miRTarBase - #MIRT675577 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WWC1   
Synonyms HBEBP3, HBEBP36, KIBRA, MEMRYQTL, PPP1R168
Description WW and C2 domain containing 1
Transcript NM_001161661   
Other Transcripts NM_001161662 , NM_015238   
Expression
Putative miRNA Targets on WWC1
3'UTR of WWC1
(miRNA target sites are highlighted)
>WWC1|NM_001161661|3'UTR
   1 TCGCCAGAAAAGTATTTCCTTTGTTCCACTGACCAGGCTGTGAACATTGACTGTGGCTAAAGTTATTTATGTGGTGTTAT
  81 ATGAAGGTACTGAGTCACAAGTCCTCTAGTGCTCTTGTTGGTTTGAAGATGAACCGACTTTTTAGTTTGGGTCCTACTGT
 161 TGTTATTAAAAACAGAACAAAAACAAAACACACACACACACAAAAACAGAAACAAAAAAAACCAGCATTAAAATAATAAG
 241 ATTGTATAGTTTGTATATTTAGGAGTGTATTTTTGGGAAAGAAAATTTAAATGAACTAAAGCAGTATTGAGTTGCTGCTC
 321 TTCTTAAAATCGTTTAGATTTTTTTTGGTTTGTACAGCTCCACCTTTTAGAGGTCTTACTGCAATAAGAAGTAATGCCTG
 401 GGGGACGGTAATCCTAATAGGACGTCCCGCACTTGTCACAGTACAGCTAATTTTTCCTAGTTAACATATTTTGTACAATA
 481 TTAAAAAAATGCACAGAAACCATTGGGGGGGATTCAGAGGTGCATCCACGGATCTTCTTGAGCTGTGACGTGTTTTTATG
 561 TGGCTGCCCAACGTGGAGCGGGCAGTGTGATAGGCTGGGTGGGCTAAGCAGCCTAGTCTATGTGGGTGACAGGCCACGCT
 641 GGTCTCAGATGCCCAGTGAAGCCACTAACATGAGTGAGGGGAGGGCTGTGGGGAACTCCATTCAGTTTTATCTCCATCAA
 721 TAAAGTGGCCTTTCAAAAAGAATCTTCCTCTTGCTCTCTTTTTCTTTCCTACCCCTCACTTCATCTGTTTCCCTGATTTT
 801 TGACTCTCCCCTTTCCAGTCATTTCTTTCCCACCCATCCGCAGTCCTGGAAACATTTATTTTTTCTTTTGCCCACTGTTT
 881 TCATTTGCTCATTAAATTAAAATGACTGCTCGGCTCATTGGGAATCCACATCCCCAAGTTAGACTGGGGATATGCTCTCT
 961 GTACTGTCTCCTTCTATGGAATTCCACCCCACCCAGAGAGAGATGACTTCACAGTTTGTTCATATGAGCATCATCCCATG
1041 TCGTCCCCAACCCAGGGGCTGGTAGGTGCTACAGCTTGTGCTTCATGCTGCTCCTGTGGCCCCTATTCCTACCCAGCTCA
1121 GAGCTTTGCAGGGTCTACTGCAGACAATCAGAAGTCAGTTTCTAACAAATAGCAACAGCCACAAATCTCTTCCTCCTTCC
1201 TCTCTGACATTACCCTGTGCAACTTTTCTCAAAGTCTGTTGCACCACTCAGCAAAGCAAGTTGCACCAGCTATATCAGAA
1281 TCACCTGGGGCAGCCTATTAAAAATGCAGACTGTTGAGACCATCCTGGCTAACACGGTGAAACCCTGTCTCTACTAAAAA
1361 TACAAAAAATTAGCCGGCCGTGGTGGCGGGCAGCTACTCGGGAGGCTGAGGCAGGAGAATGACCTGAACCTGGGAGGCAG
1441 AGCTTGCAGTGAGCTGAGATTGTGCCACTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCGTCTCAAAAAAAAAAAAAA
1521 AAGAAAAATGCAGACTGGCTGGCGCGGTGGCTCATGCTTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGCAGATCAAC
1601 TGAGATCGGGGGTTCGAGACCAGCCTGATCAACATGGAGAAACCTGGTCTCTACTAAAAATACATAATTAGCTGGGCGTA
1681 GTGGCGCATACCTGTAATCCCAGCTACTTGGGTGGCCAAGGCTTGAACCCAGGAGGCGGAGGTTGCGGTGAGCCGAGATG
1761 GCGCCATTGACTCCAGCCTGGGCAACAAGAGCGTAACTCCATCTCAAAAAAATAATAATAATAAAAATAAAATGCAGACT
1841 GTCAGGTCCTCTCTAGACCCACTGAACTATCCCGCCCACCCTGGGACGGTCCCCAGTGCCAGTGTTTTACCCATGTTCCC
1921 TCTGTAAGTCTTATGCACACCGCAATTTGAGAGCCCCACTGGTATAAAGTGAGTGAAACCCAGGCAGAGACAGGCAAAAT
2001 GGTGAGGCCCGCATCCTATTGGTGAGTCACACAGGGAACGCTGAAATTCATGGCCTTCTCCAGGCTACTGGGAACCCATG
2081 GGCGGTGATGGAGGGAGTGGTGCCACCTTCACTTGCTGCTGAGGCTCTTCCCCCTCTCCCCAGCATACTCCTTACCTGGC
2161 TGTCTCTCCTCATGTATAAGGAACCTATAGTGGTGTAGAATCTACTCTTCTTCCCCCTGTGGCTTCCAGGCCCCCCTGTA
2241 TAGCTGCTATCCAGCCCGATTTCTCACCACTGGCCCAGGGCTTCCTCCTGCCCCGTGGCTTCACGTCTCTGAACACATCA
2321 ATCTCTGATGTTCTCTCTCCTTCCATTGAATTCCACCAGACACATTCAGGGTTTACTTCGTAATGTCTTCATATGAGTAT
2401 CAATCAACACCTTCCCCAACTCAATTGTACTAGGTTGTAGAGCACAAGGATGGTCTCGTGCTGCTCTGTGGCACCTGTGC
2481 CTACACTCCTCTGAGCTTTGAGGAGGCTGCTCTCTTTGCTGACCCCATGATCTTTTCTGCCCTTCTGTTAAGGGCATTGG
2561 CCACAGCAACGGGGCAAATGCCCCAAGCTGGCTGTAAGTGACCCATCCCTTTGGCTCCCATGATTAGACCAAGGAGAGGC
2641 ATGGGGTCCAGCTGAGCCATTCAGAACCATTCCTTAGCATTTTCCACTCAAAGGTTAGAGATGAGATTTTCTCTTCCCAA
2721 GGCTACCTCTGGCCATGGTTCCAGCTTCATGGGGGCAATGGGATTAGGAAAATGAGGTCAACCTGCAAAGGAAAGCAGAT
2801 GCAAGAGATGGAGACAGAATGGGGGTGTCCTGGGGATCTTGGAGCCTGAATTCATTGGCACAAAAGGCAGCAGCATCCTC
2881 ACTGTATCTGCAGTCCATTTGGACTCAATAAAAACTTTGAAAGTCACATGTGTTATGGAATTCCTTCTCAGTGACACATT
2961 CATCTGTGCTCAGTTGTCCCAGCAAGGGTCAGCCCCTCATACCCCTGCAGCATCCGCTGCTATGAAGCAGAGCTGTAAAC
3041 GCCCTCCCTGTGTATAGGAAAAGCTACATGGAGCAAATCCTCCTGCCTGAAGAAGTGCATCTCAGCATCACTTCAGCTGT
3121 CGGGGCATTTGTGGGGAGAACCAGACCACCTCTGCGGAAGGCAGCAGACCCTCTTCCAGCCATGGATGGAGTTGAATTCT
3201 CTATAAACGGTTCACCAGCAAACCACCAATACATTCCATTGTTTGCCTAGAGAGAAATTTAAAAATAAATAAATGTTCAC
3281 TTATAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG-UGUGAGGu 5'
            ::||||  || | ||||||| 
Target 5' gtGGCACCTGTGCCTACACTCCt 3'
2468 - 2490 160.00 -18.30
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            | ||||| |   |||:||| 
Target 5' aaACCACCAAT---ACATTCCa 3'
3220 - 3238 141.00 -16.30
3
miRNA  3' guuuguggUAACA-----GUGUGAGGu 5'
                  |||||     ::|||||| 
Target 5' gagctgagATTGTGCCACTGCACTCCa 3'
1451 - 1477 134.00 -13.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN2534008 3 COSMIC
COSN30454253 5 COSMIC
COSN21913044 8 COSMIC
COSN31507821 15 COSMIC
COSN31597750 39 COSMIC
COSN31602439 43 COSMIC
COSN30505113 137 COSMIC
COSN31530582 393 COSMIC
COSN31537768 407 COSMIC
COSN31566156 430 COSMIC
COSN31530781 443 COSMIC
COSN31541121 512 COSMIC
COSN6282492 521 COSMIC
COSN22237766 1006 COSMIC
COSN20102162 1059 COSMIC
COSN6282493 1316 COSMIC
COSN15564957 1507 COSMIC
COSN19002439 1537 COSMIC
COSN26756561 1823 COSMIC
COSN31962518 2040 COSMIC
COSN30389239 2259 COSMIC
COSN2086297 2267 COSMIC
COSN17536469 2435 COSMIC
COSN15660608 2823 COSMIC
COSN5023360 3185 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773970413 2 dbSNP
rs201190242 3 dbSNP
rs369535616 4 dbSNP
rs889839834 5 dbSNP
rs1321481837 15 dbSNP
rs547943833 17 dbSNP
rs1269005966 18 dbSNP
rs372819252 19 dbSNP
rs186198517 24 dbSNP
rs369478560 35 dbSNP
rs1489065057 39 dbSNP
rs1193406136 42 dbSNP
rs776384057 46 dbSNP
rs200181853 47 dbSNP
rs201928379 48 dbSNP
rs1344896191 53 dbSNP
rs897423318 66 dbSNP
rs994417729 72 dbSNP
rs901363498 81 dbSNP
rs1027623007 88 dbSNP
rs1343257542 92 dbSNP
rs538950204 97 dbSNP
rs1426198207 101 dbSNP
rs1300871509 102 dbSNP
rs1401025752 103 dbSNP
rs952927937 105 dbSNP
rs1196753965 113 dbSNP
rs998435046 124 dbSNP
rs1028503527 131 dbSNP
rs1364464827 136 dbSNP
rs990909977 137 dbSNP
rs558723849 155 dbSNP
rs970445793 163 dbSNP
rs981783307 170 dbSNP
rs1021253449 188 dbSNP
rs968432131 188 dbSNP
rs145041993 189 dbSNP
rs1406747700 192 dbSNP
rs923614713 199 dbSNP
rs1288176317 202 dbSNP
rs934960997 202 dbSNP
rs190173187 204 dbSNP
rs960171487 208 dbSNP
rs1173887928 209 dbSNP
rs1361279029 210 dbSNP
rs1468965502 213 dbSNP
rs1177944290 214 dbSNP
rs1225051511 214 dbSNP
rs1429434316 214 dbSNP
rs915101787 219 dbSNP
rs1289829972 220 dbSNP
rs992686846 223 dbSNP
rs1186383478 234 dbSNP
rs1486429287 245 dbSNP
rs1250283339 250 dbSNP
rs1490227526 254 dbSNP
rs539926539 261 dbSNP
rs1202050572 262 dbSNP
rs1461021041 264 dbSNP
rs1263936531 281 dbSNP
rs1225465187 290 dbSNP
rs931809044 301 dbSNP
rs1305772623 305 dbSNP
rs553800956 308 dbSNP
rs889913158 315 dbSNP
rs1263876740 320 dbSNP
rs1334415976 324 dbSNP
rs948618667 332 dbSNP
rs180749116 335 dbSNP
rs1369449994 338 dbSNP
rs1460033930 339 dbSNP
rs1041096492 341 dbSNP
rs897168249 343 dbSNP
rs1371983220 360 dbSNP
rs542568165 361 dbSNP
rs1446800131 368 dbSNP
rs1170439887 380 dbSNP
rs994552254 381 dbSNP
rs1027240857 383 dbSNP
rs888664230 385 dbSNP
rs1243983014 390 dbSNP
rs562346947 397 dbSNP
rs148403937 398 dbSNP
rs545359988 407 dbSNP
rs901271605 408 dbSNP
rs970476838 416 dbSNP
rs1382077295 419 dbSNP
rs141561264 424 dbSNP
rs1244975948 425 dbSNP
rs527508015 425 dbSNP
rs35816030 426 dbSNP
rs1334701806 428 dbSNP
rs956398885 429 dbSNP
rs1384781260 430 dbSNP
rs1389313723 431 dbSNP
rs1395191923 433 dbSNP
rs547636558 437 dbSNP
rs989515630 440 dbSNP
rs1463027528 442 dbSNP
rs1372978383 466 dbSNP
rs567716579 467 dbSNP
rs1162149039 468 dbSNP
rs890002768 470 dbSNP
rs1189959966 483 dbSNP
rs1243476431 483 dbSNP
rs1011147100 484 dbSNP
rs1297486787 489 dbSNP
rs1249971895 492 dbSNP
rs1177880030 493 dbSNP
rs1484056892 503 dbSNP
rs1314029198 504 dbSNP
rs1221631841 505 dbSNP
rs953273008 507 dbSNP
rs1236488359 508 dbSNP
rs985984204 512 dbSNP
rs1307213773 513 dbSNP
rs911713174 516 dbSNP
rs1392630292 517 dbSNP
rs1343029317 521 dbSNP
rs1239975004 522 dbSNP
rs571011268 530 dbSNP
rs1424583117 542 dbSNP
rs944494389 543 dbSNP
rs1041154574 544 dbSNP
rs1366628811 546 dbSNP
rs754370813 550 dbSNP
rs930001199 551 dbSNP
rs1363475594 557 dbSNP
rs1182722523 561 dbSNP
rs1473645037 569 dbSNP
rs1484917503 571 dbSNP
rs116655861 573 dbSNP
rs558518753 574 dbSNP
rs569997695 576 dbSNP
rs1490486177 577 dbSNP
rs1269315118 580 dbSNP
rs1031807943 581 dbSNP
rs888740334 587 dbSNP
rs533178059 591 dbSNP
rs1012435948 593 dbSNP
rs549747290 594 dbSNP
rs1260960674 602 dbSNP
rs1229840618 606 dbSNP
rs1320882640 607 dbSNP
rs538937923 614 dbSNP
rs570308914 621 dbSNP
rs1332203363 622 dbSNP
rs906726621 633 dbSNP
rs14471 635 dbSNP
rs992619437 636 dbSNP
rs1380894673 638 dbSNP
rs1439943056 639 dbSNP
rs1159428582 656 dbSNP
rs1003626197 659 dbSNP
rs969962501 665 dbSNP
rs796945403 669 dbSNP
rs558858165 671 dbSNP
rs1030755708 679 dbSNP
rs956649107 689 dbSNP
rs1010609735 693 dbSNP
rs1022360782 696 dbSNP
rs1190864290 700 dbSNP
rs556060006 701 dbSNP
rs986059864 721 dbSNP
rs1452399674 737 dbSNP
rs911789843 738 dbSNP
rs1210256103 744 dbSNP
rs565915343 755 dbSNP
rs1262072865 759 dbSNP
rs1223632980 765 dbSNP
rs965871471 774 dbSNP
rs1346428648 804 dbSNP
rs1277172465 810 dbSNP
rs757769456 815 dbSNP
rs918715813 817 dbSNP
rs930051328 840 dbSNP
rs534854305 841 dbSNP
rs868855657 844 dbSNP
rs779229879 845 dbSNP
rs1437660394 859 dbSNP
rs1404223148 865 dbSNP
rs1336246987 866 dbSNP
rs1470352114 874 dbSNP
rs1049876326 877 dbSNP
rs1166157312 885 dbSNP
rs1475026200 888 dbSNP
rs554873660 894 dbSNP
rs909874643 900 dbSNP
rs746234735 904 dbSNP
rs1242154317 906 dbSNP
rs1335868924 910 dbSNP
rs1443704663 911 dbSNP
rs948031812 912 dbSNP
rs1045291784 917 dbSNP
rs1377314748 918 dbSNP
rs1392226739 919 dbSNP
rs1043982965 930 dbSNP
rs1309394302 933 dbSNP
rs1380963678 934 dbSNP
rs1314699620 939 dbSNP
rs1449026219 944 dbSNP
rs573633379 948 dbSNP
rs537841198 950 dbSNP
rs902775972 951 dbSNP
rs1371124717 958 dbSNP
rs1170342607 959 dbSNP
rs998901886 968 dbSNP
rs1384369565 972 dbSNP
rs542402719 977 dbSNP
rs895520209 980 dbSNP
rs556112138 990 dbSNP
rs1053030530 991 dbSNP
rs892239162 996 dbSNP
rs1437836138 999 dbSNP
rs1014054587 1001 dbSNP
rs1326296053 1002 dbSNP
rs932315891 1004 dbSNP
rs576138325 1006 dbSNP
rs1242951230 1010 dbSNP
rs1011058011 1013 dbSNP
rs1481145059 1019 dbSNP
rs1178623628 1041 dbSNP
rs185192380 1044 dbSNP
rs565151000 1047 dbSNP
rs58250573 1051 dbSNP
rs541188489 1053 dbSNP
rs200561729 1055 dbSNP
rs397999868 1055 dbSNP
rs398084646 1055 dbSNP
rs57187598 1055 dbSNP
rs201181632 1056 dbSNP
rs1403026976 1060 dbSNP
rs1364800143 1067 dbSNP
rs961320742 1069 dbSNP
rs1018881614 1071 dbSNP
rs965945112 1072 dbSNP
rs878923113 1074 dbSNP
rs922661759 1074 dbSNP
rs79081700 1075 dbSNP
rs1253306436 1077 dbSNP
rs985533653 1078 dbSNP
rs911376811 1097 dbSNP
rs1175582010 1101 dbSNP
rs946855216 1102 dbSNP
rs1400830443 1105 dbSNP
rs1222776386 1113 dbSNP
rs1323836785 1118 dbSNP
rs1463321356 1141 dbSNP
rs1026550552 1151 dbSNP
rs1223406090 1155 dbSNP
rs1330008191 1163 dbSNP
rs530207620 1173 dbSNP
rs1157151251 1176 dbSNP
rs141046496 1176 dbSNP
rs779701539 1178 dbSNP
rs951525885 1184 dbSNP
rs1403123848 1190 dbSNP
rs1390980718 1194 dbSNP
rs1344812629 1207 dbSNP
rs984626438 1215 dbSNP
rs1284026619 1216 dbSNP
rs1294002574 1231 dbSNP
rs1347425857 1238 dbSNP
rs746639359 1249 dbSNP
rs924147735 1253 dbSNP
rs1317251469 1265 dbSNP
rs1263036398 1273 dbSNP
rs1413606457 1275 dbSNP
rs1308503586 1285 dbSNP
rs935602466 1298 dbSNP
rs1479785052 1306 dbSNP
rs1425118799 1314 dbSNP
rs948062650 1323 dbSNP
rs768087338 1325 dbSNP
rs574599863 1336 dbSNP
rs868061158 1337 dbSNP
rs1465528715 1362 dbSNP
rs1270180391 1364 dbSNP
rs980729261 1376 dbSNP
rs190819545 1377 dbSNP
rs563685633 1380 dbSNP
rs1311303151 1381 dbSNP
rs1359687607 1383 dbSNP
rs113393019 1387 dbSNP
rs1479158448 1388 dbSNP
rs776195908 1389 dbSNP
rs892640358 1395 dbSNP
rs146398270 1397 dbSNP
rs1168076227 1401 dbSNP
rs765193815 1403 dbSNP
rs888834603 1406 dbSNP
rs1007266860 1427 dbSNP
rs1230578442 1431 dbSNP
rs1450437185 1435 dbSNP
rs1018621485 1436 dbSNP
rs552167652 1438 dbSNP
rs1367580759 1443 dbSNP
rs993810403 1448 dbSNP
rs1403163969 1453 dbSNP
rs1305706848 1460 dbSNP
rs1026203270 1461 dbSNP
rs565991685 1462 dbSNP
rs534988358 1464 dbSNP
rs951972562 1468 dbSNP
rs1228904720 1469 dbSNP
rs1283277972 1470 dbSNP
rs955403474 1477 dbSNP
rs1367029676 1484 dbSNP
rs985438913 1486 dbSNP
rs1216788374 1487 dbSNP
rs1451418025 1495 dbSNP
rs1379343795 1500 dbSNP
rs1293922482 1501 dbSNP
rs1304097647 1502 dbSNP
rs548760240 1503 dbSNP
rs1257319323 1507 dbSNP
rs1353304793 1507 dbSNP
rs1423450332 1507 dbSNP
rs565923406 1507 dbSNP
rs79016875 1507 dbSNP
rs911281363 1507 dbSNP
rs1183675331 1508 dbSNP
rs76420938 1509 dbSNP
rs1479675033 1515 dbSNP
rs139676847 1516 dbSNP
rs1489677533 1524 dbSNP
rs1221099307 1530 dbSNP
rs1242133495 1531 dbSNP
rs1486819138 1544 dbSNP
rs1017006007 1545 dbSNP
rs969440443 1546 dbSNP
rs980762020 1547 dbSNP
rs1444994229 1550 dbSNP
rs927955124 1551 dbSNP
rs939337781 1556 dbSNP
rs1371957062 1558 dbSNP
rs988817468 1561 dbSNP
rs914119790 1563 dbSNP
rs1410969957 1564 dbSNP
rs935565464 1580 dbSNP
rs1422900555 1584 dbSNP
rs368417898 1589 dbSNP
rs6889832 1590 dbSNP
rs1433552023 1591 dbSNP
rs918179682 1595 dbSNP
rs112282853 1597 dbSNP
rs1044087231 1600 dbSNP
rs1247170724 1608 dbSNP
rs1209058392 1612 dbSNP
rs1356730347 1613 dbSNP
rs538606133 1617 dbSNP
rs1327950929 1621 dbSNP
rs1288414584 1625 dbSNP
rs941124944 1635 dbSNP
rs1038608384 1636 dbSNP
rs1040092554 1644 dbSNP
rs1301792635 1649 dbSNP
rs901522151 1650 dbSNP
rs1284381112 1656 dbSNP
rs773248079 1676 dbSNP
rs1448189556 1677 dbSNP
rs993157536 1678 dbSNP
rs1026655224 1679 dbSNP
rs887690125 1687 dbSNP
rs1461653081 1688 dbSNP
rs1185201126 1697 dbSNP
rs146575614 1700 dbSNP
rs1240974414 1702 dbSNP
rs572325145 1708 dbSNP
rs1452007979 1712 dbSNP
rs1269198623 1717 dbSNP
rs1443047240 1720 dbSNP
rs1203070208 1721 dbSNP
rs1006048657 1728 dbSNP
rs866492029 1731 dbSNP
rs541017436 1738 dbSNP
rs1210088578 1739 dbSNP
rs1022732552 1747 dbSNP
rs244893 1748 dbSNP
rs1233118566 1752 dbSNP
rs149800395 1755 dbSNP
rs1031575823 1756 dbSNP
rs1035044117 1758 dbSNP
rs1157642464 1760 dbSNP
rs1388556935 1763 dbSNP
rs1458933642 1764 dbSNP
rs960993034 1764 dbSNP
rs1403963144 1779 dbSNP
rs1339130664 1781 dbSNP
rs543878979 1782 dbSNP
rs988124960 1783 dbSNP
rs1478308722 1787 dbSNP
rs563415585 1793 dbSNP
rs369862500 1794 dbSNP
rs1448603399 1811 dbSNP
rs764247080 1811 dbSNP
rs1190084242 1813 dbSNP
rs371655967 1817 dbSNP
rs1277287465 1820 dbSNP
rs1279745930 1828 dbSNP
rs1352287411 1833 dbSNP
rs992756534 1841 dbSNP
rs552106116 1842 dbSNP
rs968327828 1846 dbSNP
rs759340878 1850 dbSNP
rs1364898994 1853 dbSNP
rs979621084 1857 dbSNP
rs910712807 1858 dbSNP
rs918135020 1858 dbSNP
rs1221567137 1861 dbSNP
rs943491383 1864 dbSNP
rs188639474 1874 dbSNP
rs528751844 1875 dbSNP
rs928995662 1886 dbSNP
rs540529317 1888 dbSNP
rs1047388312 1889 dbSNP
rs1166038335 1891 dbSNP
rs548633047 1898 dbSNP
rs1460689944 1905 dbSNP
rs1187180805 1910 dbSNP
rs1390522674 1912 dbSNP
rs1233662637 1913 dbSNP
rs1471243901 1935 dbSNP
rs1187641250 1940 dbSNP
rs568614831 1942 dbSNP
rs537217532 1943 dbSNP
rs1341984500 1949 dbSNP
rs1275782184 1950 dbSNP
rs1354513091 1951 dbSNP
rs929802932 1952 dbSNP
rs1448876982 1955 dbSNP
rs1411270620 1957 dbSNP
rs1306147863 1966 dbSNP
rs1006081413 1976 dbSNP
rs1409128511 1978 dbSNP
rs1470606303 1985 dbSNP
rs569842078 1996 dbSNP
rs1404422485 2001 dbSNP
rs191385447 2002 dbSNP
rs1412655255 2007 dbSNP
rs76232984 2008 dbSNP
rs78600555 2011 dbSNP
rs905723537 2012 dbSNP
rs34947962 2015 dbSNP
rs1002622528 2016 dbSNP
rs1361558583 2018 dbSNP
rs1035523042 2019 dbSNP
rs1030046071 2033 dbSNP
rs891006471 2037 dbSNP
rs1253082199 2039 dbSNP
rs960815001 2040 dbSNP
rs1010023387 2041 dbSNP
rs1006794516 2043 dbSNP
rs1020937107 2068 dbSNP
rs148933898 2072 dbSNP
rs968320278 2075 dbSNP
rs1227794864 2077 dbSNP
rs979694700 2083 dbSNP
rs910786507 2084 dbSNP
rs903894158 2085 dbSNP
rs1323886509 2086 dbSNP
rs183708864 2092 dbSNP
rs187036116 2093 dbSNP
rs923050452 2112 dbSNP
rs1472611543 2119 dbSNP
rs929051555 2125 dbSNP
rs992304960 2133 dbSNP
rs1025183039 2134 dbSNP
rs1477266494 2135 dbSNP
rs1246484253 2137 dbSNP
rs1222658480 2138 dbSNP
rs1345565930 2144 dbSNP
rs165950 2149 dbSNP
rs1266392814 2163 dbSNP
rs908890097 2174 dbSNP
rs941675566 2186 dbSNP
rs981043366 2188 dbSNP
rs1290184791 2189 dbSNP
rs926932198 2191 dbSNP
rs1366724087 2196 dbSNP
rs962377374 2198 dbSNP
rs554596462 2205 dbSNP
rs1196166521 2206 dbSNP
rs974163716 2212 dbSNP
rs1044292852 2215 dbSNP
rs369197420 2217 dbSNP
rs1002696239 2218 dbSNP
rs1161997174 2228 dbSNP
rs1251224269 2232 dbSNP
rs1050875548 2235 dbSNP
rs574698867 2236 dbSNP
rs912433281 2237 dbSNP
rs942610297 2239 dbSNP
rs1188136499 2241 dbSNP
rs1465456306 2242 dbSNP
rs1202296437 2247 dbSNP
rs757217516 2248 dbSNP
rs1056965100 2249 dbSNP
rs1039569216 2250 dbSNP
rs1279192894 2255 dbSNP
rs1220763334 2257 dbSNP
rs903800859 2258 dbSNP
rs543210719 2259 dbSNP
rs1009643084 2263 dbSNP
rs1021430463 2264 dbSNP
rs1407888143 2273 dbSNP
rs903876486 2277 dbSNP
rs6890606 2278 dbSNP
rs892543718 2286 dbSNP
rs758809841 2287 dbSNP
rs1437019111 2291 dbSNP
rs1406244052 2292 dbSNP
rs1025130651 2295 dbSNP
rs576920928 2296 dbSNP
rs1330464638 2305 dbSNP
rs1228003801 2306 dbSNP
rs1482940476 2308 dbSNP
rs1238031515 2317 dbSNP
rs545930526 2336 dbSNP
rs780362536 2338 dbSNP
rs1337167753 2353 dbSNP
rs1339882034 2361 dbSNP
rs1273634412 2363 dbSNP
rs544216854 2368 dbSNP
rs191852364 2380 dbSNP
rs746727447 2381 dbSNP
rs1002384773 2383 dbSNP
rs1394967020 2394 dbSNP
rs1379230951 2396 dbSNP
rs964953451 2404 dbSNP
rs1016501582 2415 dbSNP
rs1490552815 2417 dbSNP
rs1417149359 2425 dbSNP
rs528504369 2426 dbSNP
rs1369190634 2431 dbSNP
rs963967343 2433 dbSNP
rs1430756885 2455 dbSNP
rs1375025612 2457 dbSNP
rs976678214 2458 dbSNP
rs1266784668 2459 dbSNP
rs1414620645 2469 dbSNP
rs1190051280 2470 dbSNP
rs1482040498 2471 dbSNP
rs1030484183 2472 dbSNP
rs918279463 2475 dbSNP
rs541022414 2480 dbSNP
rs1263360634 2486 dbSNP
rs1243571222 2487 dbSNP
rs244892 2489 dbSNP
rs183701203 2497 dbSNP
rs942515148 2504 dbSNP
rs1474625279 2511 dbSNP
rs551150021 2512 dbSNP
rs1307909531 2523 dbSNP
rs780647434 2524 dbSNP
rs1410881961 2528 dbSNP
rs186949880 2529 dbSNP
rs1399045642 2532 dbSNP
rs979730270 2535 dbSNP
rs1457582135 2543 dbSNP
rs145276992 2548 dbSNP
rs936620067 2552 dbSNP
rs938584538 2556 dbSNP
rs1300772234 2561 dbSNP
rs1420694275 2564 dbSNP
rs1057387458 2566 dbSNP
rs1264989354 2567 dbSNP
rs533254419 2571 dbSNP
rs544023211 2572 dbSNP
rs552337968 2576 dbSNP
rs147649406 2578 dbSNP
rs769139819 2583 dbSNP
rs903907573 2584 dbSNP
rs1288315437 2586 dbSNP
rs1240386347 2587 dbSNP
rs142168995 2595 dbSNP
rs554566838 2599 dbSNP
rs1324525846 2603 dbSNP
rs900782530 2607 dbSNP
rs1368611057 2614 dbSNP
rs1046488146 2618 dbSNP
rs1455752624 2619 dbSNP
rs1387955283 2628 dbSNP
rs1159903040 2636 dbSNP
rs113870642 2637 dbSNP
rs1030976277 2640 dbSNP
rs1016446210 2642 dbSNP
rs950914561 2664 dbSNP
rs963652598 2668 dbSNP
rs17070265 2671 dbSNP
rs1016001111 2675 dbSNP
rs963096133 2683 dbSNP
rs537396154 2690 dbSNP
rs138839904 2701 dbSNP
rs1206323612 2702 dbSNP
rs192509207 2709 dbSNP
rs926950086 2726 dbSNP
rs1355687642 2736 dbSNP
rs749208276 2738 dbSNP
rs951091928 2751 dbSNP
rs1206302432 2754 dbSNP
rs1372149539 2760 dbSNP
rs114990638 2769 dbSNP
rs1019285500 2775 dbSNP
rs1302879377 2776 dbSNP
rs1321308836 2777 dbSNP
rs1188343736 2780 dbSNP
rs140148118 2783 dbSNP
rs1446117007 2789 dbSNP
rs573301575 2791 dbSNP
rs1466396118 2792 dbSNP
rs913103657 2794 dbSNP
rs1396659794 2797 dbSNP
rs1166392943 2806 dbSNP
rs541819807 2814 dbSNP
rs1453836876 2827 dbSNP
rs1248188374 2828 dbSNP
rs975209361 2829 dbSNP
rs1254741733 2833 dbSNP
rs1160296613 2835 dbSNP
rs73802326 2836 dbSNP
rs549711201 2838 dbSNP
rs1043277176 2839 dbSNP
rs1282892636 2840 dbSNP
rs1226564450 2850 dbSNP
rs1341763958 2859 dbSNP
rs1270945615 2861 dbSNP
rs1337168497 2866 dbSNP
rs903960000 2868 dbSNP
rs1384671737 2872 dbSNP
rs1415310528 2873 dbSNP
rs1454815453 2875 dbSNP
rs771540206 2879 dbSNP
rs988494000 2880 dbSNP
rs531108472 2885 dbSNP
rs1169258668 2909 dbSNP
rs1262513422 2909 dbSNP
rs1039107715 2911 dbSNP
rs1327732342 2912 dbSNP
rs1208607289 2913 dbSNP
rs1471544562 2920 dbSNP
rs1367372328 2929 dbSNP
rs544962050 2933 dbSNP
rs1187529713 2960 dbSNP
rs949339957 2965 dbSNP
rs150329647 2973 dbSNP
rs1482923537 2976 dbSNP
rs905244527 2977 dbSNP
rs1197772921 2988 dbSNP
rs1354406810 2989 dbSNP
rs533597775 2995 dbSNP
rs879231896 3000 dbSNP
rs1037869314 3008 dbSNP
rs899351712 3012 dbSNP
rs1357321385 3016 dbSNP
rs1052029825 3017 dbSNP
rs1409038453 3024 dbSNP
rs886682320 3025 dbSNP
rs1330548008 3030 dbSNP
rs1026961234 3033 dbSNP
rs1389490027 3037 dbSNP
rs759194255 3039 dbSNP
rs1005090628 3045 dbSNP
rs764381263 3048 dbSNP
rs185384647 3051 dbSNP
rs1472507594 3053 dbSNP
rs1001253689 3056 dbSNP
rs1233807550 3059 dbSNP
rs1206997410 3077 dbSNP
rs1450090298 3080 dbSNP
rs1289372968 3081 dbSNP
rs113331625 3087 dbSNP
rs1034039705 3104 dbSNP
rs1214418223 3107 dbSNP
rs190676746 3112 dbSNP
rs975156625 3113 dbSNP
rs959737808 3117 dbSNP
rs1227706080 3122 dbSNP
rs566593949 3123 dbSNP
rs746712231 3125 dbSNP
rs1433982161 3132 dbSNP
rs1330174332 3139 dbSNP
rs1326141836 3142 dbSNP
rs988010579 3155 dbSNP
rs547871728 3156 dbSNP
rs913184330 3157 dbSNP
rs967679452 3164 dbSNP
rs1468035764 3168 dbSNP
rs1301978399 3170 dbSNP
rs1401789577 3174 dbSNP
rs978617795 3182 dbSNP
rs1477214805 3183 dbSNP
rs925787278 3186 dbSNP
rs568086257 3188 dbSNP
rs1309280400 3192 dbSNP
rs1194464341 3199 dbSNP
rs982097998 3202 dbSNP
rs926647576 3204 dbSNP
rs765276482 3209 dbSNP
rs1039138942 3210 dbSNP
rs1286203310 3213 dbSNP
rs921976056 3216 dbSNP
rs933369652 3218 dbSNP
rs1217314035 3223 dbSNP
rs750966220 3224 dbSNP
rs1303777881 3225 dbSNP
rs929426977 3227 dbSNP
rs1362512600 3233 dbSNP
rs1208467081 3244 dbSNP
rs1047901692 3255 dbSNP
rs1430774185 3258 dbSNP
rs1255712745 3262 dbSNP
rs192838450 3278 dbSNP
rs1161881607 3285 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuguggUAACA-----GUGUGAGGu 5'
                  |||||     ::|||||| 
Target 5' gagcugagAUUGUGCCACUGCACUCC- 3'
11 - 36
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000265293.4 | 3UTR | AGCUUGCAGUGAGCUGAGAUUGUGCCACUGCACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*