miRTarBase - #MIRT676430 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLEKHM3   
Synonyms DAPR, PLEKHM1L
Description pleckstrin homology domain containing M3
Transcript NM_001080475   
Expression
Putative miRNA Targets on PLEKHM3
3'UTR of PLEKHM3
(miRNA target sites are highlighted)
>PLEKHM3|NM_001080475|3'UTR
   1 CTCCAGCCGACCCGAAGGCCAGGGATTCACCAATCAACAATCCATCAGCCCCAGAGCGGCCTCCTAACTAGCCAGTTAGA
  81 CCCCTTTGGAAGAAGAGTATGTATCCTCTTCAACTAGATATAGATATATATATTTATTTATATATACGCAAATACCTATA
 161 CGTCCTGTACGTATGCTCTGTGTACATCATTGTCCAGACGATCCACAGAACCTCTGTGGCTCGAGAAACTACCAATAGCT
 241 GGATTACACTTAGCCAAGAATTTCAGCTGCTTGCTCCCAGACAAAACGTGGTATACACAATGCTTTATAGTTCAGACTTT
 321 TTTTTTCTCTCTGTCTCTCGGTACATTTTATTACCCAAGACACAAAAGGAAGCATTTCCTGCACAAAACAGTGCTTTAGG
 401 TTATTTTTGTGTTATTTATTTTTAGCCTTCACAGAGGCTGAGGTAACTGAGGCAGGCACCCATCATCATCTGTTTCATAA
 481 GAAAACCTTCAAAACACAAGAGACTGCTGGGTCCTTCCAGGACCTGGTGTCCGTGGCGCTCCCGCCTCAGTTCCTCCTGT
 561 GGAGGCGGGGAATCACGTAAGCAGAGCCGATGGCTGGAAACAGGAGCCAAGCCCCCTCTGACAGAAAGCATACACCCCTC
 641 ATTTATGAGGAGGGCTGGTTCTGGTTTTGAAGTTAATCTCAGAAGTTTTTTTCCTGAGAAGAGAAGAAACCTCTGCGACC
 721 AATAACTGCGTGTTGTCGGTCTGTTTTTCGGTACTAATCCCATCACCCACCTAATGATGTGACGCTCCACCGTGTTTTCC
 801 AGGCTGTACACATGGCTTTCTTAACAGTTTTCAACGGGTGCCCATGGTTGATATTTATGATTTTTTTCATGATGCTGGCC
 881 GGAGGAAATGTCCTGGGGTGGTTGTTAAAGACATCGTCGTGTAGACTGGTAGATAAGGCTATCTAGTAAGTATATTCCCA
 961 AAGAGGGTCGTTTTAGTTTCTTTTCTCAGAATCCTGTGGAGGCAGTTCCTACCTATTCATTTTAAGTGCTTTATTTCTCG
1041 TTGTTCTTCCTGCACTTTCATTTCGACCTTTGTCAATGTGACCATTCTTGCTTTCTCATTTTTTTGTTTAAAAAATCAGA
1121 GTAATGTGGAACTTCAAAATACCAACTTTGGACTATTAAGAAAATACAAACTTACAAGTATAATTAATGAATTAGATCTA
1201 ATATTATTTAAATAAATATATATATATACACACACATATATAATTGCCACCTTGAAGTAAAACAAAGAGTGCTAAAATAA
1281 ATAATAGGAGTAAGAAAGAGATCTGCTTTGCTATTTGGCAGGTAGTGTTCTCCAGCTGCAGTGCCCTTGGAAGAGCACGT
1361 GGCAGTCACTGTGACCAAAACGGCAGGTAGGACAGCCCTGGGACCCTGACAGCTCCCATTCCTTCCCCTTAACTCTCCCT
1441 AGAGCAAGAAAAATATGTTTATAATGGAACAGTTCTCAGTAGACTTTATGAGAAGATTCTGTAGCTTTCGCGCTGAGCAG
1521 ATGCCTTCTATGTCTTCATGGTTTAGTAGTTTTGCTGCTATTAGGATCAGTGGCTCACAACATACTTGGTACATTCAACC
1601 CCATTGCTCCTTTCCCCCACACGCCGCTTCCCCAAGACCCCAACTCATGATACTTCCATCCATCTAGAGATGTGACATTT
1681 CAGACTGACTTTTGTGCAGTTAGATGTAAGCATTTTACCTCTCAACCCACACCAGTTCCTTTGGCCCCAGGCCACACATT
1761 TCACCTTAATAGCTCAACACCATACATGCATTTATTTTCTGACTATACAGTAGCCGCAACCAAGGCTTGAAAACTTGTTA
1841 AAAGGCCAGGGCCCTATTCATGAGACGCCTGACGGTGCCTTTTACCCTTAGAAAAGCAGGTTGACTTTTCCCCCACTCTA
1921 GTTAAAGAGAATGTTGCACACAAAAGAAAAAGGGTGGAAAATCTCAAACACTTGGCAACAGGCAAACAAATTTGATCATC
2001 TCCTTTCCTCCTCCTCTTGGTAAAATACAGTATTTATATTTTCCAGCCTCAGAGAAGATAGCAGAACATGATCTTTCACA
2081 AGAGAATTATAGACCTGCTTATTATAAAACAGATGTGCTCCCATGGCAAAGTGCCTTCTCCCTCCGCCCCCAGCTCCCTG
2161 TCACTGTAGCTTACTTTTGCCTTCGCTGTAATTAATGTATCCGTGATTCCAACTGTCAGCGAGGCCATTCCTAGCACACT
2241 GCATTTGGAGACCTGAAGTGCAGTGCCATCTCCTCCCCTTGTAACATGTTTGCCCTGCATACAGAATTTCCTCTCCTAGC
2321 TCACAGGCACCCAGGGTCATACCTGCCGAGAGTCAAGGGCGAAATTCTGGATCCCCGTTCAAAACATCTTTGTTTTCACC
2401 AGTCCCCATTTAGAGGGCCCTGCTAAATACGAGCAGTCCCTGTGAACTCCTAAGGAGGACTTTCCACCCACATCATTTTC
2481 TGCTTATTTTCAAAAGGGAAACAAAAAATCGATGTGTTATCACCATCAGCTACCCAGAGCTGGGTCCATGTCCAGCACTC
2561 CTGTTTCCTCTCCTTTTCGTACCACCCTGACAGCTTGGTCGGTGCCAGCCACAGGCCTATGACATTCTCTGCCACCACCA
2641 CCAAAATCTGATAGGACAGAGTGGAGCCAGCTTAGGAGTTGGGTCTGCCATGAAAATTCAAAATTGCTGTTTTCAGCCCA
2721 GAATACCTTGGCGCACATGAACGCCCTTACTGTTTTCAACTTTAACAAATTACTTGGTGCACTGTTAGGTAATTGTTCCA
2801 CTGCTTAGAAACTGTCGAAACAAAAGCAAATCTGTGGATTACCACCTCTTTCAGACCAAACTAATACCTGCTTTTCCTCG
2881 TGTTCCATTTTTCATCCCATATTAAATATCTTGCACATAAAACATATGAAAAAATGGCCAATTAATCTCCTGGAGCTGGC
2961 AACTGACTCCGGGGAACCGCTTTTTGCTGAAAGGCTCATTCCCTAGTGTATCACTTGAGGAAATCCCTCCTAAAAGTGCC
3041 AGAAACTCATGTGTGAGATCGTCCAACCCTGGTGAAATGTTGGCATCTAACCCCGCAGTAAAGAAGCCAGTTCCTAAAAT
3121 AGACCTCATTTTGCACCGCGGCAGGAAGGCCACAAAGTACTTAAAAAGCCGTCAACTGGAATGGGGGTAGTGTTCTTTCC
3201 AGGCCCGCTTTTTCCAAAGTTAAAAGCCTCTTTATATGAAAACCATGTAAACTCTCAGCAGCCCCCTTTGCTTCACTGCC
3281 TTTTCTAGGGAGTGCATTAGAGTCATTTTTACGTCTGTAGTGCTAAAGGGTCACCTAGTTAGGAGCTTTAACATCGGATT
3361 CGCTGAGAGGGTCATCGGTTTTTGATTCTTCTAGAGTAGGCCTCCACCAAGAAGGGAATACGTCTAATACTTGGGATCTG
3441 TGGTTTGCAACACAAGTGGTATCCCTCAGACTCCTGAAAAGGGACTATGCCGTGACTTCCTTCCGGCTGCAGTGAGATCC
3521 GAGGTGTTTACACCACCCTAGTTGCCGAATGCAGCCTTTGCTCAGCTAGAGTGTGTCCTCTGACGGAGCCTGGCCTCTGT
3601 TTTTGTCTCTGTGTGTTGTGTGTACACACTGAACGTGGACATCGGATAGTTCTTTTCTGTGCCTCCTCAGAGAGGCTTGG
3681 CTTCCAAACCTGGGAGTTTGTTCTCTACCCATTGGCTAGAAAAGGCCGTCCATAAATTAGTATATCCAGGTGGGACTAGC
3761 ACGATGCCACGCACACTGAACATTTTCTGCAGAGGGGCGTTAGCAGTGGAAGTAGAGACACATTCTGGTCCTCCTTTAGA
3841 GTCAAGCCAATGCTGTTGCTCGTGTATTTGTGCACAATTATTCATCTCCGTTGATCTGACACACTCTCTTGAAATCACTA
3921 GATTATGAAACAGATCTTCACCTCCTGATTCCAATACTGCCTGGTTTCAACACAGGGGTTGTTTTATTTTTTTACTTCTC
4001 CTAGTAAATAGAGATGTGTATAATTTTTGCCCATTTTATTTCTTGAGTTGTCTGCACCACTTCTTTTCTTACTCTGAAAT
4081 AATGTGAAAACGTGAAGTTGGAGCAAGACCTTGAAAGAGCCTCCCTCCTTTGCGTGACCTGAATCGGTAGCGGCACTCTC
4161 TGTTTCCCCTGCCTCCGTGTCACTTGTTAGTGATGGGCATTAGGAGCTTCATATGTTGCACACCTTGTATCACTCTTCCG
4241 ACCCTGAGTCAGGTAGAGCTGTCTGCTCGAGGTCGAATCCAGTGATGGGTGACTAAGCTCTGCTCGGTTAATGTAAACAG
4321 ACAAGTGTTGATTTCTGTCATGTGGAACGGTGTTTCGACAGTTAAGTCTAGCACCCAGTAGTCTCCTTATTGGTAGACGA
4401 TTCTAATTTCATTGGATTCAAAAATCTCTGACTCAAGGGTCTTTCCTTAGTGCGTTTTAATGGGTGCATGGCTGAGGGAA
4481 AATCCAAGTCATTGTTAAACTCTAGGTAAAAGACAAGAGTATGGGATACCCTCCTAACCATACCGGTAGTTGTCAGTTTT
4561 ATTTAAAGTGGGTTCCACTTGGCCAGGATTGGTGGCTCACGCCTGTAATCCCAGCCCTTTGGGAGGCCAAGGCAGGCAGA
4641 TCACTTGAGGTCAGGAGTTTGAGACCAGCCGGGCCAAAAATGGTGAAATCAGGTCTATACTAAAAATAAAAAAATTAGGC
4721 TGAACGTAGTGGCTCATGCCTGTAATCCCAACACTTTGAAGGCCGAGGTGGGTGAATCACTTGAGGTCAGGAGTTTGAGG
4801 CCAGCCTGGCCAACATGGTGAAACCCCCCTCTTTACTAAAAATACAAAAATTAGCTGAGTGTTTTGGTGGATGCCTATAA
4881 TCCCAGCTACTTGGGAGACTGAGGCAGGAGAATTGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATTGCGCCA
4961 CTGCACTCCAGCCTGGGCGACAGAGCAAGACTCCGTCTCAAAAAAAAAAAAAAAAGTAAGTTCCAAATGATCATGTTTTG
5041 TGGCACTGTCTTCGTAAAGTGGCCGCTGGTGTGATGGAAAGCATTGCTAAACTCAAGTGAGACAACTGCTGTTTTGCTTT
5121 GGATTTTCCCTGTGAAAAGAGAAGCCACTGCCTGTTCGTCTTGTTAGAAAGACAAGACTTTGAATGAAGTTCCAGACTTT
5201 GAATGAAGTTCCAGACTTTGAATGAAGCTGGTTGTTGCCCAGAGTAGAAGATTCAGGCACCTACAGCAACTCACAGCAAC
5281 TCCTAACTCTTAGGAGGGCTCCCTCCTATTGGCCGTGAAGCTGCAAACCAGCCTCTCTCTTTTCCCTGGATCTTCCTTGC
5361 CCCTAGTTCTGAGCCCCAGCCCAGAGGCAGGCCTCATGGCTAATAAACCAGCTAGAGGACAGCTGGGGCCTGTGGCTCCT
5441 TCTCCATGTTGGCCTTCCCTTGTGTCTCTTGTCCCTGTAGGAGTGCCTTATAGTACTGTCTCGTGCTTCTAGTCTAGTCT
5521 GAACCACTTGAAGCCTGCAGGACCCTTCAACTAAATCTGGATCCCTTTGCTTCTTCCCTGCTGGCTACTCTTCATATAGA
5601 TGCTCTTGGAGCCTGTGCATTCCATGATGCATGTCAGAACTCTCACCTTGTTCAGCCTGGTGTGCCTTAACCTCAGGAGT
5681 AAAGGGAATCATGTCGGAAACACGTCGTTAAAGTAGAATGGTACAAACATTGGCTTCTTAGTGCCATTAGCACTTTTACC
5761 AGGAAATGCAAAAGATGCAACCACATAATGTTTTCACTTTGTTTTATGCTGTTCTTCAATCGCTCTTTTTGTTTATTTGT
5841 TTGTTTGCTTTCATTAACCAAACTCAGGGGAATGTCATGATGTCACCAAGGCCAATGGGTAGAGAAATAAAAACCAGCCA
5921 TCCATAATTGAATCTGTAAAGTCAGTGAACTTAGCCTTTTCAGGTTCAAAATTACACAAACACAAGGATTTTCTTATCTT
6001 TCACCTTTCAAAGGTTTTCTTTTTATTTTGCCACCTGTTTTCCAAATAAGAAGTGGGAAGCCTCTTAGATAAATTGTGAT
6081 AAAAATGTCTCTTTGTTTGGCGTGAGCTATCAAATTAGCTTTGTGTGTCCACTGAGCCATCAAATTAGGCTTTGGCTGCT
6161 GGAGGCCTAGGTTCTAGCTTTGGTCACCTATCAGAATCTTACTGTTACGCTGGGCATGGTGGCATGTGCCTACAGTCCCA
6241 GCTATTTGGGAGGCTGAAGTGGGTAGATTGCTTGAGCCCAGGAGCCTGTGCAATATGGTGAGACCCATCTCAAAAAACAA
6321 ACAAAAAAAGAAGTAGAATCTTACTGTGAATAGCTACTAGCCTACCCTAGAAGATATATATTTTAAATCTGTTTCTTAGG
6401 AATAGTAGCTAAAAGAAGGAATGGCCAAAGGAGGGAAAGTGGTTGGCCGCAGCGGCTCACACCTGTAATCCCAGCTCTTT
6481 GGGAGGCTGGGGTGGGAGGATCACTGGAGCCCAGGAGTTCAAGACAAGTCTGGGCAAGATAGCGAGACCCTCATCTCTTT
6561 GAAAAATATATATATATACTTTTTTTTTTAAAGGAGAGAAAATGCTTAGGTTGCAAATGGAGAGTATTGAACGTGGTGAT
6641 GTAAAAAACTTCTGCAAAACTTGTTCTGTAGCTCCTGGGTCAGGTCTATGCCATTTTTTCTTATATCTGCTCACACAGTA
6721 CAGAAATGACTAAAATTTTGGGTCTGGGCTGTTATATCACTTTGTGTTAAGTTATTTGTAGTAGCTAATGTGCTAACTTA
6801 TATATGTGTTCTTTCTGTTTTTTGGATTTTACCTTTTGTTTTGGCATAACTTATCTATATTTTTGTTTACATTATTTTAA
6881 AAATATCAGTAACTGTAATAATATAAAATTGAAGTTGTATTGTTGACAATACCTCTAGTTTTTAAGGTCATCTGTCACAT
6961 AATTTAAGTGCACCAGTTCCTAATGTATAAAGTTCTCTCTCTCTCTCTCTCAATAAACAATGCAGAAAATA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGG--UA--ACAGUGUGAGGu 5'
              ||||  ||  ||| ||:|||| 
Target 5' caccCACCTAATGATGTGACGCTCCa 3'
764 - 789 146.00 -19.60
2
miRNA  3' guUUGUGGUAAC---A--GUGUGAGGu 5'
            | | ||:|||   |  |||||||: 
Target 5' tcATCTCCGTTGATCTGACACACTCTc 3'
3882 - 3908 142.00 -16.10
3
miRNA  3' guuuguGGUAACAG--UGUGAGGu 5'
                ||| ||||  :|||||| 
Target 5' ctgggtCCA-TGTCCAGCACTCCt 3'
2540 - 2562 141.00 -15.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26561219 8 COSMIC
COSN30186499 14 COSMIC
COSN8608488 35 COSMIC
COSN27001321 42 COSMIC
COSN1232467 46 COSMIC
COSN9306152 211 COSMIC
COSN6934479 325 COSMIC
COSN6934478 335 COSMIC
COSN30279604 792 COSMIC
COSN24858890 835 COSMIC
COSN16424635 1519 COSMIC
COSN6165879 1948 COSMIC
COSN29591554 2012 COSMIC
COSN1820788 2032 COSMIC
COSN22018487 2434 COSMIC
COSN16202447 2727 COSMIC
COSN21935826 2784 COSMIC
COSN6165878 2998 COSMIC
COSN21460452 2999 COSMIC
COSN5129021 3139 COSMIC
COSN22371079 3151 COSMIC
COSN5865636 3207 COSMIC
COSN14974620 3447 COSMIC
COSN23491415 3505 COSMIC
COSN1820787 3584 COSMIC
COSN20958704 3666 COSMIC
COSN32056190 3799 COSMIC
COSN25280183 3852 COSMIC
COSN8278180 4133 COSMIC
COSN25768707 4177 COSMIC
COSN4910700 4616 COSMIC
COSN21561956 4718 COSMIC
COSN8278179 4809 COSMIC
COSN14814362 4922 COSMIC
COSN9306150 4985 COSMIC
COSN27234494 4999 COSMIC
COSN22625487 5158 COSMIC
COSN23250425 5175 COSMIC
COSN16864900 5223 COSMIC
COSN20249430 5251 COSMIC
COSN32069326 5314 COSMIC
COSN32058748 5388 COSMIC
COSN26310333 5646 COSMIC
COSN31550162 5684 COSMIC
COSM3962258 5807 COSMIC
COSM5994389 5879 COSMIC
COSN31488249 5961 COSMIC
rs11679380 1751 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs376563640 1 dbSNP
rs754444607 6 dbSNP
rs766421695 8 dbSNP
rs373381345 9 dbSNP
rs370203453 13 dbSNP
rs374923594 14 dbSNP
rs371655937 15 dbSNP
rs774646697 17 dbSNP
rs1487626553 18 dbSNP
rs1246406895 19 dbSNP
rs1196273486 21 dbSNP
rs775568848 21 dbSNP
rs769972351 32 dbSNP
rs952063596 33 dbSNP
rs1272324637 44 dbSNP
rs745962458 45 dbSNP
rs776626175 50 dbSNP
rs771459457 51 dbSNP
rs369960773 57 dbSNP
rs1232396959 58 dbSNP
rs1286534407 64 dbSNP
rs960770458 65 dbSNP
rs754075283 69 dbSNP
rs1240122632 81 dbSNP
rs1192789512 84 dbSNP
rs1445187167 92 dbSNP
rs1002741992 105 dbSNP
rs538631314 108 dbSNP
rs1286306636 114 dbSNP
rs971060789 117 dbSNP
rs1205199302 120 dbSNP
rs766733645 127 dbSNP
rs1270815359 134 dbSNP
rs1408354098 134 dbSNP
rs1399739442 135 dbSNP
rs1158895546 138 dbSNP
rs548120592 142 dbSNP
rs77888701 147 dbSNP
rs1010008173 148 dbSNP
rs1294273407 150 dbSNP
rs1438720019 157 dbSNP
rs892838240 158 dbSNP
rs1054638729 161 dbSNP
rs74326861 162 dbSNP
rs567199769 170 dbSNP
rs1382793334 173 dbSNP
rs1336617445 174 dbSNP
rs1393838094 181 dbSNP
rs1163007158 182 dbSNP
rs1051371141 184 dbSNP
rs879655934 190 dbSNP
rs1467083473 191 dbSNP
rs1183426561 193 dbSNP
rs1232926972 194 dbSNP
rs541630968 199 dbSNP
rs1469343635 200 dbSNP
rs1175073031 205 dbSNP
rs1410241888 207 dbSNP
rs1463287898 222 dbSNP
rs971234480 223 dbSNP
rs1463231739 235 dbSNP
rs550784300 252 dbSNP
rs1394477810 254 dbSNP
rs934219194 255 dbSNP
rs918603264 272 dbSNP
rs150726386 278 dbSNP
rs376792483 279 dbSNP
rs1277946306 281 dbSNP
rs75842382 287 dbSNP
rs180758429 288 dbSNP
rs552351332 291 dbSNP
rs1197448362 296 dbSNP
rs933765681 298 dbSNP
rs1468621883 300 dbSNP
rs1257112302 307 dbSNP
rs373197047 310 dbSNP
rs922375684 316 dbSNP
rs1475328401 322 dbSNP
rs1037298417 325 dbSNP
rs927111315 327 dbSNP
rs939881865 332 dbSNP
rs1472114415 333 dbSNP
rs73983606 334 dbSNP
rs746883255 338 dbSNP
rs984003590 339 dbSNP
rs761631553 340 dbSNP
rs916614056 344 dbSNP
rs990777694 345 dbSNP
rs1292488186 356 dbSNP
rs1443245325 367 dbSNP
rs777791940 368 dbSNP
rs960800040 369 dbSNP
rs560520494 375 dbSNP
rs1338184540 378 dbSNP
rs1193640790 382 dbSNP
rs546996068 383 dbSNP
rs1035096544 384 dbSNP
rs1209658167 386 dbSNP
rs1328500437 398 dbSNP
rs889990050 400 dbSNP
rs1440994832 406 dbSNP
rs1195964847 408 dbSNP
rs1374220289 415 dbSNP
rs530454022 418 dbSNP
rs188021026 425 dbSNP
rs1166850956 446 dbSNP
rs1396930291 449 dbSNP
rs1435601950 454 dbSNP
rs1168382627 460 dbSNP
rs1312447574 462 dbSNP
rs1399811382 466 dbSNP
rs768112401 472 dbSNP
rs1383635996 505 dbSNP
rs1453743007 506 dbSNP
rs1318721235 509 dbSNP
rs1393241356 515 dbSNP
rs1194955567 517 dbSNP
rs1226053197 518 dbSNP
rs1305031998 527 dbSNP
rs1347911629 529 dbSNP
rs1468581354 532 dbSNP
rs1022846191 537 dbSNP
rs1237130534 539 dbSNP
rs1011171171 543 dbSNP
rs1262846198 544 dbSNP
rs1446967971 551 dbSNP
rs1187178487 552 dbSNP
rs1436393247 558 dbSNP
rs897371647 559 dbSNP
rs1037041552 560 dbSNP
rs1173253198 563 dbSNP
rs1275580312 565 dbSNP
rs1455527948 566 dbSNP
rs1196793989 567 dbSNP
rs1158980272 572 dbSNP
rs112284760 576 dbSNP
rs1432840268 577 dbSNP
rs941392130 588 dbSNP
rs1301968800 590 dbSNP
rs1371100562 593 dbSNP
rs1236569505 596 dbSNP
rs888450374 612 dbSNP
rs890036002 618 dbSNP
rs1298547924 620 dbSNP
rs1055641474 622 dbSNP
rs148786316 634 dbSNP
rs146154097 637 dbSNP
rs981203117 639 dbSNP
rs900948631 649 dbSNP
rs913175536 650 dbSNP
rs988744700 657 dbSNP
rs1193149430 658 dbSNP
rs1433943665 671 dbSNP
rs775064490 676 dbSNP
rs1175458341 681 dbSNP
rs939723854 684 dbSNP
rs1454283475 687 dbSNP
rs888291781 688 dbSNP
rs957288062 693 dbSNP
rs1048206488 695 dbSNP
rs948678078 696 dbSNP
rs1175068780 706 dbSNP
rs1395206587 708 dbSNP
rs565001356 709 dbSNP
rs915809524 716 dbSNP
rs990808681 729 dbSNP
rs985221873 734 dbSNP
rs79202233 738 dbSNP
rs1374820297 749 dbSNP
rs745600753 750 dbSNP
rs1233140973 751 dbSNP
rs978204115 753 dbSNP
rs78133783 759 dbSNP
rs1485581820 762 dbSNP
rs1336172621 776 dbSNP
rs184070681 782 dbSNP
rs1213646809 783 dbSNP
rs1005781542 784 dbSNP
rs1196609012 787 dbSNP
rs1348629120 791 dbSNP
rs888473362 793 dbSNP
rs989647085 794 dbSNP
rs1189865763 807 dbSNP
rs772537083 808 dbSNP
rs1055018986 812 dbSNP
rs1474859999 817 dbSNP
rs111354269 821 dbSNP
rs114622461 826 dbSNP
rs900838396 834 dbSNP
rs142951995 835 dbSNP
rs1297099380 851 dbSNP
rs1416218006 852 dbSNP
rs779597407 858 dbSNP
rs151050899 868 dbSNP
rs374802590 868 dbSNP
rs550900713 868 dbSNP
rs796277489 868 dbSNP
rs879292245 868 dbSNP
rs1228266947 875 dbSNP
rs913048037 880 dbSNP
rs1413882599 881 dbSNP
rs1309779285 883 dbSNP
rs1228322304 889 dbSNP
rs1353338577 896 dbSNP
rs778746765 902 dbSNP
rs1015639738 903 dbSNP
rs989165541 915 dbSNP
rs1003998754 919 dbSNP
rs1213241734 926 dbSNP
rs556945493 927 dbSNP
rs1482770363 929 dbSNP
rs138443887 937 dbSNP
rs1048238595 941 dbSNP
rs948542929 945 dbSNP
rs925625929 958 dbSNP
rs1169193291 961 dbSNP
rs894284077 966 dbSNP
rs571395428 969 dbSNP
rs1387751134 970 dbSNP
rs1436233994 975 dbSNP
rs1344586945 980 dbSNP
rs1376450819 987 dbSNP
rs1447848462 988 dbSNP
rs1301448824 993 dbSNP
rs985083420 998 dbSNP
rs938559719 1019 dbSNP
rs551552420 1034 dbSNP
rs1156274782 1037 dbSNP
rs755063277 1039 dbSNP
rs1340074488 1042 dbSNP
rs752394703 1046 dbSNP
rs1281227739 1054 dbSNP
rs1311826583 1059 dbSNP
rs1207833183 1060 dbSNP
rs72964195 1065 dbSNP
rs551823294 1073 dbSNP
rs961866211 1076 dbSNP
rs1245690537 1079 dbSNP
rs1475045707 1090 dbSNP
rs1255881194 1118 dbSNP
rs1173710504 1119 dbSNP
rs1190632991 1121 dbSNP
rs915313307 1128 dbSNP
rs116108729 1137 dbSNP
rs1213721040 1140 dbSNP
rs192537960 1150 dbSNP
rs1347275240 1175 dbSNP
rs1432132706 1193 dbSNP
rs921391344 1199 dbSNP
rs72964192 1203 dbSNP
rs1363128007 1209 dbSNP
rs1443288172 1214 dbSNP
rs1033648712 1217 dbSNP
rs1002195707 1218 dbSNP
rs1217659906 1225 dbSNP
rs185143071 1227 dbSNP
rs1046490787 1228 dbSNP
rs1015297719 1229 dbSNP
rs1208035392 1229 dbSNP
rs541923945 1229 dbSNP
rs1232935335 1231 dbSNP
rs1009642973 1234 dbSNP
rs561629370 1236 dbSNP
rs1052935818 1238 dbSNP
rs935916540 1244 dbSNP
rs952491819 1245 dbSNP
rs1415213618 1246 dbSNP
rs1410633564 1250 dbSNP
rs925856282 1260 dbSNP
rs1026703010 1273 dbSNP
rs1387170976 1283 dbSNP
rs1326714301 1285 dbSNP
rs1463457351 1285 dbSNP
rs1349333797 1288 dbSNP
rs1361178195 1302 dbSNP
rs1281431821 1304 dbSNP
rs1374321986 1305 dbSNP
rs1227620865 1313 dbSNP
rs1286201790 1313 dbSNP
rs932344024 1321 dbSNP
rs1214201534 1322 dbSNP
rs1288550001 1326 dbSNP
rs1287102912 1330 dbSNP
rs1432214075 1332 dbSNP
rs922243663 1338 dbSNP
rs1012597410 1340 dbSNP
rs550951193 1345 dbSNP
rs894316854 1346 dbSNP
rs1206185047 1349 dbSNP
rs976525744 1353 dbSNP
rs961125025 1356 dbSNP
rs1181974937 1358 dbSNP
rs1056859024 1359 dbSNP
rs765767108 1360 dbSNP
rs1390126466 1371 dbSNP
rs1167506406 1377 dbSNP
rs952984519 1381 dbSNP
rs370720516 1382 dbSNP
rs146327656 1383 dbSNP
rs1409405076 1384 dbSNP
rs903098572 1388 dbSNP
rs1042417437 1390 dbSNP
rs945357506 1397 dbSNP
rs1424822240 1402 dbSNP
rs149383915 1410 dbSNP
rs376021917 1411 dbSNP
rs1053873881 1412 dbSNP
rs1233833871 1415 dbSNP
rs1283453773 1428 dbSNP
rs932686280 1451 dbSNP
rs921464803 1456 dbSNP
rs1486868556 1463 dbSNP
rs1273073675 1466 dbSNP
rs1482548861 1476 dbSNP
rs1202542592 1487 dbSNP
rs566088199 1488 dbSNP
rs1250095062 1497 dbSNP
rs545173273 1498 dbSNP
rs1470140156 1509 dbSNP
rs1486825841 1511 dbSNP
rs2021858 1512 dbSNP
rs1213201176 1513 dbSNP
rs965680216 1514 dbSNP
rs866005175 1526 dbSNP
rs908773390 1530 dbSNP
rs983025162 1538 dbSNP
rs1166882428 1554 dbSNP
rs1275358173 1554 dbSNP
rs558987823 1559 dbSNP
rs145653902 1560 dbSNP
rs373054099 1560 dbSNP
rs1306719979 1561 dbSNP
rs952399820 1569 dbSNP
rs1026568969 1586 dbSNP
rs1012628012 1593 dbSNP
rs1338684189 1599 dbSNP
rs1010087281 1601 dbSNP
rs958442345 1605 dbSNP
rs892510675 1606 dbSNP
rs1340785200 1608 dbSNP
rs1053367768 1610 dbSNP
rs1281939036 1614 dbSNP
rs1348137924 1614 dbSNP
rs1361975445 1618 dbSNP
rs138823706 1621 dbSNP
rs1035568513 1622 dbSNP
rs750836387 1623 dbSNP
rs922276147 1625 dbSNP
rs573508127 1626 dbSNP
rs1466728604 1631 dbSNP
rs1326189637 1633 dbSNP
rs1458675851 1634 dbSNP
rs1399748909 1639 dbSNP
rs939774438 1642 dbSNP
rs1354352811 1643 dbSNP
rs908321480 1658 dbSNP
rs76920076 1662 dbSNP
rs1430790603 1678 dbSNP
rs1391371297 1686 dbSNP
rs193302089 1692 dbSNP
rs764030535 1698 dbSNP
rs1011470920 1702 dbSNP
rs893816967 1706 dbSNP
rs1053777059 1714 dbSNP
rs932759912 1717 dbSNP
rs1343239181 1726 dbSNP
rs150184929 1727 dbSNP
rs187815748 1729 dbSNP
rs1024936915 1748 dbSNP
rs944216702 1750 dbSNP
rs11679380 1751 dbSNP
rs1032464709 1752 dbSNP
rs1198370269 1753 dbSNP
rs566993453 1757 dbSNP
rs1342743523 1758 dbSNP
rs1159623752 1768 dbSNP
rs1302658911 1778 dbSNP
rs1227608764 1779 dbSNP
rs931530832 1781 dbSNP
rs919628519 1782 dbSNP
rs1455547572 1785 dbSNP
rs12151729 1787 dbSNP
rs1390762031 1789 dbSNP
rs958473748 1790 dbSNP
rs1385886603 1794 dbSNP
rs1301492398 1796 dbSNP
rs1390486766 1801 dbSNP
rs1298651532 1809 dbSNP
rs759089173 1810 dbSNP
rs1337153992 1812 dbSNP
rs996784189 1815 dbSNP
rs550069040 1816 dbSNP
rs113265953 1848 dbSNP
rs1275154074 1856 dbSNP
rs1488816377 1860 dbSNP
rs1209474579 1861 dbSNP
rs567594097 1866 dbSNP
rs58524730 1867 dbSNP
rs776387494 1873 dbSNP
rs1173576161 1874 dbSNP
rs1020080055 1880 dbSNP
rs1432869207 1885 dbSNP
rs1471580996 1885 dbSNP
rs1166938162 1899 dbSNP
rs1368542816 1910 dbSNP
rs1011531839 1914 dbSNP
rs893055524 1925 dbSNP
rs1048171941 1928 dbSNP
rs1032365902 1931 dbSNP
rs1410027253 1936 dbSNP
rs996836451 1938 dbSNP
rs931036716 1948 dbSNP
rs1309056358 1953 dbSNP
rs1350204309 1956 dbSNP
rs899801956 1962 dbSNP
rs1227109436 1973 dbSNP
rs926813991 1979 dbSNP
rs1041544139 1998 dbSNP
rs980868072 1999 dbSNP
rs944096468 2008 dbSNP
rs1484177165 2009 dbSNP
rs949648445 2016 dbSNP
rs1248731226 2018 dbSNP
rs796465372 2019 dbSNP
rs1483291718 2021 dbSNP
rs1256843899 2031 dbSNP
rs1423147472 2033 dbSNP
rs1442614114 2047 dbSNP
rs1279442241 2067 dbSNP
rs772287420 2068 dbSNP
rs988794681 2076 dbSNP
rs956753351 2082 dbSNP
rs748547836 2090 dbSNP
rs931605954 2092 dbSNP
rs979552789 2094 dbSNP
rs920160179 2097 dbSNP
rs774945189 2105 dbSNP
rs1304947898 2119 dbSNP
rs1380592380 2123 dbSNP
rs1395916662 2124 dbSNP
rs1237756451 2142 dbSNP
rs531137351 2145 dbSNP
rs73983605 2146 dbSNP
rs996716991 2154 dbSNP
rs1229415220 2158 dbSNP
rs533976048 2159 dbSNP
rs1274269379 2160 dbSNP
rs1340281868 2166 dbSNP
rs928299353 2175 dbSNP
rs1212029131 2178 dbSNP
rs1256334701 2180 dbSNP
rs981603346 2181 dbSNP
rs551573672 2184 dbSNP
rs191482988 2185 dbSNP
rs1312760511 2194 dbSNP
rs1187387664 2203 dbSNP
rs1020573734 2213 dbSNP
rs774839098 2214 dbSNP
rs75607692 2220 dbSNP
rs559024036 2221 dbSNP
rs1360060285 2227 dbSNP
rs1465991477 2231 dbSNP
rs1173200380 2239 dbSNP
rs1301534240 2245 dbSNP
rs1367966630 2250 dbSNP
rs1435977487 2255 dbSNP
rs186672118 2265 dbSNP
rs1363334169 2266 dbSNP
rs530361683 2273 dbSNP
rs112988727 2275 dbSNP
rs1161564436 2285 dbSNP
rs138883054 2299 dbSNP
rs1270013097 2303 dbSNP
rs1371210455 2313 dbSNP
rs1465281533 2324 dbSNP
rs1207613679 2325 dbSNP
rs1472775228 2330 dbSNP
rs1191353595 2335 dbSNP
rs1478818262 2335 dbSNP
rs1028926358 2340 dbSNP
rs1016265627 2341 dbSNP
rs78538308 2346 dbSNP
rs73983604 2347 dbSNP
rs904919983 2348 dbSNP
rs1458198068 2353 dbSNP
rs1044782085 2358 dbSNP
rs532297624 2360 dbSNP
rs1204021746 2370 dbSNP
rs949591711 2373 dbSNP
rs1019578834 2374 dbSNP
rs73986352 2376 dbSNP
rs746034968 2377 dbSNP
rs1289958948 2394 dbSNP
rs1329821456 2401 dbSNP
rs1227657901 2406 dbSNP
rs1265709425 2417 dbSNP
rs1452768432 2418 dbSNP
rs887198187 2422 dbSNP
rs781510209 2427 dbSNP
rs979387037 2430 dbSNP
rs1413363052 2432 dbSNP
rs541231145 2436 dbSNP
rs1197762475 2437 dbSNP
rs1342774613 2438 dbSNP
rs931470230 2439 dbSNP
rs1335514053 2443 dbSNP
rs898641267 2445 dbSNP
rs1473219500 2449 dbSNP
rs1159006007 2457 dbSNP
rs572231124 2459 dbSNP
rs1029121473 2461 dbSNP
rs1382925971 2463 dbSNP
rs1322755190 2472 dbSNP
rs937571492 2480 dbSNP
rs373824988 2484 dbSNP
rs1434545804 2486 dbSNP
rs976147935 2488 dbSNP
rs928321045 2498 dbSNP
rs1045396875 2509 dbSNP
rs965236797 2509 dbSNP
rs945809069 2510 dbSNP
rs1019839081 2511 dbSNP
rs1004152784 2517 dbSNP
rs1288485143 2518 dbSNP
rs1319582979 2518 dbSNP
rs1289621860 2537 dbSNP
rs555591736 2540 dbSNP
rs1192389932 2543 dbSNP
rs1444736713 2544 dbSNP
rs912965130 2548 dbSNP
rs536393372 2549 dbSNP
rs1231736926 2554 dbSNP
rs1208862228 2559 dbSNP
rs1467725744 2560 dbSNP
rs146268233 2567 dbSNP
rs1270952211 2573 dbSNP
rs370076679 2577 dbSNP
rs73986351 2578 dbSNP
rs989869125 2579 dbSNP
rs2306432 2583 dbSNP
rs1371396203 2587 dbSNP
rs73986350 2591 dbSNP
rs1013274396 2600 dbSNP
rs142161773 2601 dbSNP
rs1299885935 2603 dbSNP
rs896663935 2609 dbSNP
rs1435995463 2612 dbSNP
rs1053008896 2618 dbSNP
rs751369549 2619 dbSNP
rs1274994709 2623 dbSNP
rs974665124 2627 dbSNP
rs1341006984 2639 dbSNP
rs1324154931 2652 dbSNP
rs1271284682 2656 dbSNP
rs763936113 2663 dbSNP
rs183278692 2670 dbSNP
rs1406813293 2671 dbSNP
rs1020072311 2672 dbSNP
rs1043998774 2679 dbSNP
rs1167206915 2689 dbSNP
rs758327928 2701 dbSNP
rs951576224 2718 dbSNP
rs1391991713 2734 dbSNP
rs1391071748 2742 dbSNP
rs1025698548 2743 dbSNP
rs1165967334 2752 dbSNP
rs1188630494 2756 dbSNP
rs976179139 2759 dbSNP
rs2306433 2762 dbSNP
rs898673885 2763 dbSNP
rs912402406 2766 dbSNP
rs764629366 2767 dbSNP
rs1215177796 2772 dbSNP
rs1398626965 2776 dbSNP
rs1453639306 2779 dbSNP
rs796211414 2781 dbSNP
rs1268811685 2783 dbSNP
rs1195632382 2788 dbSNP
rs1002230511 2800 dbSNP
rs951241097 2811 dbSNP
rs1300521399 2815 dbSNP
rs775817526 2817 dbSNP
rs565983325 2818 dbSNP
rs1210710432 2826 dbSNP
rs1248675844 2829 dbSNP
rs1370347213 2835 dbSNP
rs945743790 2840 dbSNP
rs1301475661 2841 dbSNP
rs1438903915 2846 dbSNP
rs1191227442 2848 dbSNP
rs969053683 2851 dbSNP
rs1171771894 2852 dbSNP
rs1403884684 2860 dbSNP
rs1458721738 2861 dbSNP
rs1327903745 2862 dbSNP
rs912878081 2880 dbSNP
rs1387216374 2887 dbSNP
rs1372312083 2894 dbSNP
rs1380185710 2897 dbSNP
rs1054207473 2899 dbSNP
rs1325190989 2901 dbSNP
rs1169153791 2902 dbSNP
rs1331311242 2903 dbSNP
rs759106835 2909 dbSNP
rs1392751815 2910 dbSNP
rs573384835 2918 dbSNP
rs1192478635 2924 dbSNP
rs1322066885 2926 dbSNP
rs191007273 2927 dbSNP
rs1000135699 2928 dbSNP
rs147194338 2928 dbSNP
rs1203465467 2935 dbSNP
rs1269813400 2936 dbSNP
rs529015286 2941 dbSNP
rs766056156 2946 dbSNP
rs911800570 2964 dbSNP
rs983745794 2970 dbSNP
rs1436444941 2971 dbSNP
rs147624428 2978 dbSNP
rs142551998 2979 dbSNP
rs1347179204 2986 dbSNP
rs995559367 2989 dbSNP
rs962763571 2990 dbSNP
rs1034502356 2995 dbSNP
rs1221054339 2996 dbSNP
rs1385833401 2996 dbSNP
rs1302943568 2998 dbSNP
rs1343959922 3006 dbSNP
rs1345971699 3008 dbSNP
rs1412225740 3017 dbSNP
rs1279247488 3021 dbSNP
rs1237041256 3029 dbSNP
rs1439674079 3032 dbSNP
rs1001696189 3051 dbSNP
rs769715849 3051 dbSNP
rs762206775 3053 dbSNP
rs1209416266 3060 dbSNP
rs532894854 3061 dbSNP
rs1182612829 3063 dbSNP
rs1251050326 3070 dbSNP
rs1024577707 3073 dbSNP
rs1010864549 3081 dbSNP
rs891474634 3084 dbSNP
rs1368486440 3085 dbSNP
rs1054114932 3090 dbSNP
rs187133034 3094 dbSNP
rs1161208965 3095 dbSNP
rs983556504 3100 dbSNP
rs951311506 3103 dbSNP
rs900234584 3108 dbSNP
rs919745972 3125 dbSNP
rs1039308762 3126 dbSNP
rs1156451678 3133 dbSNP
rs2306434 3138 dbSNP
rs541377616 3140 dbSNP
rs1245527593 3142 dbSNP
rs572366966 3152 dbSNP
rs1344554579 3156 dbSNP
rs555628559 3157 dbSNP
rs1205656339 3169 dbSNP
rs1250511004 3170 dbSNP
rs983392604 3171 dbSNP
rs1183462412 3173 dbSNP
rs769187402 3175 dbSNP
rs1455764932 3183 dbSNP
rs1031191499 3184 dbSNP
rs929193514 3192 dbSNP
rs1183415088 3195 dbSNP
rs932472562 3196 dbSNP
rs999270443 3200 dbSNP
rs1449669845 3206 dbSNP
rs904036677 3207 dbSNP
rs1354262025 3209 dbSNP
rs541990652 3213 dbSNP
rs1022449310 3218 dbSNP
rs1485612234 3220 dbSNP
rs1236304312 3236 dbSNP
rs918623439 3245 dbSNP
rs1452067765 3250 dbSNP
rs2306435 3260 dbSNP
rs1367659831 3262 dbSNP
rs557397108 3263 dbSNP
rs1305480341 3267 dbSNP
rs1211964562 3270 dbSNP
rs1040638575 3275 dbSNP
rs1460801981 3280 dbSNP
rs944742024 3284 dbSNP
rs962794719 3304 dbSNP
rs886426115 3312 dbSNP
rs575828299 3313 dbSNP
rs930717725 3316 dbSNP
rs1178418308 3317 dbSNP
rs1427181790 3321 dbSNP
rs1178676384 3333 dbSNP
rs1378756213 3344 dbSNP
rs1469700496 3345 dbSNP
rs1288715936 3355 dbSNP
rs1232530389 3356 dbSNP
rs371740652 3362 dbSNP
rs769725248 3367 dbSNP
rs980569589 3369 dbSNP
rs1448039895 3371 dbSNP
rs115703176 3376 dbSNP
rs916532231 3377 dbSNP
rs1315732377 3379 dbSNP
rs538981728 3382 dbSNP
rs1010521407 3384 dbSNP
rs1412305864 3388 dbSNP
rs571786934 3408 dbSNP
rs535015840 3413 dbSNP
rs1475118648 3416 dbSNP
rs1269497184 3421 dbSNP
rs978262350 3422 dbSNP
rs1032702924 3427 dbSNP
rs999851128 3431 dbSNP
rs1214457383 3447 dbSNP
rs967749934 3453 dbSNP
rs1184111738 3464 dbSNP
rs76415176 3470 dbSNP
rs778658641 3473 dbSNP
rs1480402041 3487 dbSNP
rs183421051 3488 dbSNP
rs944416655 3491 dbSNP
rs777513009 3492 dbSNP
rs758238012 3494 dbSNP
rs1293919579 3498 dbSNP
rs536020189 3499 dbSNP
rs569655255 3501 dbSNP
rs1290215128 3504 dbSNP
rs929246143 3505 dbSNP
rs886454732 3512 dbSNP
rs148843334 3520 dbSNP
rs532877852 3521 dbSNP
rs1314726990 3530 dbSNP
rs1270050181 3533 dbSNP
rs1490307780 3540 dbSNP
rs941382953 3542 dbSNP
rs1197694646 3546 dbSNP
rs564117237 3547 dbSNP
rs1470781855 3549 dbSNP
rs1361248876 3554 dbSNP
rs1176722994 3555 dbSNP
rs190996242 3556 dbSNP
rs766040785 3563 dbSNP
rs1407308329 3565 dbSNP
rs1436728747 3566 dbSNP
rs947929266 3567 dbSNP
rs754797706 3572 dbSNP
rs547394436 3584 dbSNP
rs186190756 3585 dbSNP
rs1422581661 3599 dbSNP
rs561928839 3605 dbSNP
rs1351064116 3608 dbSNP
rs1441325652 3616 dbSNP
rs538888776 3617 dbSNP
rs1380619275 3620 dbSNP
rs181796446 3628 dbSNP
rs989366952 3635 dbSNP
rs956304305 3639 dbSNP
rs1356795226 3641 dbSNP
rs1220769489 3643 dbSNP
rs1419515234 3644 dbSNP
rs34554678 3646 dbSNP
rs1277166054 3658 dbSNP
rs1033276277 3663 dbSNP
rs1186746037 3669 dbSNP
rs1204370842 3675 dbSNP
rs1231254871 3677 dbSNP
rs879878539 3680 dbSNP
rs1000427430 3689 dbSNP
rs1193277547 3692 dbSNP
rs1184276229 3694 dbSNP
rs1384904200 3700 dbSNP
rs1442976170 3703 dbSNP
rs1170274804 3710 dbSNP
rs964377627 3711 dbSNP
rs1266968597 3716 dbSNP
rs923604179 3727 dbSNP
rs188173101 3728 dbSNP
rs1448183562 3732 dbSNP
rs1313693863 3734 dbSNP
rs1306842006 3736 dbSNP
rs1008683601 3739 dbSNP
rs1230097314 3749 dbSNP
rs563637450 3762 dbSNP
rs915030558 3763 dbSNP
rs974468922 3768 dbSNP
rs890202024 3770 dbSNP
rs1302183831 3771 dbSNP
rs1438284339 3775 dbSNP
rs1019085891 3793 dbSNP
rs1009583764 3797 dbSNP
rs1460159235 3798 dbSNP
rs1369341705 3799 dbSNP
rs543934673 3812 dbSNP
rs1474994209 3813 dbSNP
rs1295649445 3819 dbSNP
rs1458791135 3821 dbSNP
rs950958369 3822 dbSNP
rs577696721 3823 dbSNP
rs1335524699 3834 dbSNP
rs1403197307 3842 dbSNP
rs1436838903 3843 dbSNP
rs1318639632 3844 dbSNP
rs764507661 3855 dbSNP
rs1325478563 3859 dbSNP
rs115739757 3861 dbSNP
rs73986349 3862 dbSNP
rs11675864 3866 dbSNP
rs185793227 3871 dbSNP
rs1210652911 3872 dbSNP
rs927349574 3883 dbSNP
rs535683105 3889 dbSNP
rs1012925129 3890 dbSNP
rs1190797465 3906 dbSNP
rs894989169 3910 dbSNP
rs1480731590 3916 dbSNP
rs1056260206 3919 dbSNP
rs1427108506 3920 dbSNP
rs939271889 3921 dbSNP
rs1383843825 3923 dbSNP
rs1316695909 3925 dbSNP
rs1347699078 3927 dbSNP
rs1431625977 3927 dbSNP
rs113338042 3934 dbSNP
rs1283268655 3935 dbSNP
rs923913358 3942 dbSNP
rs1042693450 3954 dbSNP
rs1480194657 3955 dbSNP
rs1350255751 3960 dbSNP
rs950186541 3965 dbSNP
rs770348526 3972 dbSNP
rs917309573 3978 dbSNP
rs1198406160 3988 dbSNP
rs1266750874 3994 dbSNP
rs1473516531 3994 dbSNP
rs1181946087 3996 dbSNP
rs988867064 3998 dbSNP
rs1207243959 4009 dbSNP
rs1362664541 4011 dbSNP
rs956211530 4015 dbSNP
rs1342186702 4028 dbSNP
rs760019738 4040 dbSNP
rs776768562 4053 dbSNP
rs1451178810 4055 dbSNP
rs771038469 4060 dbSNP
rs570271017 4063 dbSNP
rs1230523575 4064 dbSNP
rs1017312592 4072 dbSNP
rs974506269 4074 dbSNP
rs1302891949 4080 dbSNP
rs1344203912 4082 dbSNP
rs1393594348 4083 dbSNP
rs111280268 4091 dbSNP
rs912051288 4092 dbSNP
rs368823442 4093 dbSNP
rs987624265 4097 dbSNP
rs954372726 4100 dbSNP
rs1306665627 4104 dbSNP
rs1412196915 4109 dbSNP
rs777991973 4110 dbSNP
rs1360414881 4121 dbSNP
rs993166794 4124 dbSNP
rs1289276128 4125 dbSNP
rs899009933 4128 dbSNP
rs1484009689 4129 dbSNP
rs1196233466 4130 dbSNP
rs1249723834 4131 dbSNP
rs771812801 4134 dbSNP
rs550104389 4145 dbSNP
rs539567988 4146 dbSNP
rs570546710 4151 dbSNP
rs547431028 4152 dbSNP
rs1012956073 4153 dbSNP
rs73986348 4155 dbSNP
rs1057460403 4158 dbSNP
rs1003415376 4159 dbSNP
rs571371762 4162 dbSNP
rs1396391857 4171 dbSNP
rs1389798909 4172 dbSNP
rs1184133970 4173 dbSNP
rs902324014 4176 dbSNP
rs1483322794 4177 dbSNP
rs1245462836 4180 dbSNP
rs561836224 4186 dbSNP
rs565341455 4196 dbSNP
rs934700336 4206 dbSNP
rs1309105149 4207 dbSNP
rs926145078 4213 dbSNP
rs1227868544 4224 dbSNP
rs978925485 4227 dbSNP
rs1250734383 4229 dbSNP
rs1198174923 4238 dbSNP
rs946590316 4239 dbSNP
rs965016025 4240 dbSNP
rs910805867 4248 dbSNP
rs1460606710 4252 dbSNP
rs1256187798 4259 dbSNP
rs1237906367 4264 dbSNP
rs867451813 4268 dbSNP
rs547760544 4269 dbSNP
rs145517504 4271 dbSNP
rs531495045 4272 dbSNP
rs1286817616 4274 dbSNP
rs1038681436 4275 dbSNP
rs1373052232 4278 dbSNP
rs778655180 4295 dbSNP
rs1460885674 4298 dbSNP
rs1351626281 4303 dbSNP
rs954527434 4306 dbSNP
rs1406850000 4308 dbSNP
rs943108666 4315 dbSNP
rs911681025 4329 dbSNP
rs867101380 4339 dbSNP
rs1364317563 4348 dbSNP
rs1382607355 4349 dbSNP
rs987624773 4357 dbSNP
rs1453290259 4364 dbSNP
rs562747397 4369 dbSNP
rs1161090410 4376 dbSNP
rs1263221418 4377 dbSNP
rs1322304828 4386 dbSNP
rs868267242 4390 dbSNP
rs16840060 4395 dbSNP
rs1416996332 4398 dbSNP
rs1485973925 4399 dbSNP
rs181568896 4412 dbSNP
rs1261413975 4415 dbSNP
rs1427277682 4417 dbSNP
rs189571341 4425 dbSNP
rs541030554 4426 dbSNP
rs904996511 4436 dbSNP
rs1424996586 4438 dbSNP
rs76854461 4447 dbSNP
rs79899719 4453 dbSNP
rs779692247 4454 dbSNP
rs542557659 4458 dbSNP
rs895813941 4463 dbSNP
rs1053094319 4464 dbSNP
rs1359524210 4465 dbSNP
rs1035801359 4466 dbSNP
rs1210907574 4469 dbSNP
rs934754281 4472 dbSNP
rs755711301 4477 dbSNP
rs1043131243 4480 dbSNP
rs1285706040 4488 dbSNP
rs1284079775 4489 dbSNP
rs1243281595 4501 dbSNP
rs1487544071 4504 dbSNP
rs943538414 4510 dbSNP
rs16840057 4513 dbSNP
rs988143313 4514 dbSNP
rs1270282730 4516 dbSNP
rs1020779298 4517 dbSNP
rs1010833962 4522 dbSNP
rs556750402 4525 dbSNP
rs1410177247 4532 dbSNP
rs1401509367 4533 dbSNP
rs933576149 4540 dbSNP
rs78651674 4545 dbSNP
rs1303503772 4565 dbSNP
rs767286300 4569 dbSNP
rs570581785 4577 dbSNP
rs1280801230 4586 dbSNP
rs1373347259 4588 dbSNP
rs553854411 4600 dbSNP
rs112129867 4601 dbSNP
rs980507061 4615 dbSNP
rs759931499 4618 dbSNP
rs139836882 4631 dbSNP
rs1490333118 4650 dbSNP
rs919427330 4653 dbSNP
rs1369058013 4668 dbSNP
rs1013948277 4670 dbSNP
rs1191831379 4671 dbSNP
rs973508215 4681 dbSNP
rs1235098707 4697 dbSNP
rs1470586205 4700 dbSNP
rs892367472 4708 dbSNP
rs1249428067 4718 dbSNP
rs547871578 4719 dbSNP
rs760057430 4720 dbSNP
rs1164006688 4722 dbSNP
rs111332192 4724 dbSNP
rs1422679628 4725 dbSNP
rs1036068757 4726 dbSNP
rs1440884347 4736 dbSNP
rs185408380 4741 dbSNP
rs1384569859 4743 dbSNP
rs1246181220 4744 dbSNP
rs977553471 4747 dbSNP
rs1266563499 4754 dbSNP
rs1359257198 4758 dbSNP
rs943439987 4764 dbSNP
rs1275780982 4768 dbSNP
rs889314013 4777 dbSNP
rs1020808994 4780 dbSNP
rs571372404 4785 dbSNP
rs1203953673 4786 dbSNP
rs1051921007 4788 dbSNP
rs933607735 4790 dbSNP
rs1462838884 4794 dbSNP
rs1363156088 4795 dbSNP
rs1300035666 4797 dbSNP
rs1436064719 4799 dbSNP
rs1384846461 4804 dbSNP
rs181683453 4811 dbSNP
rs1169396702 4817 dbSNP
rs1420174081 4818 dbSNP
rs1321337918 4824 dbSNP
rs972255490 4829 dbSNP
rs1167929380 4830 dbSNP
rs1407568117 4831 dbSNP
rs1452720403 4831 dbSNP
rs1017557042 4843 dbSNP
rs1380092638 4843 dbSNP
rs1446335886 4844 dbSNP
rs1007876379 4845 dbSNP
rs1340712712 4854 dbSNP
rs1214437221 4858 dbSNP
rs532130013 4867 dbSNP
rs1051827341 4871 dbSNP
rs1204375178 4874 dbSNP
rs908858214 4875 dbSNP
rs564250416 4882 dbSNP
rs1440864807 4888 dbSNP
rs980941276 4889 dbSNP
rs897613004 4890 dbSNP
rs546858186 4896 dbSNP
rs1431334516 4906 dbSNP
rs1391500945 4913 dbSNP
rs527780784 4923 dbSNP
rs1469912204 4930 dbSNP
rs917765206 4932 dbSNP
rs1168731721 4937 dbSNP
rs1477473537 4948 dbSNP
rs1399653047 4956 dbSNP
rs562141409 4957 dbSNP
rs1320710448 4961 dbSNP
rs1399779591 4962 dbSNP
rs981357122 4963 dbSNP
rs956640047 4964 dbSNP
rs970883665 4967 dbSNP
rs1262531681 4972 dbSNP
rs528594658 4978 dbSNP
rs1268620681 4980 dbSNP
rs1000762609 4983 dbSNP
rs942225464 4994 dbSNP
rs576689126 4995 dbSNP
rs1025563890 4999 dbSNP
rs556549666 5011 dbSNP
rs1008082285 5014 dbSNP
rs889205120 5015 dbSNP
rs1158856748 5016 dbSNP
rs770011286 5016 dbSNP
rs879882911 5016 dbSNP
rs972208601 5017 dbSNP
rs990428137 5028 dbSNP
rs561397300 5030 dbSNP
rs546421560 5034 dbSNP
rs1368024148 5038 dbSNP
rs1395993066 5040 dbSNP
rs763402309 5040 dbSNP
rs1300680818 5046 dbSNP
rs1329483931 5059 dbSNP
rs577470739 5060 dbSNP
rs967366236 5064 dbSNP
rs1273313547 5065 dbSNP
rs1036590636 5067 dbSNP
rs1214219865 5072 dbSNP
rs914701418 5075 dbSNP
rs1490497599 5076 dbSNP
rs942256882 5077 dbSNP
rs1265182064 5080 dbSNP
rs957886728 5081 dbSNP
rs908910523 5083 dbSNP
rs1044716229 5093 dbSNP
rs1007478675 5099 dbSNP
rs765803299 5108 dbSNP
rs954752769 5111 dbSNP
rs1407894082 5122 dbSNP
rs1157240540 5145 dbSNP
rs554395400 5157 dbSNP
rs16840054 5158 dbSNP
rs992282668 5160 dbSNP
rs897476124 5161 dbSNP
rs956546113 5163 dbSNP
rs923742977 5172 dbSNP
rs979373929 5173 dbSNP
rs1329577387 5181 dbSNP
rs568038411 5181 dbSNP
rs1037441178 5182 dbSNP
rs1238172843 5185 dbSNP
rs1022084676 5186 dbSNP
rs1359976252 5195 dbSNP
rs1243782139 5196 dbSNP
rs1263667348 5197 dbSNP
rs953590065 5199 dbSNP
rs1195891837 5207 dbSNP
rs1249135568 5218 dbSNP
rs1456172309 5219 dbSNP
rs1185119273 5222 dbSNP
rs773354539 5223 dbSNP
rs1243359840 5224 dbSNP
rs1164479190 5228 dbSNP
rs3841869 5228 dbSNP
rs397841743 5228 dbSNP
rs57202082 5228 dbSNP
rs1174001640 5231 dbSNP
rs1479182499 5237 dbSNP
rs1367267909 5238 dbSNP
rs35645486 5241 dbSNP
rs1463936680 5251 dbSNP
rs1168583234 5255 dbSNP
rs1430393657 5266 dbSNP
rs529791278 5270 dbSNP
rs1444651741 5271 dbSNP
rs1339011920 5272 dbSNP
rs1181964652 5283 dbSNP
rs370502197 5286 dbSNP
rs866490247 5298 dbSNP
rs1482360339 5301 dbSNP
rs772293068 5308 dbSNP
rs537416665 5312 dbSNP
rs953469805 5314 dbSNP
rs569139774 5315 dbSNP
rs928917445 5316 dbSNP
rs1482700971 5318 dbSNP
rs997532678 5324 dbSNP
rs1181661932 5326 dbSNP
rs1430814519 5329 dbSNP
rs1194606593 5331 dbSNP
rs1423523755 5335 dbSNP
rs898010440 5347 dbSNP
rs1036474440 5348 dbSNP
rs1178642855 5351 dbSNP
rs1041972572 5355 dbSNP
rs1465677620 5357 dbSNP
rs552014878 5361 dbSNP
rs888031075 5362 dbSNP
rs946055741 5371 dbSNP
rs532265594 5374 dbSNP
rs1277540984 5387 dbSNP
rs1338294411 5396 dbSNP
rs1045160856 5398 dbSNP
rs947751973 5400 dbSNP
rs990246805 5410 dbSNP
rs1207514460 5415 dbSNP
rs917552780 5426 dbSNP
rs566378051 5430 dbSNP
rs1487092130 5436 dbSNP
rs964102094 5437 dbSNP
rs1263160318 5439 dbSNP
rs3832072 5451 dbSNP
rs574828781 5451 dbSNP
rs1056232253 5460 dbSNP
rs935057391 5465 dbSNP
rs1346033913 5467 dbSNP
rs1430011122 5471 dbSNP
rs986403210 5473 dbSNP
rs1174307767 5475 dbSNP
rs4487075 5476 dbSNP
rs923795095 5478 dbSNP
rs979257804 5490 dbSNP
rs1226418475 5493 dbSNP
rs748373440 5502 dbSNP
rs946650988 5503 dbSNP
rs188928664 5510 dbSNP
rs1297302724 5520 dbSNP
rs527819114 5522 dbSNP
rs985742639 5523 dbSNP
rs1352239672 5534 dbSNP
rs75736152 5535 dbSNP
rs1030717855 5555 dbSNP
rs1406624059 5565 dbSNP
rs774188894 5571 dbSNP
rs370896907 5576 dbSNP
rs1446603069 5584 dbSNP
rs1216963151 5586 dbSNP
rs961699421 5588 dbSNP
rs768371505 5596 dbSNP
rs962082718 5597 dbSNP
rs1285701698 5598 dbSNP
rs749204640 5604 dbSNP
rs1225445775 5626 dbSNP
rs1442359910 5631 dbSNP
rs1247800725 5632 dbSNP
rs1488222185 5648 dbSNP
rs367977220 5661 dbSNP
rs1005928010 5671 dbSNP
rs146150321 5673 dbSNP
rs1440510761 5674 dbSNP
rs531559664 5686 dbSNP
rs1378188612 5695 dbSNP
rs563183024 5696 dbSNP
rs1426301131 5697 dbSNP
rs887907169 5702 dbSNP
rs1023890108 5703 dbSNP
rs115881678 5704 dbSNP
rs1433734715 5706 dbSNP
rs780174939 5707 dbSNP
rs907352529 5708 dbSNP
rs1445492140 5713 dbSNP
rs1306618439 5718 dbSNP
rs1056125691 5723 dbSNP
rs1472479299 5726 dbSNP
rs1291288172 5729 dbSNP
rs1321593072 5746 dbSNP
rs115583423 5750 dbSNP
rs1234606927 5760 dbSNP
rs1458395244 5761 dbSNP
rs893160479 5774 dbSNP
rs1236576007 5776 dbSNP
rs1446264094 5784 dbSNP
rs374067872 5796 dbSNP
rs1054424065 5801 dbSNP
rs902257407 5814 dbSNP
rs1403493492 5819 dbSNP
rs745386939 5821 dbSNP
rs942669125 5822 dbSNP
rs1354552751 5824 dbSNP
rs911333916 5825 dbSNP
rs1328925255 5826 dbSNP
rs775764495 5835 dbSNP
rs745711052 5839 dbSNP
rs986884821 5848 dbSNP
rs946573839 5853 dbSNP
rs1227047528 5868 dbSNP
rs1330954155 5868 dbSNP
rs773807872 5869 dbSNP
rs560692906 5873 dbSNP
rs911023307 5878 dbSNP
rs1318778040 5887 dbSNP
rs540797870 5914 dbSNP
rs985407209 5928 dbSNP
rs933887411 5930 dbSNP
rs1188031725 5935 dbSNP
rs1236611438 5940 dbSNP
rs1471774971 5944 dbSNP
rs1188282673 5946 dbSNP
rs1227652322 5949 dbSNP
rs923099114 5956 dbSNP
rs1376936850 5961 dbSNP
rs561224649 5964 dbSNP
rs184989496 5970 dbSNP
rs144542995 5973 dbSNP
rs961895186 5989 dbSNP
rs1015892658 5993 dbSNP
rs1335291945 5997 dbSNP
rs1363939311 5998 dbSNP
rs976050729 6002 dbSNP
rs75906230 6004 dbSNP
rs1341655630 6005 dbSNP
rs756930623 6007 dbSNP
rs1218114088 6009 dbSNP
rs984458458 6010 dbSNP
rs958398211 6011 dbSNP
rs1034539750 6015 dbSNP
rs1201188402 6016 dbSNP
rs1455937528 6021 dbSNP
rs1440530936 6022 dbSNP
rs1217656078 6025 dbSNP
rs192348345 6032 dbSNP
rs186817928 6047 dbSNP
rs1190886014 6054 dbSNP
rs907378548 6056 dbSNP
rs1405254710 6060 dbSNP
rs952262017 6094 dbSNP
rs566414838 6096 dbSNP
rs1010495545 6101 dbSNP
rs893425524 6102 dbSNP
rs1054710340 6109 dbSNP
rs1399861130 6116 dbSNP
rs1347952822 6139 dbSNP
rs1247571636 6140 dbSNP
rs942700107 6143 dbSNP
rs1332962805 6151 dbSNP
rs889780267 6160 dbSNP
rs1274540239 6165 dbSNP
rs1012525102 6170 dbSNP
rs139668815 6174 dbSNP
rs1186936595 6176 dbSNP
rs1286383379 6180 dbSNP
rs1487930630 6185 dbSNP
rs1214433860 6186 dbSNP
rs896730191 6192 dbSNP
rs1451715338 6200 dbSNP
rs1466460382 6204 dbSNP
rs1034718876 6208 dbSNP
rs1470935780 6209 dbSNP
rs999200537 6218 dbSNP
rs902141458 6227 dbSNP
rs923097961 6227 dbSNP
rs1319844074 6228 dbSNP
rs1419464121 6229 dbSNP
rs1157447960 6235 dbSNP
rs150869692 6237 dbSNP
rs946429096 6244 dbSNP
rs1322930953 6263 dbSNP
rs1329568544 6277 dbSNP
rs184310939 6280 dbSNP
rs1449203115 6292 dbSNP
rs940522938 6293 dbSNP
rs1237650022 6295 dbSNP
rs776760572 6296 dbSNP
rs1050006814 6305 dbSNP
rs933962206 6307 dbSNP
rs548352789 6318 dbSNP
rs1294880411 6322 dbSNP
rs531820145 6346 dbSNP
rs922513726 6350 dbSNP
rs1036873324 6354 dbSNP
rs1289808443 6362 dbSNP
rs1033991472 6364 dbSNP
rs940695914 6366 dbSNP
rs907855985 6368 dbSNP
rs562914464 6373 dbSNP
rs952211492 6374 dbSNP
rs1157184579 6378 dbSNP
rs971132098 6402 dbSNP
rs1167530967 6405 dbSNP
rs1425334282 6410 dbSNP
rs552581528 6430 dbSNP
rs1162753076 6435 dbSNP
rs1389609057 6441 dbSNP
rs75326748 6448 dbSNP
rs560741667 6449 dbSNP
rs1376410480 6450 dbSNP
rs540826880 6453 dbSNP
rs755320243 6454 dbSNP
rs1262768764 6457 dbSNP
rs1035275393 6458 dbSNP
rs1263594205 6465 dbSNP
rs1319465289 6471 dbSNP
rs1007117823 6472 dbSNP
rs999755201 6488 dbSNP
rs966379978 6490 dbSNP
rs1456146095 6503 dbSNP
rs1177167453 6504 dbSNP
rs1021955965 6507 dbSNP
rs1258637176 6508 dbSNP
rs1487386771 6510 dbSNP
rs1248350068 6513 dbSNP
rs1223157814 6526 dbSNP
rs1367204174 6532 dbSNP
rs1478871509 6533 dbSNP
rs1010679791 6543 dbSNP
rs889529750 6544 dbSNP
rs866182686 6547 dbSNP
rs1399876047 6548 dbSNP
rs1049615493 6550 dbSNP
rs1464203280 6554 dbSNP
rs1304383369 6558 dbSNP
rs1395229224 6567 dbSNP
rs998433992 6567 dbSNP
rs867385639 6573 dbSNP
rs998684210 6574 dbSNP
rs1037077038 6579 dbSNP
rs1315699595 6579 dbSNP
rs897274398 6579 dbSNP
rs193003947 6580 dbSNP
rs1352342751 6590 dbSNP
rs1483806973 6590 dbSNP
rs1300182033 6593 dbSNP
rs1200219386 6601 dbSNP
rs909039377 6605 dbSNP
rs1218935701 6613 dbSNP
rs1194480811 6616 dbSNP
rs939930556 6623 dbSNP
rs1476873280 6626 dbSNP
rs907906970 6629 dbSNP
rs1365967746 6632 dbSNP
rs12619380 6633 dbSNP
rs930781189 6636 dbSNP
rs926955978 6641 dbSNP
rs1362386007 6649 dbSNP
rs916661021 6649 dbSNP
rs187889705 6652 dbSNP
rs971467834 6663 dbSNP
rs913008256 6673 dbSNP
rs1301605484 6678 dbSNP
rs1311199384 6680 dbSNP
rs1233022811 6684 dbSNP
rs1278550550 6686 dbSNP
rs1373798143 6687 dbSNP
rs988546247 6697 dbSNP
rs1218055729 6703 dbSNP
rs1175665840 6704 dbSNP
rs1431187288 6705 dbSNP
rs960883742 6717 dbSNP
rs1192967647 6727 dbSNP
rs957538611 6732 dbSNP
rs574973770 6744 dbSNP
rs558164980 6751 dbSNP
rs978368775 6758 dbSNP
rs528864978 6760 dbSNP
rs1420078422 6761 dbSNP
rs1199929164 6775 dbSNP
rs112940382 6778 dbSNP
rs1438016624 6781 dbSNP
rs1293561373 6785 dbSNP
rs954285730 6785 dbSNP
rs766874923 6801 dbSNP
rs1310981589 6817 dbSNP
rs1030318360 6825 dbSNP
rs1241283144 6826 dbSNP
rs376225051 6831 dbSNP
rs953701493 6838 dbSNP
rs1255010481 6857 dbSNP
rs1028491270 6869 dbSNP
rs141528495 6886 dbSNP
rs997919608 6888 dbSNP
rs1192063639 6894 dbSNP
rs760688270 6894 dbSNP
rs1243724046 6902 dbSNP
rs536455495 6903 dbSNP
rs1440133931 6920 dbSNP
rs1285581000 6925 dbSNP
rs1405741318 6932 dbSNP
rs1406950131 6944 dbSNP
rs1164879493 6954 dbSNP
rs1036809419 6955 dbSNP
rs148315132 6956 dbSNP
rs1287012558 6968 dbSNP
rs888358125 6971 dbSNP
rs1048841774 6976 dbSNP
rs937264518 6984 dbSNP
rs1048276072 6985 dbSNP
rs879035545 6990 dbSNP
rs927267632 7005 dbSNP
rs1046041568 7012 dbSNP
rs1314644781 7012 dbSNP
rs145301000 7012 dbSNP
rs770918447 7012 dbSNP
rs781641131 7012 dbSNP
rs1473648141 7013 dbSNP
rs550745486 7017 dbSNP
rs1182442117 7018 dbSNP
rs1412934842 7019 dbSNP
rs1473965612 7021 dbSNP
rs1172130503 7022 dbSNP
rs1400611022 7028 dbSNP
rs1176864922 7029 dbSNP
rs1328857401 7030 dbSNP
rs1353194406 7032 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084043
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep2
Location of target site ENST00000427836.2 | 3UTR | GAGACUGAGGCAGGAGAAUUGCUUGAACCUGGGAGGCAGAGGUUGCAGUGAGCCGAGAUUGCGCCACUGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: <