2944 ClinVar
893332 2948 ClinVar
332307 2965 ClinVar
332308 2972 ClinVar
332309 2977 ClinVar
332310 3007 ClinVar
893333 3023 ClinVar
893334 3108 ClinVar
332311 3113 ClinVar
893335 3171 ClinVar
332312 3454 ClinVar
894173 3552 ClinVar
332313 3704 ClinVar
332314 3706 ClinVar
332315 3713 ClinVar
894174 3812 ClinVar
332316 3830 ClinVar
332317 3836 ClinVar
332318 3881 ClinVar
COSM1009542 1 COSMIC
COSN24385432 4 COSMIC
COSN30142232 16 COSMIC
COSN31497748 19 COSMIC
COSN26972842 38 COSMIC
COSN32098724 128 COSMIC
COSN30492843 179 COSMIC
COSN31583466 187 COSMIC
COSN28866034 189 COSMIC
COSN31526689 189 COSMIC
COSN31599723 197 COSMIC
COSN9866593 272 COSMIC
COSN16992914 503 COSMIC
COSN24125415 518 COSMIC
COSN27255062 1259 COSMIC
COSN27392619 1566 COSMIC
COSN29752911 1660 COSMIC
COSN29392479 2196 COSMIC
COSN29513604 2896 COSMIC
COSN21740297 3117 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774610171 4 dbSNP
rs1318557536 9 dbSNP
rs974304955 12 dbSNP
rs146258833 16 dbSNP
rs529368169 17 dbSNP
rs111508787 21 dbSNP
rs113618728 21 dbSNP
rs775915730 25 dbSNP
rs1231169813 26 dbSNP
rs547884737 37 dbSNP
rs1329715218 41 dbSNP
rs566193671 42 dbSNP
rs1281612315 46 dbSNP
rs1263602568 48 dbSNP
rs753380867 49 dbSNP
rs917621207 51 dbSNP
rs1193446383 54 dbSNP
rs1210446033 56 dbSNP
rs756963461 57 dbSNP
rs752103736 58 dbSNP
rs749985794 61 dbSNP
rs1045338453 64 dbSNP
rs758318127 67 dbSNP
rs1281554162 70 dbSNP
rs1473891147 71 dbSNP
rs1474873933 72 dbSNP
rs780033111 75 dbSNP
rs183464591 80 dbSNP
rs754675602 81 dbSNP
rs913040289 84 dbSNP
rs781065193 87 dbSNP
rs1302216067 88 dbSNP
rs1357600889 89 dbSNP
rs1412719206 96 dbSNP
rs1438521206 104 dbSNP
rs551802113 106 dbSNP
rs1363814967 108 dbSNP
rs1350884827 109 dbSNP
rs1289167244 110 dbSNP
rs771324052 111 dbSNP
rs1277680217 114 dbSNP
rs1042844114 116 dbSNP
rs1316348077 120 dbSNP
rs770811882 124 dbSNP
rs139116642 127 dbSNP
rs1173233646 128 dbSNP
rs1345220178 130 dbSNP
rs746007838 131 dbSNP
rs1275881241 133 dbSNP
rs537382523 134 dbSNP
rs995843045 135 dbSNP
rs1029754748 137 dbSNP
rs1358270818 138 dbSNP
rs779164442 138 dbSNP
rs559176507 143 dbSNP
rs1051423486 152 dbSNP
rs1478413852 154 dbSNP
rs1485707880 155 dbSNP
rs761267211 160 dbSNP
rs768860063 161 dbSNP
rs1279250134 162 dbSNP
rs1434412774 163 dbSNP
rs1169437952 167 dbSNP
rs188188790 168 dbSNP
rs1431351192 174 dbSNP
rs1326810897 175 dbSNP
rs1296050415 176 dbSNP
rs746203651 181 dbSNP
rs772187578 181 dbSNP
rs1005531454 182 dbSNP
rs1335030601 188 dbSNP
rs142315519 189 dbSNP
rs764928097 190 dbSNP
rs1368143983 191 dbSNP
rs1233163386 192 dbSNP
rs1297844758 193 dbSNP
rs1018880916 194 dbSNP
rs1238447911 194 dbSNP
rs962858859 195 dbSNP
rs1344780109 207 dbSNP
rs963898465 209 dbSNP
rs974336214 212 dbSNP
rs1272926566 214 dbSNP
rs749932237 215 dbSNP
rs1190696630 217 dbSNP
rs1256215448 219 dbSNP
rs1475783815 219 dbSNP
rs1208034445 220 dbSNP
rs1356183279 222 dbSNP
rs1224427393 224 dbSNP
rs1251266139 229 dbSNP
rs1453851391 234 dbSNP
rs1217608968 239 dbSNP
rs1481427322 240 dbSNP
rs1189480662 241 dbSNP
rs1392214620 249 dbSNP
rs1451104549 253 dbSNP
rs1165882347 259 dbSNP
rs759826689 260 dbSNP
rs1395486137 266 dbSNP
rs1286557659 275 dbSNP
rs1295124976 275 dbSNP
rs1354675367 277 dbSNP
rs534906173 277 dbSNP
rs1405948988 279 dbSNP
rs1325408579 284 dbSNP
rs762387316 289 dbSNP
rs867895251 298 dbSNP
rs1298947910 304 dbSNP
rs1320844188 305 dbSNP
rs1461857996 307 dbSNP
rs1366829628 309 dbSNP
rs534394499 310 dbSNP
rs1023678288 317 dbSNP
rs1167481195 320 dbSNP
rs1462444829 323 dbSNP
rs1224776301 325 dbSNP
rs765891154 328 dbSNP
rs1357464390 337 dbSNP
rs1230584447 347 dbSNP
rs969443583 348 dbSNP
rs3795996 351 dbSNP
rs1035420657 357 dbSNP
rs754977913 361 dbSNP
rs947837118 362 dbSNP
rs1192739098 363 dbSNP
rs1274825415 368 dbSNP
rs1372328368 371 dbSNP
rs3795997 379 dbSNP
rs989154752 380 dbSNP
rs545393430 381 dbSNP
rs757543988 384 dbSNP
rs925129781 386 dbSNP
rs747147998 388 dbSNP
rs775631025 388 dbSNP
rs779206254 398 dbSNP
rs1307714505 399 dbSNP
rs1390201588 405 dbSNP
rs1374891764 407 dbSNP
rs746101734 410 dbSNP
rs1394452140 420 dbSNP
rs1161960601 423 dbSNP
rs1317171792 424 dbSNP
rs1341472276 429 dbSNP
rs772229487 433 dbSNP
rs1291985546 434 dbSNP
rs947214436 435 dbSNP
rs1229536253 446 dbSNP
rs192793810 451 dbSNP
rs184741043 455 dbSNP
rs921716331 470 dbSNP
rs780212623 471 dbSNP
rs1257057630 472 dbSNP
rs931710862 475 dbSNP
rs1189718123 479 dbSNP
rs891108882 483 dbSNP
rs1051467808 484 dbSNP
rs543380542 490 dbSNP
rs1474879603 497 dbSNP
rs1159778090 501 dbSNP
rs1007415356 509 dbSNP
rs1365089344 509 dbSNP
rs747441331 512 dbSNP
rs1157666860 515 dbSNP
rs1402390975 523 dbSNP
rs1018343154 526 dbSNP
rs1416532945 529 dbSNP
rs762022365 530 dbSNP
rs115676571 531 dbSNP
rs995635626 533 dbSNP
rs1411014324 539 dbSNP
rs1025911547 541 dbSNP
rs1334080921 543 dbSNP
rs951645717 546 dbSNP
rs1238363949 549 dbSNP
rs776847935 551 dbSNP
rs899380837 552 dbSNP
rs1208980876 554 dbSNP
rs1277974542 562 dbSNP
rs762232315 567 dbSNP
rs3795998 571 dbSNP
rs1252533853 572 dbSNP
rs980946168 583 dbSNP
rs1180391780 592 dbSNP
rs1377686581 593 dbSNP
rs1310616597 597 dbSNP
rs1436275198 597 dbSNP
rs1171325543 601 dbSNP
rs1207799285 607 dbSNP
rs1375270689 615 dbSNP
rs1430743549 621 dbSNP
rs1257512251 631 dbSNP
rs1300452905 634 dbSNP
rs1394880831 635 dbSNP
rs772797259 636 dbSNP
rs1023751854 637 dbSNP
rs1332877924 641 dbSNP
rs1216042974 642 dbSNP
rs573804203 656 dbSNP
rs1302893918 660 dbSNP
rs1211873630 663 dbSNP
rs1346922357 667 dbSNP
rs936514333 670 dbSNP
rs1253025313 673 dbSNP
rs987968835 675 dbSNP
rs3821084 677 dbSNP
rs115798465 678 dbSNP
rs1051673575 690 dbSNP
rs1178652657 691 dbSNP
rs533510209 697 dbSNP
rs1433743010 711 dbSNP
rs956936813 726 dbSNP
rs1394123776 733 dbSNP
rs1169472674 736 dbSNP
rs758911517 740 dbSNP
rs1450485513 743 dbSNP
rs189949476 749 dbSNP
rs766924280 751 dbSNP
rs1431054819 753 dbSNP
rs1178740783 758 dbSNP
rs1461981248 764 dbSNP
rs1294610788 767 dbSNP
rs1396814148 773 dbSNP
rs1438754690 783 dbSNP
rs1325481939 791 dbSNP
rs1461983630 794 dbSNP
rs1366135524 798 dbSNP
rs556403631 802 dbSNP
rs1276742621 808 dbSNP
rs886055108 809 dbSNP
rs891135177 812 dbSNP
rs1230873490 813 dbSNP
rs1297544579 815 dbSNP
rs942694418 817 dbSNP
rs1305520893 818 dbSNP
rs1039814085 819 dbSNP
rs1226661704 821 dbSNP
rs1403015650 830 dbSNP
rs1265904832 832 dbSNP
rs1293411865 848 dbSNP
rs898548799 849 dbSNP
rs995585073 851 dbSNP
rs1211200574 852 dbSNP
rs1025859018 855 dbSNP
rs1410387282 858 dbSNP
rs1395508931 862 dbSNP
rs887266932 864 dbSNP
rs1252006347 870 dbSNP
rs1465113802 871 dbSNP
rs1187898615 873 dbSNP
rs1462966455 873 dbSNP
rs1365811011 875 dbSNP
rs370150751 877 dbSNP
rs551788116 878 dbSNP
rs1166150809 883 dbSNP
rs1236012808 889 dbSNP
rs1420569089 892 dbSNP
rs1184256691 897 dbSNP
rs1459958049 909 dbSNP
rs576350801 911 dbSNP
rs1217715289 914 dbSNP
rs751026272 922 dbSNP
rs62183509 927 dbSNP
rs569982209 937 dbSNP
rs1245593297 947 dbSNP
rs1433207089 951 dbSNP
rs759375695 952 dbSNP
rs1227295888 964 dbSNP
rs531211176 974 dbSNP
rs978624073 987 dbSNP
rs1353635319 989 dbSNP
rs1381398463 992 dbSNP
rs1293831167 995 dbSNP
rs73976168 1006 dbSNP
rs969461411 1009 dbSNP
rs567960772 1010 dbSNP
rs1272062141 1012 dbSNP
rs1425356221 1013 dbSNP
rs1329201016 1018 dbSNP
rs931742127 1022 dbSNP
rs1239965737 1027 dbSNP
rs755912021 1030 dbSNP
rs1182747474 1032 dbSNP
rs1428308971 1032 dbSNP
rs3731979 1035 dbSNP
rs766988676 1038 dbSNP
rs1403472423 1041 dbSNP
rs867145560 1043 dbSNP
rs754514206 1044 dbSNP
rs1160327691 1049 dbSNP
rs750634308 1050 dbSNP
rs1402469807 1059 dbSNP
rs1470654733 1062 dbSNP
rs1426451280 1064 dbSNP
rs1157232342 1065 dbSNP
rs911617115 1070 dbSNP
rs553199100 1073 dbSNP
rs1221479596 1074 dbSNP
rs1452801011 1075 dbSNP
rs565430048 1076 dbSNP
rs1285773186 1085 dbSNP
rs1313320610 1087 dbSNP
rs987831297 1095 dbSNP
rs1357127097 1098 dbSNP
rs1412899521 1103 dbSNP
rs758732684 1104 dbSNP
rs933140491 1105 dbSNP
rs1373468582 1106 dbSNP
rs987812743 1113 dbSNP
rs1224902421 1116 dbSNP
rs1281715681 1121 dbSNP
rs1346856586 1123 dbSNP
rs1036025777 1124 dbSNP
rs779974974 1125 dbSNP
rs1379985205 1126 dbSNP
rs1282966811 1127 dbSNP
rs747173001 1135 dbSNP
rs181668017 1137 dbSNP
rs1187889829 1144 dbSNP
rs769039613 1152 dbSNP
rs1471200489 1153 dbSNP
rs781676498 1156 dbSNP
rs1455692209 1165 dbSNP
rs886055109 1166 dbSNP
rs1407331737 1174 dbSNP
rs1190925569 1177 dbSNP
rs1438953771 1178 dbSNP
rs1434049229 1187 dbSNP
rs1175725824 1188 dbSNP
rs905386250 1194 dbSNP
rs1377093190 1196 dbSNP
rs942704494 1208 dbSNP
rs1312205640 1209 dbSNP
rs1003683367 1213 dbSNP
rs1444280145 1218 dbSNP
rs748671292 1219 dbSNP
rs1399189545 1224 dbSNP
rs1371948898 1227 dbSNP
rs1234636690 1237 dbSNP
rs545278792 1246 dbSNP
rs1212598950 1248 dbSNP
rs1039762080 1249 dbSNP
rs745661005 1249 dbSNP
rs768693296 1249 dbSNP
rs886055110 1249 dbSNP
rs770099902 1252 dbSNP
rs1210526485 1259 dbSNP
rs1274334910 1260 dbSNP
rs1440110658 1261 dbSNP
rs1203029050 1266 dbSNP
rs1232413574 1267 dbSNP
rs1488835170 1268 dbSNP
rs1246951628 1271 dbSNP
rs1035519903 1278 dbSNP
rs1487736820 1278 dbSNP
rs1393433391 1279 dbSNP
rs780757035 1282 dbSNP
rs1270687861 1284 dbSNP
rs1400757521 1288 dbSNP
rs1172847231 1289 dbSNP
rs1419963846 1291 dbSNP
rs1411634744 1299 dbSNP
rs1010024943 1301 dbSNP
rs931411660 1303 dbSNP
rs1022290050 1310 dbSNP
rs1436836611 1322 dbSNP
rs773600080 1326 dbSNP
rs748910614 1328 dbSNP
rs1440949713 1341 dbSNP
rs968652902 1343 dbSNP
rs770671472 1347 dbSNP
rs1413099007 1351 dbSNP
rs1412171399 1355 dbSNP
rs1187619410 1361 dbSNP
rs1407164841 1367 dbSNP
rs1477747989 1370 dbSNP
rs565065854 1371 dbSNP
rs1271206130 1380 dbSNP
rs887289707 1384 dbSNP
rs1213376510 1386 dbSNP
rs1272860414 1387 dbSNP
rs1468970949 1388 dbSNP
rs1215575779 1391 dbSNP
rs755782376 1395 dbSNP
rs1344861403 1399 dbSNP
rs1468259203 1403 dbSNP
rs1273362045 1404 dbSNP
rs1217946264 1405 dbSNP
rs766946153 1406 dbSNP
rs1418063721 1407 dbSNP
rs775518305 1407 dbSNP
rs1242543149 1409 dbSNP
rs1276417535 1411 dbSNP
rs533336462 1414 dbSNP
rs1476244005 1420 dbSNP
rs1166122043 1424 dbSNP
rs1296168642 1425 dbSNP
rs1342137318 1428 dbSNP
rs1418618736 1429 dbSNP
rs1400314252 1430 dbSNP
rs1283542881 1431 dbSNP
rs879637626 1433 dbSNP
rs1166538745 1443 dbSNP
rs1391643480 1445 dbSNP
rs777591762 1446 dbSNP
rs760726025 1448 dbSNP
rs1047092141 1450 dbSNP
rs1356654672 1468 dbSNP
rs1428983288 1472 dbSNP
rs1270145133 1474 dbSNP
rs905475908 1476 dbSNP
rs540288434 1478 dbSNP
rs1271396051 1480 dbSNP
rs1334230634 1483 dbSNP
rs1422073985 1484 dbSNP
rs1205970647 1485 dbSNP
rs886055111 1485 dbSNP
rs1475243603 1487 dbSNP
rs953206369 1489 dbSNP
rs1255132039 1493 dbSNP
rs753734153 1496 dbSNP
rs1448520427 1497 dbSNP
rs987288010 1499 dbSNP
rs758537916 1501 dbSNP
rs911634671 1502 dbSNP
rs1233263523 1504 dbSNP
rs1189939006 1509 dbSNP
rs1415087058 1510 dbSNP
rs77176791 1522 dbSNP
rs1316030621 1525 dbSNP
rs1158817901 1526 dbSNP
rs537066061 1532 dbSNP
rs1398582890 1541 dbSNP
rs1322400776 1542 dbSNP
rs1312024461 1543 dbSNP
rs1318158844 1550 dbSNP
rs560178345 1555 dbSNP
rs766299946 1555 dbSNP
rs886055112 1555 dbSNP
rs920241912 1558 dbSNP
rs1417221206 1559 dbSNP
rs1291929043 1566 dbSNP
rs1354938820 1567 dbSNP
rs774025973 1568 dbSNP
rs930286669 1568 dbSNP
rs755028977 1569 dbSNP
rs926841736 1571 dbSNP
rs1418162565 1572 dbSNP
rs1204765269 1573 dbSNP
rs964699419 1573 dbSNP
rs1458810465 1575 dbSNP
rs781276466 1576 dbSNP
rs1485863204 1578 dbSNP
rs1212964444 1580 dbSNP
rs779024389 1586 dbSNP
rs1255269000 1590 dbSNP
rs756656686 1592 dbSNP
rs1181979395 1599 dbSNP
rs1365026961 1607 dbSNP
rs1056635823 1608 dbSNP
rs1468318083 1609 dbSNP
rs1157657295 1611 dbSNP
rs892580918 1616 dbSNP
rs778092477 1621 dbSNP
rs1311600191 1623 dbSNP
rs931276067 1625 dbSNP
rs1456266959 1627 dbSNP
rs1375309643 1629 dbSNP
rs1254886264 1637 dbSNP
rs1214259258 1638 dbSNP
rs1264970745 1640 dbSNP
rs1392464581 1642 dbSNP
rs1309323589 1643 dbSNP
rs1334021610 1645 dbSNP
rs1009643086 1646 dbSNP
rs749716370 1647 dbSNP
rs1433230973 1652 dbSNP
rs1242661059 1653 dbSNP
rs1348361891 1660 dbSNP
rs1047178470 1669 dbSNP
rs1310250297 1669 dbSNP
rs1236135274 1681 dbSNP
rs1239967439 1682 dbSNP
rs1277909417 1682 dbSNP
rs908589403 1683 dbSNP
rs1043774878 1689 dbSNP
rs1196274067 1692 dbSNP
rs903874983 1693 dbSNP
rs1435521084 1696 dbSNP
rs771202185 1703 dbSNP
rs1395244983 1705 dbSNP
rs1455869123 1707 dbSNP
rs1172223081 1708 dbSNP
rs1046599017 1714 dbSNP
rs773991916 1723 dbSNP
rs745526404 1724 dbSNP
rs1028923025 1729 dbSNP
rs1396685550 1733 dbSNP
rs771570661 1740 dbSNP
rs1326833852 1742 dbSNP
rs1002439413 1748 dbSNP
rs747014569 1748 dbSNP
rs1373395760 1752 dbSNP
rs1438978570 1759 dbSNP
rs1009180303 1768 dbSNP
rs1301034076 1780 dbSNP
rs1486889122 1781 dbSNP
rs1311369996 1782 dbSNP
rs1200269392 1787 dbSNP
rs1018767039 1788 dbSNP
rs768866544 1796 dbSNP
rs971856893 1804 dbSNP
rs1351716108 1807 dbSNP
rs1053933915 1808 dbSNP
rs893491724 1817 dbSNP
rs760665138 1819 dbSNP
rs1336891025 1827 dbSNP
rs1197398485 1833 dbSNP
rs114519296 1842 dbSNP
rs951719936 1845 dbSNP
rs1340601507 1849 dbSNP
rs776564383 1852 dbSNP
rs1191323805 1853 dbSNP
rs573985993 1854 dbSNP
rs1429432811 1857 dbSNP
rs1437919579 1861 dbSNP
rs939614007 1862 dbSNP
rs541223174 1864 dbSNP
rs1371778764 1865 dbSNP
rs769952651 1872 dbSNP
rs764957607 1873 dbSNP
rs1396749297 1878 dbSNP
rs1439046490 1879 dbSNP
rs549116176 1880 dbSNP
rs1293110673 1883 dbSNP
rs1366686633 1888 dbSNP
rs1171837647 1890 dbSNP
rs1192986938 1893 dbSNP
rs1382512134 1894 dbSNP
rs1297658496 1895 dbSNP
rs1324679932 1897 dbSNP
rs1487451905 1904 dbSNP
rs1280966759 1907 dbSNP
rs1201442734 1921 dbSNP
rs1017462563 1922 dbSNP
rs964530080 1925 dbSNP
rs1416173126 1927 dbSNP
rs773607342 1929 dbSNP
rs1277063688 1942 dbSNP
rs973332929 1946 dbSNP
rs1211460075 1948 dbSNP
rs1264452010 1949 dbSNP
rs1486399111 1950 dbSNP
rs1334400240 1953 dbSNP
rs920469294 1959 dbSNP
rs1395026132 1961 dbSNP
rs115869663 1962 dbSNP
rs1260068574 1963 dbSNP
rs1477803922 1964 dbSNP
rs569108215 1966 dbSNP
rs1043847841 1968 dbSNP
rs1420145196 1970 dbSNP
rs1459907225 1974 dbSNP
rs1164353509 1975 dbSNP
rs1466102408 1977 dbSNP
rs1377231937 1980 dbSNP
rs755189449 1981 dbSNP
rs1455531597 1982 dbSNP
rs767557924 1988 dbSNP
rs1358352436 1991 dbSNP
rs908533540 1997 dbSNP
rs1399377612 1998 dbSNP
rs1293775275 2004 dbSNP
rs766836121 2008 dbSNP
rs545198408 2010 dbSNP
rs1188515370 2011 dbSNP
rs949519645 2015 dbSNP
rs1226050897 2020 dbSNP
rs1200877010 2031 dbSNP
rs1311587681 2034 dbSNP
rs996853009 2035 dbSNP
rs1317202987 2036 dbSNP
rs1217456849 2044 dbSNP
rs1259388593 2048 dbSNP
rs1216326103 2050 dbSNP
rs1220119469 2054 dbSNP
rs1488140904 2055 dbSNP
rs1212267031 2059 dbSNP
rs1260150165 2061 dbSNP
rs982590988 2062 dbSNP
rs1474276442 2063 dbSNP
rs926824726 2064 dbSNP
rs1408807015 2065 dbSNP
rs759321882 2066 dbSNP
rs886055113 2067 dbSNP
rs752065485 2068 dbSNP
rs755750047 2069 dbSNP
rs1418819132 2070 dbSNP
rs1313411875 2074 dbSNP
rs1416071015 2079 dbSNP
rs889060136 2083 dbSNP
rs145934835 2084 dbSNP
rs756605585 2090 dbSNP
rs894027485 2091 dbSNP
rs1366911133 2096 dbSNP
rs1019254131 2097 dbSNP
rs1042095533 2099 dbSNP
rs139529937 2114 dbSNP
rs1197023996 2115 dbSNP
rs1379516941 2116 dbSNP
rs1008677186 2118 dbSNP
rs1453780784 2126 dbSNP
rs749770451 2131 dbSNP
rs1235410257 2132 dbSNP
rs1353885149 2134 dbSNP
rs757589748 2135 dbSNP
rs1240691867 2139 dbSNP
rs1282901059 2142 dbSNP
rs1441265018 2144 dbSNP
rs951793015 2145 dbSNP
rs1209990215 2148 dbSNP
rs1375885835 2149 dbSNP
rs779174983 2150 dbSNP
rs745500589 2153 dbSNP
rs1350358292 2156 dbSNP
rs549364274 2158 dbSNP
rs561245876 2159 dbSNP
rs961273998 2160 dbSNP
rs950649434 2161 dbSNP
rs1174091497 2162 dbSNP
rs1385937068 2162 dbSNP
rs1396657456 2163 dbSNP
rs1321191063 2172 dbSNP
rs1440486538 2173 dbSNP
rs1412737860 2175 dbSNP
rs983753930 2180 dbSNP
rs1354645788 2181 dbSNP
rs1015623163 2182 dbSNP
rs73976170 2184 dbSNP
rs1328891688 2185 dbSNP
rs1375770298 2189 dbSNP
rs1441180247 2192 dbSNP
rs1449376257 2194 dbSNP
rs546776106 2199 dbSNP
rs886055114 2203 dbSNP
rs1352465594 2205 dbSNP
rs1306142888 2210 dbSNP
rs926670320 2221 dbSNP
rs1343280169 2227 dbSNP
rs1219178539 2229 dbSNP
rs1220716822 2232 dbSNP
rs938189326 2239 dbSNP
rs1274272098 2241 dbSNP
rs1309335857 2242 dbSNP
rs1196759864 2243 dbSNP
rs1237624233 2252 dbSNP
rs571537121 2255 dbSNP
rs1469126000 2259 dbSNP
rs1195699452 2261 dbSNP
rs1254681061 2267 dbSNP
rs989643272 2272 dbSNP
rs915408684 2280 dbSNP
rs1476896014 2285 dbSNP
rs1220986267 2287 dbSNP
rs767339694 2287 dbSNP
rs1171932777 2288 dbSNP
rs1258868577 2292 dbSNP
rs373833929 2293 dbSNP
rs538868578 2296 dbSNP
rs1411580937 2301 dbSNP
rs186143382 2304 dbSNP
rs1398887136 2308 dbSNP
rs569741110 2310 dbSNP
rs768361114 2312 dbSNP
rs777311799 2313 dbSNP
rs1452366383 2321 dbSNP
rs776654201 2328 dbSNP
rs1436120273 2329 dbSNP
rs536596866 2330 dbSNP
rs1260572604 2333 dbSNP
rs888428 2341 dbSNP
rs1364770727 2345 dbSNP
rs1217331632 2346 dbSNP
rs769595023 2348 dbSNP
rs112519318 2349 dbSNP
rs1277578778 2349 dbSNP
rs1257549661 2350 dbSNP
rs1335496831 2357 dbSNP
rs1215824627 2359 dbSNP
rs1476834260 2364 dbSNP
rs994585312 2366 dbSNP
rs1447075428 2368 dbSNP
rs1340198868 2371 dbSNP
rs534948599 2373 dbSNP
rs1449671333 2375 dbSNP
rs1197981160 2377 dbSNP
rs1450388945 2380 dbSNP
rs553179661 2381 dbSNP
rs1478787377 2387 dbSNP
rs1456988131 2391 dbSNP
rs886259747 2396 dbSNP
rs1191395141 2397 dbSNP
rs1426371570 2398 dbSNP
rs1170843341 2408 dbSNP
rs1160907293 2410 dbSNP
rs1422313212 2411 dbSNP
rs1475224009 2412 dbSNP
rs1166648972 2415 dbSNP
rs1388054480 2418 dbSNP
rs1392479418 2422 dbSNP
rs12151641 2426 dbSNP
rs1319468256 2428 dbSNP
rs778932293 2430 dbSNP
rs760686279 2432 dbSNP
rs1278078737 2434 dbSNP
rs1356183594 2435 dbSNP
rs970755112 2439 dbSNP
rs149691298 2448 dbSNP
rs1282489748 2454 dbSNP
rs1355998255 2456 dbSNP
rs368249337 2460 dbSNP
rs1284758236 2461 dbSNP
rs1230264730 2462 dbSNP
rs993328227 2463 dbSNP
rs745784916 2467 dbSNP
rs772200637 2468 dbSNP
rs1214396422 2469 dbSNP
rs1302674781 2470 dbSNP
rs1262298072 2472 dbSNP
rs1027435305 2473 dbSNP
rs57999878 2474 dbSNP
rs1189085300 2476 dbSNP
rs770193682 2480 dbSNP
rs1340344901 2484 dbSNP
rs1332635466 2490 dbSNP
rs1472284011 2493 dbSNP
rs560982558 2494 dbSNP
rs540049401 2496 dbSNP
rs1158764507 2498 dbSNP
rs1410660165 2500 dbSNP
rs1418184342 2508 dbSNP
rs1001893060 2511 dbSNP
rs1298137659 2512 dbSNP
rs1376658926 2513 dbSNP
rs754327552 2523 dbSNP
rs915441365 2525 dbSNP
rs1339928313 2536 dbSNP
rs1242746328 2543 dbSNP
rs145373123 2546 dbSNP
rs1267271728 2550 dbSNP
rs960418697 2551 dbSNP
rs978387949 2558 dbSNP
rs912093644 2567 dbSNP
rs757742700 2571 dbSNP
rs992202409 2575 dbSNP
rs1285024079 2585 dbSNP
rs1485995766 2587 dbSNP
rs1312274169 2589 dbSNP
rs748228250 2592 dbSNP
rs966949652 2593 dbSNP
rs1379589825 2595 dbSNP
rs1441285601 2596 dbSNP
rs1487189078 2613 dbSNP
rs1182086951 2616 dbSNP
rs1310384544 2619 dbSNP
rs1239557594 2621 dbSNP
rs1394925948 2622 dbSNP
rs886055115 2624 dbSNP
rs979630744 2627 dbSNP
rs1437420762 2634 dbSNP
rs1158494397 2635 dbSNP
rs1396040103 2638 dbSNP
rs1468076620 2639 dbSNP
rs925423896 2643 dbSNP
rs533754425 2645 dbSNP
rs758118215 2646 dbSNP
rs779786259 2647 dbSNP
rs1375027397 2650 dbSNP
rs1349016367 2651 dbSNP
rs1446317220 2655 dbSNP
rs985555336 2658 dbSNP
rs1441098072 2659 dbSNP
rs746673241 2661 dbSNP
rs546863765 2667 dbSNP
rs1235355781 2679 dbSNP
rs886290970 2690 dbSNP
rs1005084715 2692 dbSNP
rs1343693121 2694 dbSNP
rs1193049371 2698 dbSNP
rs1444930622 2701 dbSNP
rs1195932606 2708 dbSNP
rs1488850782 2709 dbSNP
rs1259421338 2713 dbSNP
rs1157676916 2716 dbSNP
rs1456198654 2719 dbSNP
rs944053925 2720 dbSNP
rs148758818 2724 dbSNP
rs907149269 2730 dbSNP
rs897774070 2735 dbSNP
rs1254040486 2737 dbSNP
rs1239843055 2739 dbSNP
rs1001457082 2741 dbSNP
rs1289781040 2741 dbSNP
rs929214777 2743 dbSNP
rs1033666463 2747 dbSNP
rs886055116 2748 dbSNP
rs959355235 2754 dbSNP
rs1421174220 2755 dbSNP
rs773555321 2756 dbSNP
rs1394779994 2757 dbSNP
rs1172997684 2764 dbSNP
rs1022315829 2768 dbSNP
rs1001965149 2770 dbSNP
rs16859404 2776 dbSNP
rs1197320466 2783 dbSNP
rs567330302 2785 dbSNP
rs1368077422 2786 dbSNP
rs1307366458 2792 dbSNP
rs17221346 2796 dbSNP
rs966716591 2804 dbSNP
rs1330516152 2806 dbSNP
rs1348993972 2809 dbSNP
rs774736126 2811 dbSNP
rs974977433 2814 dbSNP
rs1259483120 2815 dbSNP
rs1315469944 2820 dbSNP
rs1197654830 2822 dbSNP
rs556334670 2824 dbSNP
rs1401285867 2825 dbSNP
rs1340807150 2829 dbSNP
rs569647129 2829 dbSNP
rs866562135 2832 dbSNP
rs1217726673 2834 dbSNP
rs921610175 2836 dbSNP
rs1489681284 2838 dbSNP
rs1208491137 2839 dbSNP
rs1013292648 2842 dbSNP
rs1429672808 2843 dbSNP
rs1196444539 2845 dbSNP
rs1421605471 2848 dbSNP
rs1465517366 2851 dbSNP
rs1477514009 2859 dbSNP
rs1198654506 2860 dbSNP
rs930271306 2864 dbSNP
rs537189202 2866 dbSNP
rs548684828 2867 dbSNP
rs752396778 2874 dbSNP
rs1001135273 2879 dbSNP
rs189368440 2882 dbSNP
rs1258743419 2883 dbSNP
rs1445448647 2883 dbSNP
rs75894811 2883 dbSNP
rs1201358671 2887 dbSNP
rs940444681 2889 dbSNP
rs1046016532 2890 dbSNP
rs985991119 2892 dbSNP
rs1337775772 2894 dbSNP
rs1217429323 2901 dbSNP
rs1293359687 2902 dbSNP
rs912685245 2904 dbSNP
rs1242125830 2908 dbSNP
rs1276966188 2916 dbSNP
rs1265278462 2919 dbSNP
rs1160354984 2926 dbSNP
rs1001887058 2927 dbSNP
rs1377414356 2931 dbSNP
rs1486370392 2935 dbSNP
rs1334624207 2936 dbSNP
rs965835850 2944 dbSNP
rs1261574297 2945 dbSNP
rs972785459 2948 dbSNP
rs1305117016 2956 dbSNP
rs1333286584 2956 dbSNP
rs1466027100 2957 dbSNP
rs1188829337 2961 dbSNP
rs1416013015 2962 dbSNP
rs886055117 2965 dbSNP
rs918566962 2965 dbSNP
rs762585568 2966 dbSNP
rs1164282613 2967 dbSNP
rs1474574829 2968 dbSNP
rs576169953 2972 dbSNP
rs78561668 2977 dbSNP
rs1444397147 2983 dbSNP
rs1241614222 2986 dbSNP
rs999596128 2996 dbSNP
rs909101153 2997 dbSNP
rs1299972992 3000 dbSNP
rs767979485 3001 dbSNP
rs374810983 3007 dbSNP
rs886055118 3007 dbSNP
rs760915283 3015 dbSNP
rs1302964850 3017 dbSNP
rs764126945 3018 dbSNP
rs1224526004 3019 dbSNP
rs75833923 3023 dbSNP
rs1284417620 3026 dbSNP
rs1311521685 3026 dbSNP
rs1354873223 3028 dbSNP
rs1380329949 3029 dbSNP
rs1230710920 3037 dbSNP
rs1242841180 3038 dbSNP
rs1284316003 3040 dbSNP
rs1353669187 3053 dbSNP
rs975010091 3057 dbSNP
rs1212193760 3063 dbSNP
rs1328332436 3064 dbSNP
rs1239305642 3067 dbSNP
rs557162290 3074 dbSNP
rs1029209617 3076 dbSNP
rs1055364460 3083 dbSNP
rs575635525 3084 dbSNP
rs1482293024 3086 dbSNP
rs544901449 3089 dbSNP
rs543136730 3093 dbSNP
rs984490390 3096 dbSNP
rs1424200705 3098 dbSNP
rs896270167 3107 dbSNP
rs1180866096 3109 dbSNP
rs1441768452 3109 dbSNP
rs1160311972 3110 dbSNP
rs1440901793 3111 dbSNP
rs17221367 3113 dbSNP
rs1042115157 3115 dbSNP
rs572867368 3116 dbSNP
rs981202979 3117 dbSNP
rs540242814 3129 dbSNP
rs902193930 3131 dbSNP
rs1221314661 3136 dbSNP
rs1419076932 3149 dbSNP
rs1176642683 3152 dbSNP
rs565191054 3160 dbSNP
rs1445089159 3164 dbSNP
rs1287951360 3165 dbSNP
rs865846361 3171 dbSNP
rs1240579857 3183 dbSNP
rs1178628646 3192 dbSNP
rs937153720 3208 dbSNP
rs1055644001 3209 dbSNP
rs763672996 3209 dbSNP
rs1307591457 3210 dbSNP
rs765730468 3211 dbSNP
rs893023810 3213 dbSNP
rs1324238617 3219 dbSNP
rs1404608103 3221 dbSNP
rs1220344504 3226 dbSNP
rs1281256690 3231 dbSNP
rs947300274 3247 dbSNP
rs1044137475 3251 dbSNP
rs1310527860 3255 dbSNP
rs1407625220 3258 dbSNP
rs954273124 3259 dbSNP
rs1209574167 3270 dbSNP
rs1007091158 3271 dbSNP
rs1459293380 3274 dbSNP
rs1198035349 3277 dbSNP
rs1020185626 3278 dbSNP
rs532886693 3286 dbSNP
rs1217153824 3289 dbSNP
rs965516202 3290 dbSNP
rs1438809489 3292 dbSNP
rs1365692144 3295 dbSNP
rs902011327 3299 dbSNP
rs1427108192 3302 dbSNP
rs572264674 3307 dbSNP
rs1174792768 3309 dbSNP
rs1400362302 3310 dbSNP
rs1466882541 3311 dbSNP
rs973249185 3316 dbSNP
rs750945995 3317 dbSNP
rs758777886 3328 dbSNP
rs1437555300 3333 dbSNP
rs1276957155 3334 dbSNP
rs952725289 3336 dbSNP
rs1344992847 3339 dbSNP
rs780589850 3339 dbSNP
rs760034253 3341 dbSNP
rs952313198 3346 dbSNP
rs1217924181 3349 dbSNP
rs1320037024 3360 dbSNP
rs544468117 3363 dbSNP
rs909173262 3364 dbSNP
rs750021840 3365 dbSNP
rs181938173 3378 dbSNP
rs1222106309 3380 dbSNP
rs1054996078 3392 dbSNP
rs1477028228 3394 dbSNP
rs1190502168 3400 dbSNP
rs1423756298 3405 dbSNP
rs1204538758 3408 dbSNP
rs1264515713 3416 dbSNP
rs757732239 3416 dbSNP
rs1478476569 3419 dbSNP
rs1487282765 3421 dbSNP
rs1168108614 3425 dbSNP
rs1399162945 3426 dbSNP
rs1405585975 3433 dbSNP
rs780733984 3436 dbSNP
rs779410799 3438 dbSNP
rs539235134 3443 dbSNP
rs1299303583 3453 dbSNP
rs747674263 3454 dbSNP
rs928367307 3463 dbSNP
rs1262428321 3468 dbSNP
rs1221536037 3471 dbSNP
rs1321518865 3471 dbSNP
rs758748448 3471 dbSNP
rs1215416133 3472 dbSNP
rs768059186 3503 dbSNP
rs1277631227 3507 dbSNP
rs1357369940 3508 dbSNP
rs879141809 3509 dbSNP
rs1361495753 3514 dbSNP
rs569269640 3516 dbSNP
rs1268841171 3519 dbSNP
rs949218997 3520 dbSNP
rs185157481 3526 dbSNP
rs1449613800 3529 dbSNP
rs1221656402 3536 dbSNP
rs1263737102 3539 dbSNP
rs142460755 3543 dbSNP
rs914386439 3545 dbSNP
rs530498334 3548 dbSNP
rs1170736253 3550 dbSNP
rs947332859 3552 dbSNP
rs1410621774 3556 dbSNP
rs1416931823 3561 dbSNP
rs1321877561 3563 dbSNP
rs373344754 3566 dbSNP
rs566345467 3566 dbSNP
rs936359696 3568 dbSNP
rs1053440385 3579 dbSNP
rs1405069877 3585 dbSNP
rs147950025 3586 dbSNP
rs1260123277 3590 dbSNP
rs1205285579 3592 dbSNP
rs1363070112 3593 dbSNP
rs1398690417 3596 dbSNP
rs1297711686 3599 dbSNP
rs749242448 3604 dbSNP
rs770670358 3606 dbSNP
rs1019842902 3621 dbSNP
rs1271147360 3623 dbSNP
rs1282574900 3624 dbSNP
rs1384007019 3625 dbSNP
rs1354007395 3630 dbSNP
rs1314742053 3637 dbSNP
rs1245044664 3641 dbSNP
rs901353658 3650 dbSNP
rs774169442 3651 dbSNP
rs1298308861 3654 dbSNP
rs1330707225 3656 dbSNP
rs1214337446 3661 dbSNP
rs1025688503 3662 dbSNP
rs1461040359 3671 dbSNP
rs996260545 3672 dbSNP
rs1166483973 3675 dbSNP
rs1442457469 3679 dbSNP
rs752201590 3683 dbSNP
rs1345910935 3690 dbSNP
rs887932240 3696 dbSNP
rs1443617934 3697 dbSNP
rs747209139 3702 dbSNP
rs9789572 3704 dbSNP
rs577520268 3706 dbSNP
rs1363929783 3711 dbSNP
rs74780004 3713 dbSNP
rs1403005966 3715 dbSNP
rs991156839 3726 dbSNP
rs962019492 3727 dbSNP
rs1332256313 3731 dbSNP
rs1249632292 3732 dbSNP
rs1311359741 3736 dbSNP
rs1319613018 3754 dbSNP
rs1340161774 3755 dbSNP
rs1224243382 3759 dbSNP
rs1447750810 3768 dbSNP
rs571444202 3771 dbSNP
rs190749922 3776 dbSNP
rs1378780447 3777 dbSNP
rs1237913367 3790 dbSNP
rs1360391728 3793 dbSNP
rs747211504 3798 dbSNP
rs1035759256 3802 dbSNP
rs1291566860 3802 dbSNP
rs768818183 3802 dbSNP
rs1260009164 3806 dbSNP
rs1356549150 3815 dbSNP
rs1308345742 3819 dbSNP
rs141563827 3820 dbSNP
rs773543654 3829 dbSNP
rs59827170 3830 dbSNP
rs1460628949 3831 dbSNP
rs936390939 3834 dbSNP
rs886055119 3836 dbSNP
rs1053469636 3838 dbSNP
rs1438145329 3841 dbSNP
rs1161508597 3845 dbSNP
rs1411706030 3849 dbSNP
rs977743895 3849 dbSNP
rs1378774401 3850 dbSNP
rs1446746587 3850 dbSNP
rs1479286059 3855 dbSNP
rs766820600 3866 dbSNP
rs754667938 3881 dbSNP
rs1192963584 3886 dbSNP
rs1466360867 3891 dbSNP
rs181080251 3900 dbSNP
rs1402205538 3902 dbSNP
rs1490590921 3904 dbSNP
rs1444239790 3905 dbSNP
rs1268439381 3908 dbSNP
rs943944999 3909 dbSNP
rs752404121 3911 dbSNP
rs1331677588 3915 dbSNP
rs536073936 3916 dbSNP
rs889475988 3917 dbSNP
rs1272594862 3922 dbSNP
rs554603193 3928 dbSNP
rs1198888222 3934 dbSNP
rs1164458549 3935 dbSNP
rs1238992671 3937 dbSNP
rs1360072538 3937 dbSNP
rs1315619717 3938 dbSNP
rs1418890469 3939 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauacaCGACGAu 5'
Target 5' ---guuaugaauaaaGCUGCUa 3'
1 - 19
Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
CLIP-seq Support 1 for dataset GSM1067870
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000375255.3 | 3UTR | GUUAUGAAUAAAGCUGCUAUGAACAUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.341 8.0e-4 0.248 1.2e-2 83 Click to see details
GSE42095 Differentiated embryonic stem cells 0.57 2.3e-3 0.562 2.6e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.576 3.9e-3 0.764 4.4e-5 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.396 2.8e-2 -0.440 1.6e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.428 3.0e-2 -0.426 3.1e-2 20 Click to see details
GSE19783 ER- ER- breast cancer 0.182 5.4e-2 0.217 2.7e-2 79 Click to see details
GSE19536 Breast cancer 0.16 5.6e-2 0.145 7.5e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.316 6.2e-2 0.279 8.8e-2 25 Click to see details
GSE17498 Multiple myeloma -0.239 6.9e-2 -0.316 2.3e-2 40 Click to see details
GSE28260 Renal cortex and medulla -0.409 8.3e-2 -0.236 2.2e-1 13 Click to see details
GSE17306 Multiple myeloma 0.167 1.3e-1 0.015 4.6e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.137 1.4e-1 -0.211 4.7e-2 64 Click to see details
GSE19350 CNS germ cell tumors 0.339 1.4e-1 -0.035 4.6e-1 12 Click to see details
GSE27834 Pluripotent stem cells -0.275 1.5e-1 -0.229 2.0e-1 16 Click to see details
GSE38226 Liver fibrosis 0.184 2.1e-1 0.156 2.5e-1 21 Click to see details
GSE28544 Breast cancer 0.1 3.2e-1 0.493 7.2e-3 24 Click to see details
GSE14794 Lymphoblastoid cells -0.039 3.6e-1 -0.032 3.8e-1 90 Click to see details
GSE21849 B cell lymphoma 0.069 3.6e-1 0.109 2.9e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.024 4.5e-1 -0.103 2.9e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.015 4.7e-1 -0.031 4.4e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.015 4.7e-1 -0.031 4.4e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.637 0 -0.600 0 18 Click to see details
HNSC 0.346 0.01 0.372 0.01 42 Click to see details
PAAD 0.912 0.04 0.800 0.1 4 Click to see details
UCEC 0.396 0.05 0.239 0.16 19 Click to see details
KICH -0.332 0.05 -0.295 0.08 25 Click to see details
BRCA -0.161 0.07 -0.196 0.04 84 Click to see details
CHOL -0.516 0.08 -0.200 0.3 9 Click to see details
KIRP -0.236 0.1 -0.242 0.09 32 Click to see details
KIRC -0.149 0.11 -0.181 0.07 68 Click to see details
THCA -0.153 0.12 -0.301 0.01 59 Click to see details
PCPG -0.864 0.17 -1.000 0.5 3 Click to see details
LIHC -0.113 0.22 -0.071 0.31 49 Click to see details
STAD -0.129 0.24 -0.086 0.32 32 Click to see details
LUSC 0.087 0.3 0.133 0.21 38 Click to see details
COAD -0.208 0.31 -0.619 0.05 8 Click to see details
ESCA 0.16 0.32 0.218 0.26 11 Click to see details
PRAD 0.066 0.32 0.010 0.47 50 Click to see details
LUAD -0.046 0.44 0.028 0.47 12 Click to see details
CESC 0.086 0.47 0.500 0.33 3 Click to see details
CESC 0.086 0.47 0.500 0.33 3 Click to see details
CESC 0.086 0.47 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
694 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 4 4
MIRT000285 CCND2 cyclin D2 4 7
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 4 5
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 6 8
MIRT001228 CCNE1 cyclin E1 7 10
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 4 4
MIRT003330 RPS6 ribosomal protein S6 0 1
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 3 6
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 4 3
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 7 17
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 6 3
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 2 2
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 4 3
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 2 5
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 2 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057514 CEP55 centrosomal protein 55 2 8
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061244 AMOTL1 angiomotin like 1 2 12
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066312 USP15 ubiquitin specific peptidase 15 2 2
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075249 SNTB2 syntrophin beta 2 2 4
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079655 NAPG NSF attachment protein gamma 2 12
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087424 ZNRF3 zinc and ring finger 3 2 2
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 2 6
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096234 CANX calnexin 2 2
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 3 8
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100896 CD2AP CD2 associated protein 2 2
MIRT102434 CALU calumenin 2 3
MIRT102632 UBN2 ubinuclein 2 2 11
MIRT102971 EN2 engrailed homeobox 2 2 6
MIRT103092 MAFK MAF bZIP transcription factor K 2 5
MIRT103856 FOXK1 forkhead box K1 2 3
MIRT104015 USP42 ubiquitin specific peptidase 42 2 6
MIRT106292 ZFHX4 zinc finger homeobox 4 2 6
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 2 2
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112969 LUZP1 leucine zipper protein 1 2 6
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117655 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 2 3
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 2 9
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 2 3
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 2 3
MIRT154043 RASSF2 Ras association domain family member 2 2 2
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158519 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 2 3
MIRT165883 CREBRF CREB3 regulatory factor 2 3
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189961 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190184 GPR180 G protein-coupled receptor 180 2 6
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191625 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 2 2
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204623 MOB4 MOB family member 4, phocein 2 8
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206020 NUP50 nucleoporin 50 2 7
MIRT211199 FGF2 fibroblast growth factor 2 2 4
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217743 TBPL1 TATA-box binding protein like 1 2 3
MIRT223681 FZD6 frizzled class receptor 6 2 6
MIRT224965 BAG4 BCL2 associated athanogene 4 2 2
MIRT229343 ZNF449 zinc finger protein 449 2 2
MIRT229860 YIPF6 Yip1 domain family member 6 2 2
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 2 8
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT247236 ELK4 ELK4, ETS transcription factor 2 4
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249449 ZNF691 zinc finger protein 691 2 4
MIRT251487 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255333 SRPRB SRP receptor beta subunit 2 5
MIRT256305 CDC42SE2 CDC42 small effector 2 2 2
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265056 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265076 CHEK1 checkpoint kinase 1 2 3
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 2 2
MIRT273665 HOXC8 homeobox C8 2 2
MIRT274741 RAB3IP RAB3A interacting protein 2 2
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 2 2
MIRT294283 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295810 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300100 STRADB STE20-related kinase adaptor beta 2 2
MIRT300992 MTMR3 myotubularin related protein 3 2 2
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302825 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307141 CTDSPL CTD small phosphatase like 2 4
MIRT313675 ITGA2 integrin subunit alpha 2 2 2
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320626 ZNRF2 zinc and ring finger 2 2 2
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 2 6