miRTarBase - #MIRT675263 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF431   
Synonyms -
Description zinc finger protein 431
Transcript NM_133473   
Expression
Putative miRNA Targets on ZNF431
3'UTR of ZNF431
(miRNA target sites are highlighted)
>ZNF431|NM_133473|3'UTR
   1 GCAGTCCTCAACTCTTACTAAGCATTAAATATTGGCCGGGTGCGGTGGCTTATGCAAAATGGCTCCCAGCATTTTGGGAG
  81 GCTGAGGTGGGTGGATCACAAGGTCAAGAGATCGAGACCATCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATA
 161 CAAAAATTATCTGGGTGTGGTGGCACGTGCCTGTATTCCCATCTACTCGGGAGGCTTAGGCAGGATAATCACTTGAACCT
 241 GGGAGGTGGAAGTTGCAGTGAGCCAAGATTGTACCACTGCACTCCAGTTTGGCAACAGAGTGAGACTCCGTCTCAAAAAA
 321 AATTTATACTGTACAAAAACCCCACAAGTGTGAAAAACATGGCAAAGCCTTTAAGAAGCCCTCAATTCTTAACAGACATA
 401 AGATAATTTATACTGGAGAGAAACTCTACAAATCAGAAAGATGTGACTACTTTTGACAACGCCTCAAACTTTTCTAACCA
 481 TAAAAGTAATTATACTGGTGAGAAATCCTAGAAATCTGAAGAGTGAGATAAAGCCTTTAAATGGTTGTCACACTTCATTG
 561 TAGGTAAGATAATTCATACTGGAGAAAACGCCTACATGTGTGAACAATATGGCAAAACTTAATGCTCACACTTTATTGCT
 641 AGGAAAGCATTTATACTTGAGATAAATTATACAAATATAAAGACTGTGAAAAAGCCATCATTATCTGCTCACATTTTACT
 721 CAACACAGAGAGTTCCTGCTTAATAAAAGCATTATAAGTGCAATTACTGTCAAAAGATCTTTCAGAAAATATAAGCTTTT
 801 TTAGTGAAGAGTATTTATTTTGAAGTTGAACATCACAAATATAAAAAGGGTTGTAGTGCCTTTACTTGTATCACAGATCT
 881 TTTTGTAGACATTTTCTTCTAGAGGAAAACTCTGAAGCAGTTGATCAAACTTTGTTCAACATCAGGGAATTTATATTGAA
 961 AAATTGTGCAAATATAATAAATTTGGAAAAACAATTTTTCAAAAACTACAGCTTAGAAATCAACAGTTATACTAGAATAT
1041 ATTTTTTCCAGATGCAGTAAAAGTAAAATATTTAATCCATAATTAAGTCTATGCAAATATCAGAGAATTTATGGTAGAAA
1121 TATATAAGGTACTGACACTTCAGATATACTAAATCAGAGTGCTAAGTATAGAAAATCTGAAACTAAAGTTGGTAGAAAAG
1201 TTATTTGTATAGAACTTTAAGAGGATCAGAAGGTTTTTTGCAGAGTTATAATTACATTCAAAGTATACTTTATTTCTTGA
1281 AAAATATTACAGATTTTTTGAAAATTGAATAATGTCATCATTCAACTCTGAAATTATTTCCTGTTGTTTCTTCATTCCTA
1361 TTGGATTCACATGTGAAAGCATGGGGTTAATTGTTGCTACATCAAAGAGAGAGATTCTTTTGTTTGTTTGTTCGTTTGTT
1441 TTTTGAGACTGAGTTTCACTCTTTCGCCCAGGCTGGAGTGCATTGGCATGATCTCAGCTCACTACAACCTCTGCCTTCTG
1521 GTTTCAAGCAACTCTTCTGCCTCAGCATCCCAAGTAGCTGGGATAACAGGTGCCAGCCACCATGCCCAGCTAATTTGTGT
1601 ATTTCTAGTAGAGATGGGGTTTCACCATATTGGCCAAGCTGGTCTTGAACTCCTGACCTCATGTGATCCGCCCGCCTCAG
1681 CCTCCCAAAGTGCTGGGATTACAGGCTTGAGCCACCACGCCCAGCCTGTAGCATATTTTAATAGGAGAATACAATATATA
1761 ATAGTAGCAGGGTTAAGTAAGGCATCCATCATCTGTAGCATTTCTCCTTTGTTTTACAAACAATCCAATTCTACACTTTA
1841 AAAAAAAATTTTTAAATGTACAATTAAATTTTTATTTACCACAGTGTTATTTTTATCGTCATAATAAAAATTATATACGA
1921 GTATAAATGAAATTCATTTCTAAATTCTTAATAAATATTTTCTCATGCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             | |: :||||||||||:| 
Target 5' tttAAATGGTTGTCACACTTCa 3'
536 - 557 155.00 -20.90
2
miRNA  3' guuuGUGGUAACA-----GUGUGAGGu 5'
              ||  |||||     ::|||||| 
Target 5' gagcCAAGATTGTACCACTGCACTCCa 3'
260 - 286 138.00 -16.00
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||| : ||  |||||||:: 
Target 5' aaAACTTAATGCTCACACTTTa 3'
614 - 635 132.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30554828 2 COSMIC
COSN22633796 10 COSMIC
COSN27006105 14 COSMIC
COSN27006109 35 COSMIC
COSN31540816 39 COSMIC
COSN1762715 44 COSMIC
COSN28568591 108 COSMIC
COSN29827976 311 COSMIC
COSN30533458 499 COSMIC
COSN5850190 644 COSMIC
COSN25058165 655 COSMIC
COSN20115624 727 COSMIC
COSN29471018 1000 COSMIC
COSN1762716 1413 COSMIC
COSN16072523 1851 COSMIC
COSN15722418 1993 COSMIC
COSN6139791 2173 COSMIC
COSN20688322 2245 COSMIC
COSN6139792 2276 COSMIC
COSN23816159 2308 COSMIC
COSN27420160 2672 COSMIC
COSN5435689 2711 COSMIC
COSN23745265 2720 COSMIC
COSN16346161 2805 COSMIC
COSN6667589 3290 COSMIC
COSN17899993 3423 COSMIC
COSN18775760 3423 COSMIC
COSN7118124 3630 COSMIC
COSN30233997 4113 COSMIC
COSN1762717 4117 COSMIC
COSN23889502 4250 COSMIC
COSN30300084 4452 COSMIC
COSN8257278 4905 COSMIC
COSN28354400 5206 COSMIC
COSN24769907 5507 COSMIC
COSN6139793 5608 COSMIC
COSN5435691 5671 COSMIC
COSN5435692 5718 COSMIC
COSN7118125 5884 COSMIC
COSN1212728 5977 COSMIC
COSN27779818 6016 COSMIC
COSN26338576 6140 COSMIC
COSN6139794 6473 COSMIC
COSN23335814 6524 COSMIC
COSN16147687 6641 COSMIC
COSN9350848 6834 COSMIC
COSN21514440 6907 COSMIC
COSN25765941 7128 COSMIC
COSN9847171 7153 COSMIC
COSN23641799 7315 COSMIC
COSN29766127 7436 COSMIC
COSN15780830 7633 COSMIC
COSN29888823 7744 COSMIC
COSN7118126 7809 COSMIC
COSN21505635 7933 COSMIC
COSN16380490 8077 COSMIC
COSN30407806 8359 COSMIC
COSN1762718 9030 COSMIC
COSN28047306 9048 COSMIC
COSN26218704 9480 COSMIC
COSN15693021 10115 COSMIC
COSN4777441 10195 COSMIC
COSN16441502 10213 COSMIC
COSN27276970 10455 COSMIC
COSN23426873 10456 COSMIC
COSN6417226 10488 COSMIC
COSN1212729 10492 COSMIC
COSN21827997 10498 COSMIC
COSN25537665 10750 COSMIC
COSN29550562 10789 COSMIC
COSN4777442 11124 COSMIC
COSN1762719 11279 COSMIC
COSN24874523 11309 COSMIC
COSN29204909 11319 COSMIC
COSN22376530 11443 COSMIC
COSN30024140 11738 COSMIC
COSN16227102 11829 COSMIC
COSN1762720 11981 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772694239 5 dbSNP
rs772595166 8 dbSNP
rs754461369 9 dbSNP
rs1282363492 12 dbSNP
rs920466079 13 dbSNP
rs755378371 17 dbSNP
rs1169337964 21 dbSNP
rs760273973 22 dbSNP
rs1463183119 27 dbSNP
rs765992934 30 dbSNP
rs959423079 33 dbSNP
rs776286138 38 dbSNP
rs770710432 39 dbSNP
rs765020967 41 dbSNP
rs1166928986 42 dbSNP
rs142847540 44 dbSNP
rs113594182 45 dbSNP
rs1217995464 46 dbSNP
rs1186880510 53 dbSNP
rs1422603814 60 dbSNP
rs941364522 63 dbSNP
rs539696677 72 dbSNP
rs1260201519 88 dbSNP
rs973185100 90 dbSNP
rs1482931213 101 dbSNP
rs1273551999 103 dbSNP
rs919162980 104 dbSNP
rs1340965430 109 dbSNP
rs929237936 111 dbSNP
rs536880512 114 dbSNP
rs566945295 115 dbSNP
rs943087736 118 dbSNP
rs1415243357 126 dbSNP
rs1038773170 130 dbSNP
rs1349659488 133 dbSNP
rs901386755 134 dbSNP
rs775480323 143 dbSNP
rs1268864816 148 dbSNP
rs182117642 162 dbSNP
rs1192074691 167 dbSNP
rs1041905889 169 dbSNP
rs904727683 171 dbSNP
rs1166280075 174 dbSNP
rs999934565 175 dbSNP
rs151066009 180 dbSNP
rs1021071031 187 dbSNP
rs1365300413 188 dbSNP
rs894245315 191 dbSNP
rs1208770099 206 dbSNP
rs1332032222 209 dbSNP
rs575271622 210 dbSNP
rs1003818385 218 dbSNP
rs186767782 221 dbSNP
rs1444070847 222 dbSNP
rs971987153 231 dbSNP
rs189765532 234 dbSNP
rs1438886301 246 dbSNP
rs541552375 250 dbSNP
rs1326592473 256 dbSNP
rs991020718 257 dbSNP
rs951903733 267 dbSNP
rs1160691382 268 dbSNP
rs577871671 270 dbSNP
rs1017017701 279 dbSNP
rs1298100463 288 dbSNP
rs760589919 290 dbSNP
rs1364088398 297 dbSNP
rs1320834889 300 dbSNP
rs1219342481 303 dbSNP
rs911267119 310 dbSNP
rs540115202 311 dbSNP
rs556478179 312 dbSNP
rs761967855 313 dbSNP
rs1273958274 315 dbSNP
rs765467679 317 dbSNP
rs946273436 323 dbSNP
rs1373404889 325 dbSNP
rs1042021908 328 dbSNP
rs929185375 329 dbSNP
rs987356223 330 dbSNP
rs1385059875 335 dbSNP
rs1320828753 336 dbSNP
rs1401732408 342 dbSNP
rs1401964812 345 dbSNP
rs1422406493 348 dbSNP
rs1452222022 359 dbSNP
rs1396479262 360 dbSNP
rs936132587 361 dbSNP
rs182429972 363 dbSNP
rs34629919 370 dbSNP
rs1217868241 384 dbSNP
rs1453609841 386 dbSNP
rs529077215 393 dbSNP
rs1277680808 397 dbSNP
rs1208409168 398 dbSNP
rs866397979 399 dbSNP
rs1350370683 415 dbSNP
rs1304409499 418 dbSNP
rs894183796 421 dbSNP
rs187987244 422 dbSNP
rs1271948720 424 dbSNP
rs943202174 428 dbSNP
rs1436113623 430 dbSNP
rs1340353604 433 dbSNP
rs1311487453 435 dbSNP
rs897516392 435 dbSNP
rs993355848 441 dbSNP
rs1226393933 442 dbSNP
rs1408939405 443 dbSNP
rs1416788464 450 dbSNP
rs562585408 453 dbSNP
rs1314836945 458 dbSNP
rs539350761 461 dbSNP
rs893541408 462 dbSNP
rs193028963 464 dbSNP
rs1042034363 470 dbSNP
rs1204114174 474 dbSNP
rs1265723537 479 dbSNP
rs1275247331 481 dbSNP
rs569461276 482 dbSNP
rs183597919 484 dbSNP
rs976898031 489 dbSNP
rs1236532465 493 dbSNP
rs758473196 494 dbSNP
rs1441053073 499 dbSNP
rs1183982076 509 dbSNP
rs533718588 513 dbSNP
rs780044650 514 dbSNP
rs967396991 527 dbSNP
rs1417148879 528 dbSNP
rs1472566934 529 dbSNP
rs1476106675 530 dbSNP
rs559247728 536 dbSNP
rs977439081 541 dbSNP
rs1479805853 550 dbSNP
rs572092731 553 dbSNP
rs188970022 554 dbSNP
rs1176062272 557 dbSNP
rs962802151 561 dbSNP
rs1357629637 563 dbSNP
rs1450396384 569 dbSNP
rs973231099 570 dbSNP
rs1304406261 578 dbSNP
rs1379563844 580 dbSNP
rs1409188880 588 dbSNP
rs192625512 590 dbSNP
rs1330686319 591 dbSNP
rs1288149234 597 dbSNP
rs1222391783 601 dbSNP
rs1370787749 603 dbSNP
rs955366050 606 dbSNP
rs916112672 618 dbSNP
rs949823721 619 dbSNP
rs986801211 621 dbSNP
rs911789632 629 dbSNP
rs964624930 630 dbSNP
rs530158306 640 dbSNP
rs1256971936 648 dbSNP
rs1482918894 657 dbSNP
rs781633295 660 dbSNP
rs1180694931 663 dbSNP
rs1045507117 671 dbSNP
rs897596603 675 dbSNP
rs1254584675 676 dbSNP
rs1178001041 679 dbSNP
rs974576316 684 dbSNP
rs770641648 685 dbSNP
rs770108463 700 dbSNP
rs993094800 701 dbSNP
rs1215591826 703 dbSNP
rs1469336095 719 dbSNP
rs1190697336 720 dbSNP
rs11411736 726 dbSNP
rs397797325 726 dbSNP
rs1416404456 727 dbSNP
rs74204348 728 dbSNP
rs915080586 729 dbSNP
rs1375882294 732 dbSNP
rs555508173 734 dbSNP
rs1300681876 736 dbSNP
rs1442441751 737 dbSNP
rs1428865638 741 dbSNP
rs569033090 755 dbSNP
rs946449456 759 dbSNP
rs887655954 761 dbSNP
rs1410292155 762 dbSNP
rs748533075 768 dbSNP
rs1364814570 791 dbSNP
rs1159501812 792 dbSNP
rs923721465 793 dbSNP
rs537907979 803 dbSNP
rs141186657 814 dbSNP
rs1393466536 819 dbSNP
rs1056165712 832 dbSNP
rs1195627991 833 dbSNP
rs577950065 835 dbSNP
rs895387790 838 dbSNP
rs534122552 842 dbSNP
rs1203436130 850 dbSNP
rs998659765 851 dbSNP
rs1483670754 856 dbSNP
rs1221412367 860 dbSNP
rs1261716862 860 dbSNP
rs1245108636 863 dbSNP
rs553767062 866 dbSNP
rs778680808 892 dbSNP
rs1192064021 905 dbSNP
rs967470556 906 dbSNP
rs898666668 908 dbSNP
rs1389770826 910 dbSNP
rs1447829454 919 dbSNP
rs1380481727 921 dbSNP
rs1363941956 930 dbSNP
rs1166491905 931 dbSNP
rs1433840459 934 dbSNP
rs1373933667 945 dbSNP
rs1175750169 948 dbSNP
rs994380076 950 dbSNP
rs1372138151 957 dbSNP
rs1191049514 971 dbSNP
rs1430855158 974 dbSNP
rs1187754601 976 dbSNP
rs1263021912 976 dbSNP
rs573946890 978 dbSNP
rs1322783471 987 dbSNP
rs1282834336 991 dbSNP
rs1347648930 995 dbSNP
rs955477383 1003 dbSNP
rs145011836 1004 dbSNP
rs1345225928 1005 dbSNP
rs1250299153 1006 dbSNP
rs1275131484 1006 dbSNP
rs562624036 1011 dbSNP
rs1309235457 1012 dbSNP
rs957608897 1017 dbSNP
rs1414007527 1023 dbSNP
rs964577435 1024 dbSNP
rs576211359 1032 dbSNP
rs916044264 1042 dbSNP
rs975071437 1043 dbSNP
rs950220092 1048 dbSNP
rs915047450 1050 dbSNP
rs968280243 1052 dbSNP
rs918972309 1053 dbSNP
rs1228294553 1057 dbSNP
rs1474481068 1058 dbSNP
rs929059283 1064 dbSNP
rs977991402 1071 dbSNP
rs1048709766 1076 dbSNP
rs1442682233 1080 dbSNP
rs923667811 1084 dbSNP
rs1453460364 1088 dbSNP
rs1193632164 1094 dbSNP
rs1222423300 1095 dbSNP
rs1481325029 1098 dbSNP
rs767006742 1102 dbSNP
rs1232612921 1110 dbSNP
rs943268551 1115 dbSNP
rs1294934149 1125 dbSNP
rs939112250 1133 dbSNP
rs1245221975 1143 dbSNP
rs574427068 1148 dbSNP
rs1327102884 1150 dbSNP
rs901777433 1151 dbSNP
rs1190697088 1155 dbSNP
rs577052056 1161 dbSNP
rs1325249641 1162 dbSNP
rs1460368890 1165 dbSNP
rs1420609983 1168 dbSNP
rs916252288 1169 dbSNP
rs997332489 1177 dbSNP
rs1475599098 1186 dbSNP
rs544765879 1199 dbSNP
rs1020810272 1204 dbSNP
rs903231160 1205 dbSNP
rs543803211 1210 dbSNP
rs527272742 1216 dbSNP
rs1238272523 1219 dbSNP
rs1212476233 1228 dbSNP
rs1411514457 1229 dbSNP
rs1467122552 1232 dbSNP
rs1274964419 1233 dbSNP
rs1210283103 1234 dbSNP
rs1406960158 1241 dbSNP
rs1349697125 1242 dbSNP
rs547308264 1245 dbSNP
rs184978806 1254 dbSNP
rs898786530 1257 dbSNP
rs1377878689 1259 dbSNP
rs112917399 1262 dbSNP
rs1397392067 1264 dbSNP
rs1047247100 1268 dbSNP
rs762313299 1269 dbSNP
rs991915131 1274 dbSNP
rs549169155 1281 dbSNP
rs1160603694 1285 dbSNP
rs1327457561 1286 dbSNP
rs1244503779 1290 dbSNP
rs377406485 1291 dbSNP
rs972063436 1292 dbSNP
rs1192529284 1294 dbSNP
rs1452030645 1318 dbSNP
rs1282730802 1326 dbSNP
rs1254267351 1327 dbSNP
rs1359085371 1329 dbSNP
rs1008283454 1340 dbSNP
rs576208494 1342 dbSNP
rs981594212 1342 dbSNP
rs879442025 1357 dbSNP
rs1354748478 1361 dbSNP
rs1279862758 1363 dbSNP
rs1232267067 1373 dbSNP
rs1373292549 1374 dbSNP
rs1275448779 1376 dbSNP
rs1430665877 1382 dbSNP
rs1018193771 1383 dbSNP
rs146511962 1384 dbSNP
rs1420681206 1386 dbSNP
rs1210863225 1400 dbSNP
rs1248873332 1401 dbSNP
rs1172634439 1402 dbSNP
rs1447419561 1404 dbSNP
rs774932691 1408 dbSNP
rs1011613262 1412 dbSNP
rs929049435 1414 dbSNP
rs1426692855 1415 dbSNP
rs1235454539 1418 dbSNP
rs370710894 1419 dbSNP
rs571663116 1419 dbSNP
rs984533955 1433 dbSNP
rs879532438 1434 dbSNP
rs1022631822 1435 dbSNP
rs1039124933 1439 dbSNP
rs901727945 1440 dbSNP
rs1350260064 1451 dbSNP
rs933238185 1454 dbSNP
rs1214027905 1462 dbSNP
rs746898703 1462 dbSNP
rs551561138 1465 dbSNP
rs768596979 1466 dbSNP
rs1401074446 1467 dbSNP
rs1355244981 1468 dbSNP
rs776362174 1469 dbSNP
rs1412574586 1472 dbSNP
rs543646887 1477 dbSNP
rs1033068937 1481 dbSNP
rs1408848553 1482 dbSNP
rs1417374055 1484 dbSNP
rs960404617 1489 dbSNP
rs1172737388 1493 dbSNP
rs1395026020 1505 dbSNP
rs1332648926 1508 dbSNP
rs1185475593 1516 dbSNP
rs1012884761 1517 dbSNP
rs1238244741 1535 dbSNP
rs571648406 1542 dbSNP
rs991915898 1557 dbSNP
rs1342590618 1559 dbSNP
rs1415987595 1564 dbSNP
rs188178112 1567 dbSNP
rs1219810166 1571 dbSNP
rs1334724511 1574 dbSNP
rs529026236 1575 dbSNP
rs113635752 1576 dbSNP
rs1026428013 1578 dbSNP
rs1303060016 1583 dbSNP
rs1440934449 1586 dbSNP
rs1352273442 1588 dbSNP
rs773401421 1595 dbSNP
rs1466102332 1596 dbSNP
rs930254431 1599 dbSNP
rs1198906147 1607 dbSNP
rs532131974 1608 dbSNP
rs536507112 1618 dbSNP
rs556436438 1619 dbSNP
rs944094383 1626 dbSNP
rs1199316709 1627 dbSNP
rs1468465381 1628 dbSNP
rs1039757266 1630 dbSNP
rs899955521 1636 dbSNP
rs1250968671 1639 dbSNP
rs1306664954 1645 dbSNP
rs1222874596 1646 dbSNP
rs1370668677 1647 dbSNP
rs1310862002 1654 dbSNP
rs1011975063 1656 dbSNP
rs576152759 1659 dbSNP
rs933246922 1664 dbSNP
rs1323815036 1666 dbSNP
rs1021658262 1667 dbSNP
rs1350279619 1670 dbSNP
rs1158059558 1671 dbSNP
rs545119262 1674 dbSNP
rs903740115 1675 dbSNP
rs1179404149 1677 dbSNP
rs999462288 1686 dbSNP
rs879382387 1693 dbSNP
rs1030805603 1694 dbSNP
rs1170417635 1703 dbSNP
rs564815356 1710 dbSNP
rs1053623271 1712 dbSNP
rs1435727913 1713 dbSNP
rs1308027428 1714 dbSNP
rs960520552 1717 dbSNP
rs1013452351 1719 dbSNP
rs1044400148 1720 dbSNP
rs1298500496 1726 dbSNP
rs1388482746 1740 dbSNP
rs992030826 1747 dbSNP
rs1288121017 1753 dbSNP
rs376053438 1761 dbSNP
rs1330545867 1772 dbSNP
rs1362766495 1775 dbSNP
rs1159477506 1778 dbSNP
rs1434278012 1787 dbSNP
rs1393371801 1794 dbSNP
rs1231400990 1795 dbSNP
rs1023786672 1798 dbSNP
rs763140773 1805 dbSNP
rs1178275846 1809 dbSNP
rs1276824634 1816 dbSNP
rs1261609476 1821 dbSNP
rs1349858441 1824 dbSNP
rs969192940 1827 dbSNP
rs1489471990 1829 dbSNP
rs113483906 1839 dbSNP
rs1216917486 1840 dbSNP
rs144882093 1840 dbSNP
rs974116657 1845 dbSNP
rs1253783452 1848 dbSNP
rs191449396 1849 dbSNP
rs755195805 1849 dbSNP
rs930178923 1850 dbSNP
rs540695455 1855 dbSNP
rs912851172 1857 dbSNP
rs1432064983 1858 dbSNP
rs1196392684 1859 dbSNP
rs1414427525 1861 dbSNP
rs866054268 1862 dbSNP
rs922941921 1869 dbSNP
rs944208961 1878 dbSNP
rs1304708068 1883 dbSNP
rs1378995221 1883 dbSNP
rs1466602186 1885 dbSNP
rs1168955716 1886 dbSNP
rs954334763 1886 dbSNP
rs1424829968 1887 dbSNP
rs1479062690 1887 dbSNP
rs1039873669 1889 dbSNP
rs899902896 1896 dbSNP
rs141152990 1897 dbSNP
rs1043427042 1898 dbSNP
rs529552720 1899 dbSNP
rs998890093 1900 dbSNP
rs1030919600 1901 dbSNP
rs936581784 1902 dbSNP
rs1250211388 1904 dbSNP
rs1053611515 1909 dbSNP
rs1319860101 1912 dbSNP
rs1278651662 1916 dbSNP
rs896426368 1919 dbSNP
rs1013409998 1920 dbSNP
rs1315100968 1925 dbSNP
rs1396750955 1926 dbSNP
rs1395893691 1934 dbSNP
rs1023479602 1935 dbSNP
rs866532682 1937 dbSNP
rs1401637607 1938 dbSNP
rs1164735675 1948 dbSNP
rs1325541098 1952 dbSNP
rs758829850 1958 dbSNP
rs969518063 1964 dbSNP
rs995267958 1969 dbSNP
rs1002804720 1977 dbSNP
rs1296622105 1977 dbSNP
rs1339773367 1978 dbSNP
rs1423978239 1979 dbSNP
rs1249243450 1982 dbSNP
rs549257193 1986 dbSNP
rs1047722355 1987 dbSNP
rs951046343 1995 dbSNP
rs1487908775 1996 dbSNP
rs1212907439 2005 dbSNP
rs1207568929 2012 dbSNP
rs1006461026 2014 dbSNP
rs1254264835 2018 dbSNP
rs982453328 2019 dbSNP
rs912799112 2027 dbSNP
rs1388760520 2033 dbSNP
rs1325833290 2038 dbSNP
rs1404040270 2039 dbSNP
rs562790262 2047 dbSNP
rs569940975 2048 dbSNP
rs531795693 2050 dbSNP
rs1458128479 2064 dbSNP
rs1379277477 2066 dbSNP
rs975959779 2070 dbSNP
rs1440994376 2073 dbSNP
rs1238180914 2075 dbSNP
rs1449758386 2079 dbSNP
rs551916113 2079 dbSNP
rs947420992 2083 dbSNP
rs1043137119 2085 dbSNP
rs1284148413 2094 dbSNP
rs1242505567 2102 dbSNP
rs1354522952 2107 dbSNP
rs184010392 2110 dbSNP
rs1434984127 2111 dbSNP
rs1333300233 2119 dbSNP
rs934630484 2123 dbSNP
rs1324672625 2124 dbSNP
rs1395242618 2129 dbSNP
rs1381992682 2142 dbSNP
rs112544060 2143 dbSNP
rs1156461879 2146 dbSNP
rs1030707625 2148 dbSNP
rs896372402 2153 dbSNP
rs1013524639 2154 dbSNP
rs138614111 2164 dbSNP
rs567652049 2165 dbSNP
rs1199392621 2170 dbSNP
rs1446222801 2180 dbSNP
rs1383696135 2181 dbSNP
rs1295960228 2185 dbSNP
rs559191184 2192 dbSNP
rs1219103503 2194 dbSNP
rs1488718673 2196 dbSNP
rs1242469422 2198 dbSNP
rs1274531297 2199 dbSNP
rs1279754137 2200 dbSNP
rs1334896517 2203 dbSNP
rs536595268 2207 dbSNP
rs1347814400 2210 dbSNP
rs1245803477 2211 dbSNP
rs1486610011 2213 dbSNP
rs556473314 2215 dbSNP
rs1255855835 2219 dbSNP
rs1026734627 2222 dbSNP
rs1167496834 2225 dbSNP
rs189766809 2230 dbSNP
rs753067571 2236 dbSNP
rs181880671 2237 dbSNP
rs1019253042 2240 dbSNP
rs756528285 2245 dbSNP
rs1047711886 2271 dbSNP
rs1426584366 2277 dbSNP
rs1157294982 2279 dbSNP
rs1477428596 2280 dbSNP
rs1421252881 2281 dbSNP
rs186873158 2290 dbSNP
rs942266594 2291 dbSNP
rs1237102191 2297 dbSNP
rs1208186643 2299 dbSNP
rs1454443819 2301 dbSNP
rs778341632 2303 dbSNP
rs552416831 2306 dbSNP
rs1038385893 2311 dbSNP
rs1378113916 2319 dbSNP
rs1280547772 2326 dbSNP
rs900774599 2327 dbSNP
rs965577625 2337 dbSNP
rs570831866 2341 dbSNP
rs996711799 2345 dbSNP
rs1394271692 2348 dbSNP
rs572050590 2352 dbSNP
rs1030508786 2353 dbSNP
rs1355616706 2354 dbSNP
rs1227260160 2356 dbSNP
rs921545813 2360 dbSNP
rs890203327 2361 dbSNP
rs1172625020 2362 dbSNP
rs999316633 2374 dbSNP
rs540684622 2378 dbSNP
rs1473869543 2380 dbSNP
rs1238152199 2387 dbSNP
rs190561477 2388 dbSNP
rs574092280 2392 dbSNP
rs1260546569 2400 dbSNP
rs1199747513 2405 dbSNP
rs1321514452 2408 dbSNP
rs1190777091 2409 dbSNP
rs1288114606 2409 dbSNP
rs1226290003 2411 dbSNP
rs934743111 2412 dbSNP
rs1472519987 2417 dbSNP
rs1180117816 2419 dbSNP
rs1445382715 2431 dbSNP
rs1374656448 2433 dbSNP
rs1410205734 2435 dbSNP
rs1466023510 2436 dbSNP
rs745533408 2437 dbSNP
rs1175602613 2439 dbSNP
rs1407332522 2440 dbSNP
rs1414783786 2443 dbSNP
rs1178183816 2445 dbSNP
rs542948040 2451 dbSNP
rs562856410 2454 dbSNP
rs927834045 2454 dbSNP
rs938763591 2454 dbSNP
rs532003646 2457 dbSNP
rs1245386881 2460 dbSNP
rs545274378 2462 dbSNP
rs1044982409 2463 dbSNP
rs779559198 2465 dbSNP
rs376362931 2472 dbSNP
rs995335265 2473 dbSNP
rs527722718 2478 dbSNP
rs900719506 2491 dbSNP
rs932287538 2496 dbSNP
rs565433852 2504 dbSNP
rs890652289 2511 dbSNP
rs1003937135 2512 dbSNP
rs1158288629 2520 dbSNP
rs1418046835 2526 dbSNP
rs1382285359 2527 dbSNP
rs527820365 2530 dbSNP
rs1159298863 2537 dbSNP
rs547907302 2543 dbSNP
rs1019200769 2569 dbSNP
rs900855695 2573 dbSNP
rs1423664749 2574 dbSNP
rs1310867454 2575 dbSNP
rs996955118 2582 dbSNP
rs999264172 2596 dbSNP
rs1028554670 2610 dbSNP
rs1262843551 2616 dbSNP
rs1215472260 2633 dbSNP
rs1487081018 2637 dbSNP
rs149298075 2646 dbSNP
rs1281417286 2648 dbSNP
rs1483034839 2659 dbSNP
rs768542163 2660 dbSNP
rs1311602071 2663 dbSNP
rs893578012 2664 dbSNP
rs1220820146 2675 dbSNP
rs1010949433 2677 dbSNP
rs1297317412 2679 dbSNP
rs530103570 2680 dbSNP
rs1023307689 2683 dbSNP
rs1031860307 2690 dbSNP
rs1362672038 2692 dbSNP
rs776517713 2711 dbSNP
rs181767888 2714 dbSNP
rs1003500348 2715 dbSNP
rs1178882256 2716 dbSNP
rs1434208208 2730 dbSNP
rs569876429 2738 dbSNP
rs1191914550 2748 dbSNP
rs1476662902 2748 dbSNP
rs948748555 2750 dbSNP
rs1205288373 2763 dbSNP
rs1482651494 2772 dbSNP
rs980535430 2773 dbSNP
rs1034796848 2774 dbSNP
rs951244776 2775 dbSNP
rs1277384745 2781 dbSNP
rs1216558133 2795 dbSNP
rs1342685002 2796 dbSNP
rs1395402095 2799 dbSNP
rs982590528 2800 dbSNP
rs1395607977 2806 dbSNP
rs538882461 2811 dbSNP
rs926549607 2812 dbSNP
rs1304618960 2813 dbSNP
rs931236300 2817 dbSNP
rs1259617054 2822 dbSNP
rs1355837855 2822 dbSNP
rs907928579 2826 dbSNP
rs1424718478 2831 dbSNP
rs963503205 2831 dbSNP
rs1048192136 2836 dbSNP
rs1193483719 2846 dbSNP
rs973805753 2850 dbSNP
rs886946144 2856 dbSNP
rs939740391 2860 dbSNP
rs1040768697 2861 dbSNP
rs1257342928 2863 dbSNP
rs1196603493 2890 dbSNP
rs1235994424 2891 dbSNP
rs1304660043 2896 dbSNP
rs1251620550 2913 dbSNP
rs1244369754 2934 dbSNP
rs1338892614 2938 dbSNP
rs1314999255 2942 dbSNP
rs1453453844 2943 dbSNP
rs1341872673 2944 dbSNP
rs900952399 2945 dbSNP
rs1376168344 2949 dbSNP
rs1329927124 2957 dbSNP
rs752529576 2958 dbSNP
rs1226896383 2962 dbSNP
rs1275717061 2964 dbSNP
rs1052047024 2968 dbSNP
rs780460852 2982 dbSNP
rs1220932485 2983 dbSNP
rs1366343151 2985 dbSNP
rs558483468 2986 dbSNP
rs1444716774 2991 dbSNP
rs769563194 2996 dbSNP
rs565858050 3007 dbSNP
rs1245014047 3008 dbSNP
rs1470009518 3018 dbSNP
rs1251021765 3021 dbSNP
rs772946387 3028 dbSNP
rs760597241 3037 dbSNP
rs763165674 3040 dbSNP
rs1246914188 3041 dbSNP
rs186347651 3042 dbSNP
rs935462101 3049 dbSNP
rs904747703 3050 dbSNP
rs1253434402 3052 dbSNP
rs893511676 3058 dbSNP
rs1336851135 3059 dbSNP
rs1323382567 3061 dbSNP
rs1448636536 3065 dbSNP
rs1393247337 3066 dbSNP
rs1000855702 3067 dbSNP
rs1424843115 3077 dbSNP
rs554222955 3081 dbSNP
rs1031808490 3084 dbSNP
rs1410401498 3094 dbSNP
rs1045121543 3096 dbSNP
rs189529185 3100 dbSNP
rs1003855613 3106 dbSNP
rs1269141160 3107 dbSNP
rs182229061 3109 dbSNP
rs556868849 3113 dbSNP
rs1284036666 3117 dbSNP
rs1003971349 3119 dbSNP
rs1352126451 3135 dbSNP
rs970578073 3145 dbSNP
rs1274785676 3166 dbSNP
rs1231632324 3168 dbSNP
rs576673456 3174 dbSNP
rs1284280104 3181 dbSNP
rs1405220274 3183 dbSNP
rs1272233651 3184 dbSNP
rs545671444 3190 dbSNP
rs186491388 3199 dbSNP
rs973538116 3202 dbSNP
rs921915616 3205 dbSNP
rs774437947 3206 dbSNP
rs931207473 3210 dbSNP
rs1287875315 3211 dbSNP
rs984011984 3219 dbSNP
rs987488104 3224 dbSNP
rs908501277 3239 dbSNP
rs912108225 3240 dbSNP
rs1447673424 3242 dbSNP
rs935576679 3244 dbSNP
rs527863153 3250 dbSNP
rs1284378674 3252 dbSNP
rs372346727 3255 dbSNP
rs1218395401 3258 dbSNP
rs1339514853 3258 dbSNP
rs1275918705 3263 dbSNP
rs1432383936 3266 dbSNP
rs1326536394 3268 dbSNP
rs915450183 3272 dbSNP
rs946438694 3278 dbSNP
rs1214622440 3280 dbSNP
rs1044848490 3287 dbSNP
rs904951819 3289 dbSNP
rs1247624926 3293 dbSNP
rs939838634 3295 dbSNP
rs759563622 3297 dbSNP
rs1056067451 3308 dbSNP
rs900892300 3314 dbSNP
rs1185477046 3321 dbSNP
rs1463093794 3325 dbSNP
rs541571300 3327 dbSNP
rs1415077274 3328 dbSNP
rs1462558669 3337 dbSNP
rs1049363382 3338 dbSNP
rs1216003182 3341 dbSNP
rs904192416 3342 dbSNP
rs999895549 3349 dbSNP
rs1412368862 3352 dbSNP
rs997098560 3356 dbSNP
rs1337331935 3361 dbSNP
rs148011588 3362 dbSNP
rs1397881423 3364 dbSNP
rs953591156 3369 dbSNP
rs892077846 3371 dbSNP
rs1413325536 3372 dbSNP
rs143388900 3380 dbSNP
rs1446524499 3381 dbSNP
rs1024494022 3386 dbSNP
rs970146679 3388 dbSNP
rs550204078 3389 dbSNP
rs1235013054 3396 dbSNP
rs1291970771 3396 dbSNP
rs1357512158 3397 dbSNP
rs1288712167 3398 dbSNP
rs1307784915 3398 dbSNP
rs956939812 3398 dbSNP
rs1158103273 3400 dbSNP
rs1226206386 3400 dbSNP
rs1315085240 3400 dbSNP
rs1321844770 3400 dbSNP
rs1349020461 3400 dbSNP
rs1385983239 3400 dbSNP
rs1426731722 3400 dbSNP
rs1442656069 3400 dbSNP
rs1027622844 3401 dbSNP
rs915380278 3402 dbSNP
rs952134195 3411 dbSNP
rs1286148327 3413 dbSNP
rs981363727 3415 dbSNP
rs1209417420 3416 dbSNP
rs1255304744 3417 dbSNP
rs80272387 3417 dbSNP
rs1476114045 3418 dbSNP
rs1315123913 3419 dbSNP
rs748236325 3419 dbSNP
rs983439229 3419 dbSNP
rs151120543 3420 dbSNP
rs61515676 3420 dbSNP
rs1491543136 3421 dbSNP
rs1366413448 3422 dbSNP
rs367722753 3422 dbSNP
rs377612633 3422 dbSNP
rs7255882 3423 dbSNP
rs926360300 3424 dbSNP
rs939140575 3425 dbSNP
rs1056055742 3426 dbSNP
rs1311375339 3427 dbSNP
rs886800467 3431 dbSNP
rs1377802227 3432 dbSNP
rs1415897750 3433 dbSNP
rs1287836921 3434 dbSNP
rs1216448186 3435 dbSNP
rs908453510 3438 dbSNP
rs6511207 3444 dbSNP
rs1038263195 3452 dbSNP
rs1380700092 3453 dbSNP
rs1351207252 3466 dbSNP
rs898425136 3468 dbSNP
rs976531118 3474 dbSNP
rs536341258 3475 dbSNP
rs1466018839 3480 dbSNP
rs532344898 3481 dbSNP
rs1357911113 3482 dbSNP
rs996654384 3485 dbSNP
rs1028582587 3493 dbSNP
rs932382560 3495 dbSNP
rs753245244 3496 dbSNP
rs552444908 3497 dbSNP
rs756755449 3498 dbSNP
rs935636906 3506 dbSNP
rs956719169 3507 dbSNP
rs1241206095 3516 dbSNP
rs988151825 3531 dbSNP
rs1324032743 3533 dbSNP
rs1257151226 3536 dbSNP
rs1052801132 3540 dbSNP
rs1309455995 3542 dbSNP
rs550259110 3543 dbSNP
rs1014535508 3547 dbSNP
rs1395518317 3548 dbSNP
rs1380585936 3551 dbSNP
rs1339282697 3556 dbSNP
rs1453942737 3557 dbSNP
rs565765490 3562 dbSNP
rs1460203740 3563 dbSNP
rs534523673 3568 dbSNP
rs1170628157 3570 dbSNP
rs570266488 3573 dbSNP
rs547952715 3574 dbSNP
rs1461690833 3578 dbSNP
rs980958539 3582 dbSNP
rs1435943168 3585 dbSNP
rs1481778080 3588 dbSNP
rs1252112357 3595 dbSNP
rs1307930196 3596 dbSNP
rs926826593 3597 dbSNP
rs939088046 3598 dbSNP
rs1001745364 3604 dbSNP
rs1247398031 3606 dbSNP
rs1028152479 3609 dbSNP
rs908313814 3619 dbSNP
rs567817718 3620 dbSNP
rs1298413216 3621 dbSNP
rs754168492 3629 dbSNP
rs763199606 3630 dbSNP
rs536706501 3647 dbSNP
rs556720586 3653 dbSNP
rs1049577624 3654 dbSNP
rs1337297914 3657 dbSNP
rs976642724 3661 dbSNP
rs890988005 3669 dbSNP
rs1420671944 3670 dbSNP
rs1250915188 3677 dbSNP
rs1209503828 3681 dbSNP
rs1197036786 3683 dbSNP
rs1294106187 3684 dbSNP
rs374288136 3686 dbSNP
rs922576837 3700 dbSNP
rs1040451568 3701 dbSNP
rs1191337590 3702 dbSNP
rs1278307408 3705 dbSNP
rs892570117 3705 dbSNP
rs1454981498 3710 dbSNP
rs954008577 3711 dbSNP
rs1168577639 3712 dbSNP
rs191367773 3714 dbSNP
rs1363312280 3720 dbSNP
rs1304504844 3732 dbSNP
rs1022754413 3734 dbSNP
rs1463922293 3734 dbSNP
rs1168602058 3735 dbSNP
rs1390078284 3737 dbSNP
rs985333324 3744 dbSNP
rs968329444 3745 dbSNP
rs925681699 3748 dbSNP
rs935751463 3750 dbSNP
rs1372987011 3752 dbSNP
rs1364207618 3753 dbSNP
rs1052749704 3755 dbSNP
rs57805586 3756 dbSNP
rs1294494866 3761 dbSNP
rs758020922 3767 dbSNP
rs1479612571 3771 dbSNP
rs1271324940 3774 dbSNP
rs559186557 3776 dbSNP
rs751605613 3777 dbSNP
rs779606621 3783 dbSNP
rs1282193490 3784 dbSNP
rs16997503 3794 dbSNP
rs937491837 3804 dbSNP
rs1049241642 3807 dbSNP
rs960832408 3810 dbSNP
rs1347705706 3811 dbSNP
rs1333490588 3822 dbSNP
rs1211515582 3826 dbSNP
rs887839253 3828 dbSNP
rs992305363 3833 dbSNP
rs1325382191 3835 dbSNP
rs1315575976 3847 dbSNP
rs908261642 3849 dbSNP
rs781740976 3862 dbSNP
rs1385562729 3869 dbSNP
rs1004926075 3880 dbSNP
rs1468598214 3883 dbSNP
rs559308376 3893 dbSNP
rs1431091810 3902 dbSNP
rs1186299502 3903 dbSNP
rs1014842196 3908 dbSNP
rs1240478748 3916 dbSNP
rs961120461 3916 dbSNP
rs541668382 3917 dbSNP
rs1430833747 3919 dbSNP
rs901841766 3923 dbSNP
rs371657777 3933 dbSNP
rs1194476236 3947 dbSNP
rs997564803 3948 dbSNP
rs919624416 3949 dbSNP
rs1326135220 3950 dbSNP
rs932565558 3951 dbSNP
rs1029974740 3952 dbSNP
rs1223792614 3953 dbSNP
rs574997807 3961 dbSNP
rs143364355 3963 dbSNP
rs111579492 3964 dbSNP
rs1450306797 3971 dbSNP
rs957072952 3982 dbSNP
rs7259368 3990 dbSNP
rs1409665676 3995 dbSNP
rs552224328 3999 dbSNP
rs1169808551 4000 dbSNP
rs1475792438 4015 dbSNP
rs559620553 4020 dbSNP
rs1296208267 4021 dbSNP
rs1182326380 4024 dbSNP
rs1463024505 4028 dbSNP
rs528322272 4038 dbSNP
rs913021181 4042 dbSNP
rs949698783 4044 dbSNP
rs547990991 4046 dbSNP
rs1288154853 4051 dbSNP
rs1204253250 4056 dbSNP
rs1033870904 4063 dbSNP
rs960948555 4064 dbSNP
rs12609797 4068 dbSNP
rs927507172 4069 dbSNP
rs1313693889 4074 dbSNP
rs1243744726 4077 dbSNP
rs1384887674 4083 dbSNP
rs937625635 4085 dbSNP
rs1015750168 4086 dbSNP
rs1049654976 4088 dbSNP
rs887953914 4093 dbSNP
rs974253466 4094 dbSNP
rs1447040420 4097 dbSNP
rs919587997 4098 dbSNP
rs371665454 4102 dbSNP
rs1468944881 4104 dbSNP
rs1036400934 4106 dbSNP
rs1206228670 4108 dbSNP
rs953812534 4115 dbSNP
rs188244145 4117 dbSNP
rs1257447968 4118 dbSNP
rs1360883848 4123 dbSNP
rs1315666502 4125 dbSNP
rs1474472786 4135 dbSNP
rs1190186410 4139 dbSNP
rs1223100405 4140 dbSNP
rs192250358 4141 dbSNP
rs1472413540 4152 dbSNP
rs997910717 4153 dbSNP
rs912443711 4154 dbSNP
rs1029009290 4155 dbSNP
rs29730 4165 dbSNP
rs1343286333 4166 dbSNP
rs749055790 4167 dbSNP
rs1399431312 4173 dbSNP
rs1298826880 4174 dbSNP
rs945471248 4178 dbSNP
rs1032814196 4179 dbSNP
rs1044173487 4182 dbSNP
rs957184128 4184 dbSNP
rs988683430 4187 dbSNP
rs1267733684 4198 dbSNP
rs903955849 4203 dbSNP
rs1265479641 4205 dbSNP
rs139338391 4205 dbSNP
rs200383901 4206 dbSNP
rs1315036296 4212 dbSNP
rs971182850 4213 dbSNP
rs1344577827 4223 dbSNP
rs1160383277 4224 dbSNP
rs1281629852 4224 dbSNP
rs1283214886 4224 dbSNP
rs1469620758 4224 dbSNP
rs34285164 4224 dbSNP
rs398034239 4224 dbSNP
rs59419405 4224 dbSNP
rs772758974 4225 dbSNP
rs1294622817 4226 dbSNP
rs1173857305 4231 dbSNP
rs1355518654 4233 dbSNP
rs1481197024 4238 dbSNP
rs77763264 4239 dbSNP
rs1222917641 4241 dbSNP
rs926981600 4242 dbSNP
rs1318288263 4243 dbSNP
rs1240213413 4249 dbSNP
rs1047355487 4250 dbSNP
rs1484892234 4252 dbSNP
rs1243781280 4253 dbSNP
rs1484988145 4256 dbSNP
rs937555685 4262 dbSNP
rs1013829716 4268 dbSNP
rs985050007 4269 dbSNP
rs34994776 4282 dbSNP
rs745425202 4282 dbSNP
rs772296651 4282 dbSNP
rs79785310 4282 dbSNP
rs1225631928 4284 dbSNP
rs771461772 4285 dbSNP
rs1312980469 4290 dbSNP
rs909506255 4293 dbSNP
rs1212882556 4294 dbSNP
rs1364092322 4298 dbSNP
rs897343624 4305 dbSNP
rs1175764279 4306 dbSNP
rs940842995 4307 dbSNP
rs572782701 4309 dbSNP
rs995701693 4311 dbSNP
rs1377841155 4315 dbSNP
rs1159060714 4325 dbSNP
rs535298362 4326 dbSNP
rs1027124970 4329 dbSNP
rs150040119 4333 dbSNP
rs1314639603 4341 dbSNP
rs1189185927 4343 dbSNP
rs1460799919 4358 dbSNP
rs1241102360 4359 dbSNP
rs933439981 4362 dbSNP
rs1483415095 4364 dbSNP
rs1250980493 4367 dbSNP
rs1225451302 4370 dbSNP
rs575084736 4372 dbSNP
rs775555978 4378 dbSNP
rs1298387188 4382 dbSNP
rs1245953481 4384 dbSNP
rs1019322276 4388 dbSNP
rs965272404 4389 dbSNP
rs889133260 4390 dbSNP
rs1317690658 4403 dbSNP
rs1001307441 4419 dbSNP
rs1396154436 4421 dbSNP
rs1295879300 4423 dbSNP
rs183224575 4427 dbSNP
rs893083420 4446 dbSNP
rs774402160 4451 dbSNP
rs947186574 4454 dbSNP
rs187939316 4460 dbSNP
rs1055047245 4461 dbSNP
rs1383307232 4461 dbSNP
rs925326427 4461 dbSNP
rs938144632 4461 dbSNP
rs896514077 4474 dbSNP
rs949624773 4476 dbSNP
rs1037216007 4480 dbSNP
rs759898481 4481 dbSNP
rs1294602464 4488 dbSNP
rs996037112 4493 dbSNP
rs1335581132 4495 dbSNP
rs563789708 4506 dbSNP
rs1234631573 4509 dbSNP
rs971515202 4515 dbSNP
rs1193218919 4517 dbSNP
rs1351944123 4524 dbSNP
rs1308189661 4530 dbSNP
rs1423462785 4540 dbSNP
rs768575986 4541 dbSNP
rs1027160696 4542 dbSNP
rs889524608 4549 dbSNP
rs1458316208 4550 dbSNP
rs1175217287 4551 dbSNP
rs1179383079 4554 dbSNP
rs1002633719 4580 dbSNP
rs577237323 4582 dbSNP
rs1198899539 4593 dbSNP
rs965015692 4593 dbSNP
rs191402175 4594 dbSNP
rs984443700 4596 dbSNP
rs1259410008 4611 dbSNP
rs909453998 4612 dbSNP
rs1330171661 4621 dbSNP
rs1462211839 4623 dbSNP
rs1288608566 4627 dbSNP
rs1324795646 4630 dbSNP
rs772276403 4646 dbSNP
rs1403907142 4651 dbSNP
rs1343138167 4652 dbSNP
rs962281773 4655 dbSNP
rs1387342682 4659 dbSNP
rs1384162299 4662 dbSNP
rs978996240 4664 dbSNP
rs927189199 4666 dbSNP
rs1458630264 4673 dbSNP
rs776510318 4674 dbSNP
rs990892143 4692 dbSNP
rs923445710 4697 dbSNP
rs368788226 4700 dbSNP
rs559281759 4701 dbSNP
rs1361906272 4706 dbSNP
rs949363545 4708 dbSNP
rs1036993819 4709 dbSNP
rs1207356638 4710 dbSNP
rs1213275797 4714 dbSNP
rs1465651940 4726 dbSNP
rs1204296751 4733 dbSNP
rs918797826 4737 dbSNP
rs1275266596 4744 dbSNP
rs933369078 4745 dbSNP
rs62124926 4746 dbSNP
rs910666875 4748 dbSNP
rs761209299 4750 dbSNP
rs1271521568 4754 dbSNP
rs145233563 4758 dbSNP
rs1053816456 4759 dbSNP
rs1325294350 4761 dbSNP
rs1247014073 4764 dbSNP
rs1316159567 4765 dbSNP
rs1007078628 4766 dbSNP
rs1040794743 4768 dbSNP
rs893034355 4773 dbSNP
rs1010159557 4777 dbSNP
rs1041538455 4778 dbSNP
rs907027164 4784 dbSNP
rs1173319112 4786 dbSNP
rs1475136502 4787 dbSNP
rs1475069228 4789 dbSNP
rs764531391 4802 dbSNP
rs1421102369 4810 dbSNP
rs1034082434 4812 dbSNP
rs561571614 4813 dbSNP
rs1280315993 4816 dbSNP
rs1005811763 4823 dbSNP
rs184550250 4826 dbSNP
rs1163511000 4828 dbSNP
rs1391848994 4833 dbSNP
rs1267866658 4835 dbSNP
rs1019983321 4839 dbSNP
rs962232526 4841 dbSNP
rs1462660373 4842 dbSNP
rs1314206878 4843 dbSNP
rs969038527 4848 dbSNP
rs972298341 4866 dbSNP
rs550467300 4872 dbSNP
rs1394480079 4873 dbSNP
rs1420591053 4873 dbSNP
rs958502502 4878 dbSNP
rs954901208 4893 dbSNP
rs1450713966 4899 dbSNP
rs986730110 4907 dbSNP
rs910626564 4931 dbSNP
rs936753618 4940 dbSNP
rs1344953673 4951 dbSNP
rs992638527 4956 dbSNP
rs1429292797 4957 dbSNP
rs917960519 4958 dbSNP
rs970792102 4960 dbSNP
rs973134644 4960 dbSNP
rs989440874 4961 dbSNP
rs754190731 4962 dbSNP
rs913910836 4965 dbSNP
rs931546564 4976 dbSNP
rs1048613695 4981 dbSNP
rs116796731 4995 dbSNP
rs1381117379 5002 dbSNP
rs945391906 5007 dbSNP
rs762054863 5008 dbSNP
rs1334202014 5018 dbSNP
rs1041241848 5023 dbSNP
rs1430504338 5024 dbSNP
rs907137906 5029 dbSNP
rs1364989520 5040 dbSNP
rs540752467 5040 dbSNP
rs900915107 5040 dbSNP
rs1010030319 5041 dbSNP
rs1158342285 5043 dbSNP
rs777687006 5046 dbSNP
rs58095420 5048 dbSNP
rs546587875 5055 dbSNP
rs1478070864 5073 dbSNP
rs1483114915 5076 dbSNP
rs1056046676 5078 dbSNP
rs1219339771 5079 dbSNP
rs140093264 5082 dbSNP
rs1476012030 5083 dbSNP
rs1163447676 5090 dbSNP
rs1005929995 5091 dbSNP
rs1015848679 5102 dbSNP
rs897489045 5103 dbSNP
rs1290470317 5107 dbSNP
rs993162240 5113 dbSNP
rs1030566106 5114 dbSNP
rs1014006105 5116 dbSNP
rs1320614591 5116 dbSNP
rs1439294867 5116 dbSNP
rs955161713 5122 dbSNP
rs1399343177 5123 dbSNP
rs754691560 5124 dbSNP
rs1361768797 5131 dbSNP
rs780613693 5132 dbSNP
rs1472699698 5149 dbSNP
rs1428056671 5154 dbSNP
rs1188944831 5161 dbSNP
rs573104003 5162 dbSNP
rs1311188269 5164 dbSNP
rs1357409848 5176 dbSNP
rs1489138737 5185 dbSNP
rs1247234153 5190 dbSNP
rs970782365 5193 dbSNP
rs972863561 5194 dbSNP
rs1269752632 5204 dbSNP
rs752212659 5206 dbSNP
rs1371034079 5208 dbSNP
rs952721280 5212 dbSNP
rs958073783 5217 dbSNP
rs1478134130 5218 dbSNP
rs1288828755 5222 dbSNP
rs989555314 5228 dbSNP
rs914025534 5229 dbSNP
rs770691001 5233 dbSNP
rs1391342781 5238 dbSNP
rs1321624051 5249 dbSNP
rs1457502526 5250 dbSNP
rs1286043929 5259 dbSNP
rs755992423 5263 dbSNP
rs984534157 5266 dbSNP
rs1434424583 5281 dbSNP
rs982548702 5283 dbSNP
rs372811479 5289 dbSNP
rs942966511 5289 dbSNP
rs1175027417 5298 dbSNP
rs1210046299 5301 dbSNP
rs535387861 5304 dbSNP
rs928539822 5309 dbSNP
rs555279842 5310 dbSNP
rs1254506276 5315 dbSNP
rs777599667 5319 dbSNP
rs1212458657 5320 dbSNP
rs1312890621 5322 dbSNP
rs189748580 5323 dbSNP
rs1041436947 5333 dbSNP
rs894321828 5341 dbSNP
rs1367966735 5360 dbSNP
rs1362865637 5366 dbSNP
rs904288798 5374 dbSNP
rs941903302 5381 dbSNP
rs1400455299 5383 dbSNP
rs1300752886 5385 dbSNP
rs1037411619 5386 dbSNP
rs935641479 5388 dbSNP
rs1055395777 5390 dbSNP
rs894387199 5391 dbSNP
rs1014163044 5392 dbSNP
rs1024073027 5398 dbSNP
rs1443811065 5399 dbSNP
rs374567309 5404 dbSNP
rs1381284005 5412 dbSNP
rs993113128 5414 dbSNP
rs897636002 5416 dbSNP
rs1030426460 5423 dbSNP
rs562302758 5429 dbSNP
rs1377413062 5431 dbSNP
rs1396689073 5439 dbSNP
rs1328189018 5440 dbSNP
rs952917321 5441 dbSNP
rs1018328058 5443 dbSNP
rs1407477394 5443 dbSNP
rs1411616496 5443 dbSNP
rs762632162 5443 dbSNP
rs964272227 5443 dbSNP
rs977031532 5444 dbSNP
rs78993709 5445 dbSNP
rs1169185919 5448 dbSNP
rs557225140 5454 dbSNP
rs577276509 5455 dbSNP
rs946212384 5456 dbSNP
rs1166639032 5458 dbSNP
rs759190619 5458 dbSNP
rs1008232360 5461 dbSNP
rs1250095986 5464 dbSNP
rs1311246060 5470 dbSNP
rs1180228850 5471 dbSNP
rs1484096205 5474 dbSNP
rs1354116291 5477 dbSNP
rs1233566640 5478 dbSNP
rs925692073 5484 dbSNP
rs1354848709 5487 dbSNP
rs1267678215 5491 dbSNP
rs1278087939 5493 dbSNP
rs1349879363 5494 dbSNP
rs935781385 5496 dbSNP
rs1017888777 5498 dbSNP
rs958187956 5501 dbSNP
rs1435765391 5503 dbSNP
rs1183497551 5505 dbSNP
rs989668458 5508 dbSNP
rs1386207287 5510 dbSNP
rs1388493416 5513 dbSNP
rs1295157194 5517 dbSNP
rs1021036386 5522 dbSNP
rs1239241159 5524 dbSNP
rs1454096179 5531 dbSNP
rs1192078154 5532 dbSNP
rs894166660 5545 dbSNP
rs949956844 5553 dbSNP
rs1412867869 5554 dbSNP
rs966797460 5558 dbSNP
rs29729 5561 dbSNP
rs1449873515 5568 dbSNP
rs1270116943 5569 dbSNP
rs927955753 5572 dbSNP
rs1210910496 5574 dbSNP
rs1167433332 5578 dbSNP
rs369821323 5580 dbSNP
rs1411910248 5582 dbSNP
rs1226247998 5584 dbSNP
rs959950232 5590 dbSNP
rs991808498 5595 dbSNP
rs1231905731 5598 dbSNP
rs1288514151 5598 dbSNP
rs915868514 5604 dbSNP
rs1328798588 5606 dbSNP
rs1303361507 5616 dbSNP
rs993312339 5620 dbSNP
rs770621803 5622 dbSNP
rs1037529386 5628 dbSNP
rs778837519 5631 dbSNP
rs929067775 5633 dbSNP
rs1459086630 5644 dbSNP
rs1049403689 5645 dbSNP
rs34141135 5645 dbSNP
rs776076125 5645 dbSNP
rs201138872 5646 dbSNP
rs1200254024 5652 dbSNP
rs1051398724 5654 dbSNP
rs1018275908 5657 dbSNP
rs746024395 5658 dbSNP
rs572877412 5660 dbSNP
rs1268393545 5667 dbSNP
rs1300929641 5677 dbSNP
rs1342315637 5678 dbSNP
rs1276086886 5682 dbSNP
rs1233954439 5683 dbSNP
rs1364367730 5684 dbSNP
rs767477582 5690 dbSNP
rs541753204 5700 dbSNP
rs569613288 5700 dbSNP
rs1365603661 5701 dbSNP
rs9749329 5705 dbSNP
rs1039673867 5711 dbSNP
rs772440776 5727 dbSNP
rs1011050024 5732 dbSNP
rs1250303977 5738 dbSNP
rs1336874854 5740 dbSNP
rs192768636 5741 dbSNP
rs1173225952 5743 dbSNP
rs1429111476 5744 dbSNP
rs1388873296 5750 dbSNP
rs1191005243 5751 dbSNP
rs966744568 5752 dbSNP
rs559253036 5766 dbSNP
rs1029879987 5772 dbSNP
rs528374828 5773 dbSNP
rs143572910 5775 dbSNP
rs1035145608 5785 dbSNP
rs1280208838 5788 dbSNP
rs959634582 5794 dbSNP
rs1200543161 5796 dbSNP
rs1340776723 5799 dbSNP
rs879939228 5804 dbSNP
rs544401278 5807 dbSNP
rs879329722 5809 dbSNP
rs564087362 5810 dbSNP
rs76160532 5813 dbSNP
rs991225998 5814 dbSNP
rs746604408 5818 dbSNP
rs779158584 5818 dbSNP
rs963280127 5818 dbSNP
rs949684505 5819 dbSNP
rs775663273 5820 dbSNP
rs973189639 5824 dbSNP
rs1045383144 5825 dbSNP
rs111768942 5827 dbSNP
rs1161823833 5837 dbSNP
rs1434848258 5846 dbSNP
rs1172418642 5848 dbSNP
rs1417314226 5850 dbSNP
rs146800402 5853 dbSNP
rs566502296 5855 dbSNP
rs1432372510 5856 dbSNP
rs1188166405 5857 dbSNP
rs929253864 5860 dbSNP
rs1361083477 5864 dbSNP
rs768822603 5871 dbSNP
rs776982752 5880 dbSNP
rs1051947439 5886 dbSNP
rs1438317778 5889 dbSNP
rs528881378 5893 dbSNP
rs943013535 5895 dbSNP
rs1285035127 5896 dbSNP
rs548966290 5897 dbSNP
rs561771449 5911 dbSNP
rs765513386 5913 dbSNP
rs1038732487 5919 dbSNP
rs1278236753 5923 dbSNP
rs1411048706 5924 dbSNP
rs894038545 5926 dbSNP
rs1039786293 5936 dbSNP
rs1267646437 5939 dbSNP
rs760088930 5940 dbSNP
rs1489011214 5951 dbSNP
rs892637708 5954 dbSNP
rs1205121315 5959 dbSNP
rs998152316 5961 dbSNP
rs1409213461 5965 dbSNP
rs1183716246 5972 dbSNP
rs1480638439 5975 dbSNP
rs1219232905 5976 dbSNP
rs1246075053 5976 dbSNP
rs1453150741 5983 dbSNP
rs1208410092 5995 dbSNP
rs1260281784 5998 dbSNP
rs1449174098 6001 dbSNP
rs1194503713 6003 dbSNP
rs1290374626 6004 dbSNP
rs1229103264 6005 dbSNP
rs750790580 6009 dbSNP
rs759130818 6010 dbSNP
rs1042545042 6013 dbSNP
rs568738776 6016 dbSNP
rs999534961 6025 dbSNP
rs1320297402 6026 dbSNP
rs1455913108 6031 dbSNP
rs1386008023 6037 dbSNP
rs1160861839 6043 dbSNP
rs1033166073 6053 dbSNP
rs957741325 6054 dbSNP
rs991621830 6057 dbSNP
rs915629591 6063 dbSNP
rs537304370 6065 dbSNP
rs1187702349 6067 dbSNP
rs1463334127 6068 dbSNP
rs981073964 6071 dbSNP
rs1458231648 6073 dbSNP
rs1003755110 6077 dbSNP
rs1288001235 6088 dbSNP
rs918941709 6089 dbSNP
rs1382736723 6091 dbSNP
rs929226803 6106 dbSNP
rs1035497288 6110 dbSNP
rs11882130 6114 dbSNP
rs1221495548 6117 dbSNP
rs1372364946 6125 dbSNP
rs1354236321 6128 dbSNP
rs1433374756 6129 dbSNP
rs1012635445 6130 dbSNP
rs552427428 6135 dbSNP
rs909151315 6139 dbSNP
rs1453975660 6147 dbSNP
rs1358129254 6149 dbSNP
rs1173340038 6152 dbSNP
rs943143052 6161 dbSNP
rs1038892821 6174 dbSNP
rs1016911384 6178 dbSNP
rs1259278158 6185 dbSNP
rs113685041 6193 dbSNP
rs1249635247 6196 dbSNP
rs570953944 6206 dbSNP
rs1187381675 6208 dbSNP
rs934102904 6208 dbSNP
rs1235876946 6219 dbSNP
rs1212351035 6221 dbSNP
rs1348614038 6222 dbSNP
rs973303491 6228 dbSNP
rs1226797206 6233 dbSNP
rs143158394 6244 dbSNP
rs1296720997 6255 dbSNP
rs1382502323 6260 dbSNP
rs1484724083 6263 dbSNP
rs553031320 6264 dbSNP
rs1449615105 6277 dbSNP
rs1375482476 6278 dbSNP
rs950585981 6282 dbSNP
rs151224037 6287 dbSNP
rs1391851654 6289 dbSNP
rs1183614782 6291 dbSNP
rs893399886 6293 dbSNP
rs767175671 6294 dbSNP
rs1183773503 6298 dbSNP
rs1418680266 6304 dbSNP
rs1023131501 6305 dbSNP
rs752159199 6308 dbSNP
rs541840986 6313 dbSNP
rs1484319315 6315 dbSNP
rs1252336872 6323 dbSNP
rs981186769 6324 dbSNP
rs555297055 6326 dbSNP
rs974365723 6334 dbSNP
rs1159176591 6335 dbSNP
rs1374386284 6340 dbSNP
rs1412403640 6344 dbSNP
rs541457923 6347 dbSNP
rs1355601252 6354 dbSNP
rs914917524 6354 dbSNP
rs1379485430 6356 dbSNP
rs946400703 6357 dbSNP
rs1407995649 6362 dbSNP
rs755545805 6371 dbSNP
rs148188699 6374 dbSNP
rs763706761 6379 dbSNP
rs1167231176 6384 dbSNP
rs1475650807 6391 dbSNP
rs1411413378 6392 dbSNP
rs76731964 6394 dbSNP
rs1473581091 6399 dbSNP
rs1056649849 6405 dbSNP
rs184939038 6406 dbSNP
rs934048437 6409 dbSNP
rs1012290231 6411 dbSNP
rs1215244176 6417 dbSNP
rs1335074359 6424 dbSNP
rs1280257350 6426 dbSNP
rs1346260018 6429 dbSNP
rs188822687 6432 dbSNP
rs540365388 6433 dbSNP
rs560306640 6434 dbSNP
rs1388378966 6436 dbSNP
rs934624807 6443 dbSNP
rs528970323 6444 dbSNP
rs879871008 6457 dbSNP
rs1013148478 6458 dbSNP
rs1157154072 6458 dbSNP
rs1364427033 6458 dbSNP
rs1198841474 6459 dbSNP
rs757225508 6461 dbSNP
rs1270006496 6465 dbSNP
rs994151058 6475 dbSNP
rs1194663331 6477 dbSNP
rs561136570 6480 dbSNP
rs1003062067 6483 dbSNP
rs1441301562 6484 dbSNP
rs1206402697 6485 dbSNP
rs1178961865 6487 dbSNP
rs1352273841 6489 dbSNP
rs950674426 6494 dbSNP
rs1026445599 6498 dbSNP
rs1305461710 6506 dbSNP
rs1412649701 6507 dbSNP
rs950503072 6508 dbSNP
rs181559074 6509 dbSNP
rs565557931 6514 dbSNP
rs923196452 6514 dbSNP
rs1174766786 6517 dbSNP
rs1461227765 6523 dbSNP
rs1246546726 6525 dbSNP
rs987686765 6527 dbSNP
rs933115279 6531 dbSNP
rs531284407 6536 dbSNP
rs924682561 6549 dbSNP
rs1342198611 6551 dbSNP