miRTarBase - #MIRT674215 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM120AOS   
Synonyms C9orf10OS
Description family with sequence similarity 120A opposite strand
Transcript NM_198841   
Expression
Putative miRNA Targets on FAM120AOS
3'UTR of FAM120AOS
(miRNA target sites are highlighted)
>FAM120AOS|NM_198841|3'UTR
   1 AAAACTAGGGTCAAGTTCTGCAGAGGCATTGAAAGGACAAGAAACCACCCTGATACCCATCGTGTGAGGGAAAATGCTCT
  81 ATTCACCATTCCTCAGCTTCTGCTTCTGGTTTCAGAGTTCTCTCTATATTGGAGGGTGTTTTAAAGCTAGAGTGGTCTTT
 161 ATCCACTTTTATTAACACATCTGAATGTGAAGGTCAAGAGAGGAAAGTGATATGTCCTAAGTCAGAGTAGAGTCAACAAG
 241 AAAATAAGACAAACAGCGACTGAGCCCCTGGTGTATACTGGGCATTGGCCAGCTACTGGGGATATGGAGATGAAGAAAAC
 321 ATAACCCTTCTTCAAGGAGCCCAACCTACCAAGGTAGACAGACATATAGACAAATAGATACTTGCATAGAAAAAAAGAGG
 401 AAAAGGGGATCAGTGTGACCTGTGTAACTAAGTACCCTATAAACCCTCCTGCAACAGATCATATTGCCCTTTATAGTGGG
 481 GATGGTAATCCCATCTGAATTCCACAGGTACTTTGCAGTCATACCACACCCATGTGTCTGTCGGTCCTGACTGTACCATT
 561 TATAAACAGCTTCACTTTCAGCAGTTCTCAGCCCTCTTAAGCTAGGGTCATTGTCAGTAGGGATACTGCTTCATAAGCAC
 641 CAGCAGAACACCAAAGGAGACCATATGGGTGAAAGCAACCAGCACTGCCCTGGCGCTTCATAGGTTCTTAGAGTTTTTAT
 721 CTTTTACTTTCAGTCTAACACAGCACTGCCTGCTTTTTGTTTTTGTTGCTTGGTTTGTTTTTTTCTTACCGTGTTCACCA
 801 AACTTGTGTCCAAATAGCTTTGGGCTGATGCAAAAATATCTATGTGGAAGAGAAGAGTTGTTCTCATGGAGGGCCTTCAG
 881 ATGAGTGCTATAGACTCTCTAGGCAACTCCAAGAGGCTTCTCAAGCAGGGTGGGCAGTGAGAGCTGCTATGGAATCAATG
 961 GACAAACTGACAGGGACTGCTTTGAAAGACAGTACTCAGTTGAGTATATATATTCTCTCTTAAGGGCTAAAAGTTTATAA
1041 TCATCCCTTAAACACTCTGTGATGGGATCTTCAGGATCATCTTTTGAAGTAAACTATATTTTACAATGTGATATAAAAAA
1121 AAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            | ||:|  |   ||||||: 
Target 5' taATCATCCCTTAAACACTCTg 3'
1038 - 1059 132.00 -10.60
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |::||| |    || |||| 
Target 5' taAGTACCCTATAAACCCTCCt 3'
429 - 450 120.00 -11.90
3
miRNA  3' guUUGUGGUAACAGU-GUGAGGu 5'
            ||::|: |  ||| ||:||| 
Target 5' aaAATGCTCTATTCACCATTCCt 3'
71 - 93 116.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30122158 23 COSMIC
COSN30129779 25 COSMIC
COSN18733944 61 COSMIC
COSN31528030 82 COSMIC
COSN31560418 92 COSMIC
COSN31610586 109 COSMIC
COSN31559420 120 COSMIC
COSN31514251 150 COSMIC
COSN30123268 159 COSMIC
COSN30111018 210 COSMIC
COSN5708283 229 COSMIC
COSN23547623 258 COSMIC
COSN29212796 301 COSMIC
COSN21515477 405 COSMIC
rs3924389 2894 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs202165253 3 dbSNP
rs1390632974 7 dbSNP
rs770110625 9 dbSNP
rs199960989 20 dbSNP
rs1270442647 27 dbSNP
rs777174574 28 dbSNP
rs1438075641 29 dbSNP
rs769177486 30 dbSNP
rs746486025 31 dbSNP
rs779437034 39 dbSNP
rs758012776 40 dbSNP
rs1328977271 41 dbSNP
rs1467017959 42 dbSNP
rs115808552 44 dbSNP
rs778765910 45 dbSNP
rs1408866414 46 dbSNP
rs1477183754 50 dbSNP
rs1337800441 54 dbSNP
rs1217945840 59 dbSNP
rs41274384 61 dbSNP
rs1439843877 62 dbSNP
rs1191814024 64 dbSNP
rs987045869 70 dbSNP
rs1252502308 77 dbSNP
rs1304607849 84 dbSNP
rs962238420 96 dbSNP
rs1371287307 97 dbSNP
rs955826869 102 dbSNP
rs1236964887 108 dbSNP
rs1461242813 109 dbSNP
rs1168353804 117 dbSNP
rs1459594958 122 dbSNP
rs1324602824 125 dbSNP
rs1020269917 126 dbSNP
rs755033894 143 dbSNP
rs1363222018 150 dbSNP
rs1442492611 163 dbSNP
rs1303981551 164 dbSNP
rs528597057 168 dbSNP
rs988832676 170 dbSNP
rs1227144507 171 dbSNP
rs957437099 179 dbSNP
rs1033127834 183 dbSNP
rs1001625559 195 dbSNP
rs1320243276 195 dbSNP
rs1272817857 207 dbSNP
rs1468928095 208 dbSNP
rs1195590240 209 dbSNP
rs1347012028 210 dbSNP
rs1427911084 211 dbSNP
rs1332335116 213 dbSNP
rs1034301219 219 dbSNP
rs1193607966 219 dbSNP
rs1002842403 220 dbSNP
rs1163698746 224 dbSNP
rs1173957720 226 dbSNP
rs1394779653 239 dbSNP
rs1462499464 248 dbSNP
rs41274382 251 dbSNP
rs1387879757 253 dbSNP
rs766798048 257 dbSNP
rs1185601973 258 dbSNP
rs1041789938 261 dbSNP
rs1382203431 265 dbSNP
rs1024579623 278 dbSNP
rs1342721578 290 dbSNP
rs1014146837 293 dbSNP
rs1009782392 295 dbSNP
rs372276687 305 dbSNP
rs1047368150 312 dbSNP
rs1054069362 318 dbSNP
rs1223851064 320 dbSNP
rs936582210 324 dbSNP
rs1485487333 335 dbSNP
rs530975085 339 dbSNP
rs1442284607 341 dbSNP
rs1050057262 344 dbSNP
rs932989187 362 dbSNP
rs368620010 365 dbSNP
rs879410125 367 dbSNP
rs922975714 368 dbSNP
rs898912897 369 dbSNP
rs1476015874 374 dbSNP
rs1156283891 377 dbSNP
rs75779550 377 dbSNP
rs943140119 379 dbSNP
rs1289910115 380 dbSNP
rs1363016481 387 dbSNP
rs911364173 388 dbSNP
rs940468496 399 dbSNP
rs779112100 400 dbSNP
rs1297382417 404 dbSNP
rs1230284617 419 dbSNP
rs987403785 419 dbSNP
rs1215366089 426 dbSNP
rs1364426335 432 dbSNP
rs1305176241 437 dbSNP
rs909379178 439 dbSNP
rs1282499615 445 dbSNP
rs1287991288 447 dbSNP
rs182736305 449 dbSNP
rs1209874837 451 dbSNP
rs1374710251 460 dbSNP
rs1313427051 469 dbSNP
rs1258021222 475 dbSNP
rs574945746 478 dbSNP
rs913512460 485 dbSNP
rs1175075804 490 dbSNP
rs1436307895 496 dbSNP
rs147325203 502 dbSNP
rs749372579 507 dbSNP
rs1428731000 510 dbSNP
rs1033012563 511 dbSNP
rs527407303 514 dbSNP
rs1173372678 523 dbSNP
rs1179551415 524 dbSNP
rs970563148 534 dbSNP
rs780336632 542 dbSNP
rs375510405 543 dbSNP
rs886355682 544 dbSNP
rs1258780831 553 dbSNP
rs371029369 558 dbSNP
rs1392034026 564 dbSNP
rs1034582884 571 dbSNP
rs1482390865 573 dbSNP
rs1345611581 576 dbSNP
rs1233525875 581 dbSNP
rs1026223943 583 dbSNP
rs765594646 591 dbSNP
rs981369053 593 dbSNP
rs142030308 594 dbSNP
rs1480791273 606 dbSNP
rs1038688544 610 dbSNP
rs1179955100 614 dbSNP
rs1205748745 615 dbSNP
rs943120771 623 dbSNP
rs1193510324 625 dbSNP
rs41274380 634 dbSNP
rs1032161467 637 dbSNP
rs1051267897 644 dbSNP
rs1356206169 657 dbSNP
rs1295240190 669 dbSNP
rs148588599 687 dbSNP
rs1001117592 689 dbSNP
rs1297388605 691 dbSNP
rs1462308033 694 dbSNP
rs913408740 695 dbSNP
rs3898091 696 dbSNP
rs1355872842 697 dbSNP
rs1303992727 704 dbSNP
rs546304557 706 dbSNP
rs1369642039 711 dbSNP
rs1162297538 723 dbSNP
rs889010385 725 dbSNP
rs1272093927 726 dbSNP
rs117128404 733 dbSNP
rs932938198 747 dbSNP
rs936258240 751 dbSNP
rs569311860 754 dbSNP
rs1213775692 755 dbSNP
rs1247798438 760 dbSNP
rs768339833 770 dbSNP
rs980130328 772 dbSNP
rs1036476761 776 dbSNP
rs1471896649 784 dbSNP
rs1250443472 785 dbSNP
rs746513776 789 dbSNP
rs1173029782 790 dbSNP
rs192096876 791 dbSNP
rs917360578 796 dbSNP
rs1460924484 797 dbSNP
rs992668622 798 dbSNP
rs908969843 801 dbSNP
rs1428607087 802 dbSNP
rs984953832 813 dbSNP
rs771917816 819 dbSNP
rs536171660 822 dbSNP
rs565837266 825 dbSNP
rs1290986481 826 dbSNP
rs963292744 831 dbSNP
rs547250481 832 dbSNP
rs971661886 833 dbSNP
rs1453803661 839 dbSNP
rs1214220397 842 dbSNP
rs1242065448 842 dbSNP
rs1007676696 852 dbSNP
rs1196299835 862 dbSNP
rs1213264647 863 dbSNP
rs1475035805 865 dbSNP
rs866283291 866 dbSNP
rs989245770 873 dbSNP
rs957446312 878 dbSNP
rs778606236 881 dbSNP
rs1317483027 883 dbSNP
rs532369296 890 dbSNP
rs1326904808 891 dbSNP
rs1009318981 894 dbSNP
rs1306228629 899 dbSNP
rs1354410597 901 dbSNP
rs1233568931 902 dbSNP
rs1033527031 920 dbSNP
rs891944726 922 dbSNP
rs757019777 926 dbSNP
rs1375219331 947 dbSNP
rs570946888 949 dbSNP
rs781771560 957 dbSNP
rs926219667 958 dbSNP
rs1044400097 966 dbSNP
rs1255907246 969 dbSNP
rs1439695662 971 dbSNP
rs187624162 978 dbSNP
rs1394851509 994 dbSNP
rs1278591997 999 dbSNP
rs1166389130 1000 dbSNP
rs1380831864 1002 dbSNP
rs1455203603 1003 dbSNP
rs1421496801 1005 dbSNP
rs566923427 1007 dbSNP
rs1171493540 1010 dbSNP
rs1363675247 1014 dbSNP
rs1374584768 1014 dbSNP
rs1396410953 1016 dbSNP
rs1335714068 1019 dbSNP
rs549007893 1020 dbSNP
rs530414172 1030 dbSNP
rs901783460 1044 dbSNP
rs1279686492 1045 dbSNP
rs993283267 1046 dbSNP
rs768772996 1059 dbSNP
rs1242998338 1066 dbSNP
rs781384075 1084 dbSNP
rs1036000959 1085 dbSNP
rs757589518 1089 dbSNP
rs973233218 1096 dbSNP
rs963262273 1098 dbSNP
rs144761786 1106 dbSNP
rs1181152038 1115 dbSNP
rs1238914064 1122 dbSNP
rs1441660797 1124 dbSNP
rs1007482016 1127 dbSNP
rs542484133 1129 dbSNP
rs1469070621 1136 dbSNP
rs1049294512 1137 dbSNP
rs1409059579 1137 dbSNP
rs368334816 1137 dbSNP
rs539268599 1137 dbSNP
rs183946458 1138 dbSNP
rs1030015107 1142 dbSNP
rs1378420777 1145 dbSNP
rs530306653 1148 dbSNP
rs190967422 1150 dbSNP
rs754647050 1151 dbSNP
rs1331104174 1166 dbSNP
rs1261430973 1176 dbSNP
rs950287554 1187 dbSNP
rs1337665512 1191 dbSNP
rs892251135 1194 dbSNP
rs1053264642 1195 dbSNP
rs62574532 1228 dbSNP
rs988802133 1234 dbSNP
rs1211902732 1237 dbSNP
rs529947283 1237 dbSNP
rs1252287561 1239 dbSNP
rs957601235 1245 dbSNP
rs926024815 1253 dbSNP
rs985940378 1257 dbSNP
rs765810651 1260 dbSNP
rs1371209140 1271 dbSNP
rs1474977916 1279 dbSNP
rs904768615 1285 dbSNP
rs1327523197 1287 dbSNP
rs1432207880 1289 dbSNP
rs149410459 1293 dbSNP
rs760210175 1295 dbSNP
rs1028811684 1299 dbSNP
rs1324702496 1310 dbSNP
rs949001864 1314 dbSNP
rs895782676 1318 dbSNP
rs1326152357 1325 dbSNP
rs1387905014 1325 dbSNP
rs1325003962 1327 dbSNP
rs1218420142 1335 dbSNP
rs965928984 1339 dbSNP
rs1320352419 1343 dbSNP
rs1231510889 1346 dbSNP
rs59509900 1349 dbSNP
rs929373656 1363 dbSNP
rs919381386 1365 dbSNP
rs1211521388 1369 dbSNP
rs1004519423 1370 dbSNP
rs887434770 1381 dbSNP
rs1048761768 1383 dbSNP
rs1454991947 1396 dbSNP
rs1425310104 1399 dbSNP
rs186062564 1400 dbSNP
rs941831446 1403 dbSNP
rs76828368 1404 dbSNP
rs1262503336 1405 dbSNP
rs986427920 1407 dbSNP
rs761637284 1410 dbSNP
rs954661456 1419 dbSNP
rs1030398786 1420 dbSNP
rs1299250384 1422 dbSNP
rs1486770081 1423 dbSNP
rs774079239 1424 dbSNP
rs1312318719 1430 dbSNP
rs913442702 1436 dbSNP
rs112393313 1441 dbSNP
rs1258890606 1444 dbSNP
rs936299789 1449 dbSNP
rs138565058 1450 dbSNP
rs985481734 1466 dbSNP
rs1305401405 1467 dbSNP
rs1224759695 1485 dbSNP
rs1032128049 1492 dbSNP
rs922701154 1494 dbSNP
rs1156396392 1496 dbSNP
rs1000625591 1501 dbSNP
rs1419671625 1512 dbSNP
rs9696476 1514 dbSNP
rs1383417271 1522 dbSNP
rs768908198 1526 dbSNP
rs1362801493 1528 dbSNP
rs1433269662 1534 dbSNP
rs565818585 1536 dbSNP
rs554074255 1539 dbSNP
rs1023152591 1544 dbSNP
rs1013571507 1545 dbSNP
rs1014794219 1546 dbSNP
rs1305020373 1555 dbSNP
rs1376022580 1555 dbSNP
rs1240740478 1558 dbSNP
rs896092083 1559 dbSNP
rs983773393 1560 dbSNP
rs1345402250 1561 dbSNP
rs763845420 1565 dbSNP
rs1484061688 1577 dbSNP
rs1027721916 1586 dbSNP
rs143093972 1589 dbSNP
rs374332978 1589 dbSNP
rs1179758492 1596 dbSNP
rs538793574 1598 dbSNP
rs1057440947 1599 dbSNP
rs760348064 1601 dbSNP
rs1433174671 1605 dbSNP
rs897835623 1609 dbSNP
rs1037708743 1610 dbSNP
rs1359942295 1617 dbSNP
rs71496441 1625 dbSNP
rs1467811261 1626 dbSNP
rs774887815 1629 dbSNP
rs141303817 1638 dbSNP
rs1399583192 1639 dbSNP
rs1014339734 1642 dbSNP
rs564856630 1648 dbSNP
rs1475207769 1653 dbSNP
rs1373865112 1665 dbSNP
rs1218411045 1666 dbSNP
rs1301772982 1672 dbSNP
rs1313552623 1675 dbSNP
rs1195350369 1677 dbSNP
rs1257056646 1678 dbSNP
rs144710936 1680 dbSNP
rs1477355658 1682 dbSNP
rs891950925 1682 dbSNP
rs910346584 1685 dbSNP
rs1255264791 1687 dbSNP
rs1426264269 1687 dbSNP
rs370906709 1687 dbSNP
rs1187094041 1691 dbSNP
rs1053329313 1692 dbSNP
rs537568180 1700 dbSNP
rs986011666 1708 dbSNP
rs771574548 1709 dbSNP
rs923254567 1711 dbSNP
rs1282176997 1714 dbSNP
rs1333510197 1715 dbSNP
rs1193926333 1721 dbSNP
rs1049734295 1724 dbSNP
rs745837299 1733 dbSNP
rs932643407 1744 dbSNP
rs922647846 1745 dbSNP
rs1338266021 1747 dbSNP
rs142331484 1748 dbSNP
rs940162069 1750 dbSNP
rs118033131 1762 dbSNP
rs1032015233 1768 dbSNP
rs1219913814 1768 dbSNP
rs1243903668 1782 dbSNP
rs983333944 1789 dbSNP
rs979153167 1794 dbSNP
rs952028631 1795 dbSNP
rs1489635346 1797 dbSNP
rs969179936 1798 dbSNP
rs1415923912 1801 dbSNP
rs530150540 1802 dbSNP
rs1478297357 1804 dbSNP
rs979695889 1805 dbSNP
rs559793866 1810 dbSNP
rs1409767693 1812 dbSNP
rs1023957945 1814 dbSNP
rs1397423335 1817 dbSNP
rs1165322087 1828 dbSNP
rs751452078 1834 dbSNP
rs10992739 1839 dbSNP
rs548071484 1844 dbSNP
rs532527328 1848 dbSNP
rs1013955347 1849 dbSNP
rs891565379 1850 dbSNP
rs1401421477 1851 dbSNP
rs565152529 1858 dbSNP
rs1000382028 1869 dbSNP
rs1165818876 1874 dbSNP
rs1475490510 1883 dbSNP
rs904733916 1885 dbSNP
rs1259534911 1887 dbSNP
rs1179325479 1890 dbSNP
rs1050012970 1895 dbSNP
rs1020378286 1897 dbSNP
rs749082923 1900 dbSNP
rs1196049334 1906 dbSNP
rs901172918 1916 dbSNP
rs1041091669 1926 dbSNP
rs1182588337 1927 dbSNP
rs993711325 1935 dbSNP
rs1417830027 1948 dbSNP
rs376169203 1949 dbSNP
rs1037677620 1950 dbSNP
rs1421306301 1952 dbSNP
rs1331717950 1954 dbSNP
rs930493573 1968 dbSNP
rs1448109511 1972 dbSNP
rs34068791 1975 dbSNP
rs1006248300 1977 dbSNP
rs1285494885 1984 dbSNP
rs1233374133 1990 dbSNP
rs1337514983 1994 dbSNP
rs1285952707 1995 dbSNP
rs1278322538 2001 dbSNP
rs1198261676 2002 dbSNP
rs1010450214 2003 dbSNP
rs1354792253 2003 dbSNP
rs1276765002 2004 dbSNP
rs1331346968 2008 dbSNP
rs920477013 2009 dbSNP
rs1438962699 2011 dbSNP
rs1210869429 2012 dbSNP
rs889231513 2014 dbSNP
rs1437929821 2015 dbSNP
rs544986481 2015 dbSNP
rs1380851785 2016 dbSNP
rs543085233 2016 dbSNP
rs1401030036 2017 dbSNP
rs979978510 2017 dbSNP
rs575528994 2018 dbSNP
rs1445417727 2019 dbSNP
rs933204388 2019 dbSNP
rs1415811908 2020 dbSNP
rs1156773480 2021 dbSNP
rs923107785 2021 dbSNP
rs1052311398 2022 dbSNP
rs1469608612 2022 dbSNP
rs1364148711 2023 dbSNP
rs867719438 2024 dbSNP
rs1456449913 2025 dbSNP
rs924913467 2025 dbSNP
rs1238703665 2026 dbSNP
rs916895239 2026 dbSNP
rs1376811907 2027 dbSNP
rs386415494 2027 dbSNP
rs1173905685 2028 dbSNP
rs1234428198 2028 dbSNP
rs1266601788 2028 dbSNP
rs1322172593 2028 dbSNP
rs1331509285 2028 dbSNP
rs1393606744 2028 dbSNP
rs1401631693 2028 dbSNP
rs1478244825 2028 dbSNP
rs1491367030 2028 dbSNP
rs199731649 2028 dbSNP
rs71364380 2028 dbSNP
rs955953636 2028 dbSNP
rs992535464 2028 dbSNP
rs1252008879 2029 dbSNP
rs979115235 2029 dbSNP
rs1213724561 2030 dbSNP
rs969540885 2030 dbSNP
rs1000737346 2031 dbSNP
rs1170737732 2031 dbSNP
rs1425089334 2031 dbSNP
rs1455946716 2031 dbSNP
rs1477319318 2031 dbSNP
rs749645011 2031 dbSNP
rs916366173 2031 dbSNP
rs1028535769 2032 dbSNP
rs1380691713 2032 dbSNP
rs147304646 2032 dbSNP
rs1264788086 2036 dbSNP
rs997084827 2042 dbSNP
rs992325304 2049 dbSNP
rs1487852848 2051 dbSNP
rs960193646 2052 dbSNP
rs1281578151 2055 dbSNP
rs36105963 2060 dbSNP
rs1264890266 2062 dbSNP
rs10992738 2064 dbSNP
rs1421540472 2069 dbSNP
rs1186302241 2071 dbSNP
rs1223690360 2077 dbSNP
rs10992737 2081 dbSNP
rs1035838281 2083 dbSNP
rs575707686 2089 dbSNP
rs766303979 2098 dbSNP
rs993681775 2099 dbSNP
rs1166056702 2112 dbSNP
rs1358965994 2116 dbSNP
rs769951169 2118 dbSNP
rs1281630579 2119 dbSNP
rs1232556810 2129 dbSNP
rs1298957289 2134 dbSNP
rs1004237823 2147 dbSNP
rs1364431060 2147 dbSNP
rs962297663 2159 dbSNP
rs1312157410 2160 dbSNP
rs1016202095 2162 dbSNP
rs1006218869 2164 dbSNP
rs557243818 2174 dbSNP
rs1443142447 2179 dbSNP
rs1343477271 2180 dbSNP
rs1217154124 2187 dbSNP
rs1262111650 2189 dbSNP
rs1482100869 2194 dbSNP
rs1199361994 2196 dbSNP
rs1050499999 2197 dbSNP
rs1256199145 2199 dbSNP
rs1317795742 2201 dbSNP
rs1425057686 2204 dbSNP
rs1400037398 2207 dbSNP
rs10992736 2213 dbSNP
rs10992735 2221 dbSNP
rs920423640 2227 dbSNP
rs12684981 2231 dbSNP
rs1439464258 2236 dbSNP
rs901655955 2242 dbSNP
rs1044232496 2244 dbSNP
rs1052282947 2247 dbSNP
rs1464768236 2249 dbSNP
rs935224981 2260 dbSNP
rs925229057 2261 dbSNP
rs1302518106 2270 dbSNP
rs137906888 2272 dbSNP
rs1193850869 2273 dbSNP
rs1478831972 2274 dbSNP
rs1376147005 2281 dbSNP
rs917177928 2281 dbSNP
rs1258320480 2283 dbSNP
rs1308932937 2285 dbSNP
rs145547619 2286 dbSNP
rs867821578 2287 dbSNP
rs947709651 2293 dbSNP
rs916232198 2294 dbSNP
rs1462212762 2303 dbSNP
rs991899754 2309 dbSNP
rs1196281812 2312 dbSNP
rs1214533897 2316 dbSNP
rs1236867555 2318 dbSNP
rs10992734 2319 dbSNP
rs960750358 2319 dbSNP
rs200786156 2320 dbSNP
rs955741365 2328 dbSNP
rs924306445 2331 dbSNP
rs1470990331 2335 dbSNP
rs572052168 2337 dbSNP
rs978533721 2339 dbSNP
rs968480258 2340 dbSNP
rs1028484825 2341 dbSNP
rs1365148085 2344 dbSNP
rs1209114768 2351 dbSNP
rs928792588 2360 dbSNP
rs997032327 2370 dbSNP
rs553744626 2372 dbSNP
rs747213674 2375 dbSNP
rs1347650659 2378 dbSNP
rs538951815 2379 dbSNP
rs965598339 2380 dbSNP
rs1256913218 2382 dbSNP
rs1318037979 2389 dbSNP
rs962268132 2397 dbSNP
rs1205777195 2400 dbSNP
rs1235107521 2409 dbSNP
rs76767782 2414 dbSNP
rs577886379 2421 dbSNP
rs1016505418 2422 dbSNP
rs1481566448 2425 dbSNP
rs140358054 2430 dbSNP
rs887105146 2432 dbSNP
rs1326904974 2437 dbSNP
rs1048912062 2441 dbSNP
rs953366659 2442 dbSNP
rs548787654 2443 dbSNP
rs997583055 2444 dbSNP
rs1348118586 2445 dbSNP
rs1432834672 2446 dbSNP
rs1374605539 2447 dbSNP
rs1174087989 2448 dbSNP
rs1346970196 2462 dbSNP
rs537076188 2467 dbSNP
rs76660595 2470 dbSNP
rs1340535532 2471 dbSNP
rs1185369590 2474 dbSNP
rs948573679 2476 dbSNP
rs183258285 2478 dbSNP
rs1275704361 2483 dbSNP
rs917130602 2496 dbSNP
rs1221255346 2500 dbSNP
rs999391962 2504 dbSNP
rs903694781 2507 dbSNP
rs1043622706 2510 dbSNP
rs1292907103 2510 dbSNP
rs1490948421 2512 dbSNP
rs536207143 2514 dbSNP
rs1262742480 2518 dbSNP
rs1475782588 2522 dbSNP
rs894781857 2523 dbSNP
rs1188420200 2528 dbSNP
rs1411510043 2529 dbSNP
rs1186387277 2531 dbSNP
rs1404736143 2532 dbSNP
rs1164168554 2534 dbSNP
rs566072661 2542 dbSNP
rs939095613 2543 dbSNP
rs190089098 2550 dbSNP
rs373936204 2554 dbSNP
rs1432259560 2556 dbSNP
rs370755370 2558 dbSNP
rs940828662 2565 dbSNP
rs1272592587 2575 dbSNP
rs1228200331 2577 dbSNP
rs1316363595 2586 dbSNP
rs947092063 2594 dbSNP
rs921036349 2595 dbSNP
rs1285568102 2599 dbSNP
rs1447853233 2599 dbSNP
rs909388530 2601 dbSNP
rs549943912 2609 dbSNP
rs1235769431 2613 dbSNP
rs1364137308 2615 dbSNP
rs1184066237 2620 dbSNP
rs1291572350 2628 dbSNP
rs58641123 2636 dbSNP
rs1157877015 2644 dbSNP
rs965541505 2646 dbSNP
rs1020233433 2653 dbSNP
rs370986520 2656 dbSNP
rs1028983106 2658 dbSNP
rs560815783 2662 dbSNP
rs116172571 2663 dbSNP
rs983051000 2675 dbSNP
rs115650155 2681 dbSNP
rs1285837659 2693 dbSNP
rs1385703359 2696 dbSNP
rs376468534 2701 dbSNP
rs151222305 2702 dbSNP
rs57664931 2705 dbSNP
rs1276789569 2716 dbSNP
rs1441846256 2722 dbSNP
rs903662353 2725 dbSNP
rs754269475 2735 dbSNP
rs538036846 2737 dbSNP
rs1258846486 2738 dbSNP
rs1177967896 2741 dbSNP
rs895077474 2745 dbSNP
rs1183915469 2746 dbSNP
rs764505634 2747 dbSNP
rs573784392 2750 dbSNP
rs1056129660 2751 dbSNP
rs1469860141 2752 dbSNP
rs1036138526 2754 dbSNP
rs1178033071 2757 dbSNP
rs554724439 2761 dbSNP
rs1408905384 2763 dbSNP
rs1205465139 2766 dbSNP
rs536765997 2767 dbSNP
rs185719472 2770 dbSNP
rs1328802952 2774 dbSNP
rs1336669026 2778 dbSNP
rs1271341920 2781 dbSNP
rs534152352 2783 dbSNP
rs760438114 2785 dbSNP
rs1057383720 2787 dbSNP
rs1232754725 2788 dbSNP
rs1344639557 2797 dbSNP
rs939055519 2805 dbSNP
rs934583423 2810 dbSNP
rs532810868 2813 dbSNP
rs60847685 2825 dbSNP
rs947041157 2830 dbSNP
rs571596848 2831 dbSNP
rs147899245 2839 dbSNP
rs1439335390 2840 dbSNP
rs1196547043 2849 dbSNP
rs1245752140 2850 dbSNP
rs920982719 2852 dbSNP
rs181515329 2854 dbSNP
rs1229777359 2868 dbSNP
rs941132669 2869 dbSNP
rs909359154 2871 dbSNP
rs943805663 2879 dbSNP
rs1464661947 2882 dbSNP
rs985394444 2887 dbSNP
rs1397916304 2893 dbSNP
rs3924389 2894 dbSNP
rs1442465474 2895 dbSNP
rs189135845 2910 dbSNP
rs1405723579 2915 dbSNP
rs976368015 2918 dbSNP
rs140704839 2919 dbSNP
rs1226868761 2920 dbSNP
rs1251800232 2927 dbSNP
rs187337766 2928 dbSNP
rs35466478 2928 dbSNP
rs974004287 2930 dbSNP
rs1167487001 2931 dbSNP
rs755599407 2932 dbSNP
rs182239743 2934 dbSNP
rs1201065788 2936 dbSNP
rs749975383 2936 dbSNP
rs1260599420 2950 dbSNP
rs1477207749 2952 dbSNP
rs1193352567 2960 dbSNP
rs1374107134 2961 dbSNP
rs1178211297 2963 dbSNP
rs969352308 2963 dbSNP
rs1023631008 2966 dbSNP
rs1251390501 2967 dbSNP
rs905971654 2972 dbSNP
rs370194021 2974 dbSNP
rs896592713 2975 dbSNP
rs1267346688 2978 dbSNP
rs1246871739 2979 dbSNP
rs1315118418 2981 dbSNP
rs1311012588 2982 dbSNP
rs1328314394 2983 dbSNP
rs1242458425 2989 dbSNP
rs1314313164 2991 dbSNP
rs968153320 2995 dbSNP
rs1359805884 2996 dbSNP
rs1022110164 2997 dbSNP
rs1224532846 2997 dbSNP
rs143027778 2997 dbSNP
rs1485363062 2997 dbSNP
rs566957284 2997 dbSNP
rs999114670 2999 dbSNP
rs1385228243 3000 dbSNP
rs1165914436 3003 dbSNP
rs1378669057 3006 dbSNP
rs1012532652 3010 dbSNP
rs959312068 3016 dbSNP
rs947317749 3025 dbSNP
rs899494982 3026 dbSNP
rs1335999080 3034 dbSNP
rs36088229 3037 dbSNP
rs1439756131 3038 dbSNP
rs147656988 3039 dbSNP
rs1306758105 3046 dbSNP
rs1316143206 3048 dbSNP
rs562726490 3052 dbSNP
rs1262126061 3054 dbSNP
rs1481985227 3057 dbSNP
rs544528355 3058 dbSNP
rs1202547350 3066 dbSNP
rs1243042681 3096 dbSNP
rs377565703 3101 dbSNP
rs1294830957 3104 dbSNP
rs1186003721 3109 dbSNP
rs896803225 3113 dbSNP
rs1418878603 3114 dbSNP
rs912313644 3115 dbSNP
rs11793303 3116 dbSNP
rs1160023730 3117 dbSNP
rs770864445 3118 dbSNP
rs117812063 3122 dbSNP
rs1175857920 3134 dbSNP
rs1406962329 3135 dbSNP
rs551543196 3146 dbSNP
rs762825758 3152 dbSNP
rs1441958404 3153 dbSNP
rs1393462766 3172 dbSNP
rs1049228475 3173 dbSNP
rs1308674629 3175 dbSNP
rs555558623 3180 dbSNP
rs540081612 3181 dbSNP
rs1325105569 3182 dbSNP
rs1269543921 3183 dbSNP
rs1250136814 3184 dbSNP
rs922123793 3185 dbSNP
rs1480509113 3186 dbSNP
rs34317623 3187 dbSNP
rs1203538082 3198 dbSNP
rs916569670 3199 dbSNP
rs528681536 3202 dbSNP
rs1041001719 3204 dbSNP
rs1260096021 3216 dbSNP
rs12002609 3219 dbSNP
rs1479602612 3221 dbSNP
rs1198994122 3230 dbSNP
rs1430006237 3232 dbSNP
rs992134501 3235 dbSNP
rs960800370 3237 dbSNP
rs1168439639 3238 dbSNP
rs1353918187 3244 dbSNP
rs1462282424 3246 dbSNP
rs116311818 3247 dbSNP
rs114312655 3261 dbSNP
rs1277980134 3263 dbSNP
rs1271489687 3266 dbSNP
rs978110491 3281 dbSNP
rs773020912 3289 dbSNP
rs1205625742 3291 dbSNP
rs373538041 3292 dbSNP
rs1253395441 3303 dbSNP
rs769545458 3305 dbSNP
rs1302683700 3307 dbSNP
rs1380045328 3308 dbSNP
rs915344226 3310 dbSNP
rs1184905451 3311 dbSNP
rs1418660280 3312 dbSNP
rs1290003532 3320 dbSNP
rs1422108246 3321 dbSNP
rs1374005233 3323 dbSNP
rs538642057 3324 dbSNP
rs139396844 3325 dbSNP
rs1021504572 3330 dbSNP
rs1303378359 3335 dbSNP
rs1367114889 3348 dbSNP
rs1397564171 3349 dbSNP
rs1269121339 3351 dbSNP
rs1379601393 3358 dbSNP
rs556406629 3359 dbSNP
rs868807609 3361 dbSNP
rs1011479504 3367 dbSNP
rs1034879280 3369 dbSNP
rs1298378271 3379 dbSNP
rs899776901 3381 dbSNP
rs780308797 3387 dbSNP
rs1262561711 3389 dbSNP
rs1194265624 3394 dbSNP
rs189453201 3413 dbSNP
rs1277914583 3414 dbSNP
rs1003387042 3417 dbSNP
rs1490912308 3422 dbSNP
rs1345221273 3423 dbSNP
rs1039356544 3425 dbSNP
rs567893216 3428 dbSNP
rs1224566607 3430 dbSNP
rs1306385045 3434 dbSNP
rs1008325891 3440 dbSNP
rs890841170 3445 dbSNP
rs1188133298 3467 dbSNP
rs1047259413 3468 dbSNP
rs549539932 3474 dbSNP
rs372858429 3483 dbSNP
rs1396995985 3484 dbSNP
rs1005216236 3488 dbSNP
rs1404566147 3494 dbSNP
rs1398553789 3501 dbSNP
rs1317213029 3502 dbSNP
rs1345195230 3505 dbSNP
rs772111651 3507 dbSNP
rs1381281437 3508 dbSNP
rs566572494 3510 dbSNP
rs996625146 3511 dbSNP
rs900636235 3520 dbSNP
rs920076535 3521 dbSNP
rs1172992483 3524 dbSNP
rs1478722084 3531 dbSNP
rs1222223899 3547 dbSNP
rs1040593638 3548 dbSNP
rs761713437 3549 dbSNP
rs1241175272 3560 dbSNP
rs1460846162 3570 dbSNP
rs201438819 3576 dbSNP
rs377153444 3576 dbSNP
rs1244695561 3577 dbSNP
rs1157625904 3580 dbSNP
rs948280019 3580 dbSNP
rs1258061218 3582 dbSNP
rs916851098 3583 dbSNP
rs1173681296 3584 dbSNP
rs150909481 3584 dbSNP
rs1193696288 3591 dbSNP
rs1480140087 3594 dbSNP
rs1452483136 3596 dbSNP
rs1337973836 3603 dbSNP
rs961001103 3604 dbSNP
rs1042403515 3608 dbSNP
rs946674620 3609 dbSNP
rs1279179016 3623 dbSNP
rs1374399525 3624 dbSNP
rs924001858 3627 dbSNP
rs532918139 3630 dbSNP
rs1258138866 3632 dbSNP
rs184521498 3639 dbSNP
rs1204145006 3642 dbSNP
rs779079497 3656 dbSNP
rs991289104 3657 dbSNP
rs762869034 3664 dbSNP
rs1265001232 3668 dbSNP
rs373884548 3669 dbSNP
rs968181941 3669 dbSNP
rs1246218391 3676 dbSNP
rs1021453814 3679 dbSNP
rs775802418 3684 dbSNP
rs959497705 3685 dbSNP
rs1427915709 3690 dbSNP
rs1469874686 3692 dbSNP
rs1327334729 3697 dbSNP
rs1011426824 3701 dbSNP
rs1391032124 3701 dbSNP
rs544148910 3702 dbSNP
rs981936986 3706 dbSNP
rs141514940 3709 dbSNP
rs191310081 3717 dbSNP
rs1459966287 3721 dbSNP
rs984003780 3728 dbSNP
rs1415534882 3733 dbSNP
rs952457885 3735 dbSNP
rs1027999814 3742 dbSNP
rs1285090962 3743 dbSNP
rs149142463 3750 dbSNP
rs1007859088 3757 dbSNP
rs890778344 3761 dbSNP
rs140145584 3768 dbSNP
rs994310418 3770 dbSNP
rs900944657 3776 dbSNP
rs1019120535 3778 dbSNP
rs115702959 3780 dbSNP
rs1201025147 3786 dbSNP
rs1379851046 3792 dbSNP
rs757862696 3795 dbSNP
rs1167868537 3797 dbSNP
rs1179480213 3798 dbSNP
rs1165424467 3803 dbSNP
rs1397589616 3807 dbSNP
rs1432024894 3814 dbSNP
rs573000089 3815 dbSNP
rs759689286 3821 dbSNP
rs1436798360 3824 dbSNP
rs188352356 3834 dbSNP
rs11548958 3839 dbSNP
rs902689830 3842 dbSNP
rs1365241252 3850 dbSNP
rs1042624174 3856 dbSNP
rs1226528828 3857 dbSNP
rs1324781362 3857 dbSNP
rs545107422 3858 dbSNP
rs754359400 3866 dbSNP
rs1199937365 3868 dbSNP
rs1243575994 3869 dbSNP
rs577588753 3870 dbSNP
rs1057111788 3872 dbSNP
rs776634949 3881 dbSNP
rs939661531 3882 dbSNP
rs1210943220 3884 dbSNP
rs184059774 3900 dbSNP
rs923917126 3906 dbSNP
rs1451691780 3908 dbSNP
rs112907784 3909 dbSNP
rs1377859059 3910 dbSNP
rs1311783330 3912 dbSNP
rs1055161146 3913 dbSNP
rs1165231527 3917 dbSNP
rs938077645 3927 dbSNP
rs1382792854 3929 dbSNP
rs1381787079 3931 dbSNP
rs1439038091 3938 dbSNP
rs1367333394 3939 dbSNP
rs115985232 3944 dbSNP
rs1314063383 3948 dbSNP
rs866290516 3949 dbSNP
rs1246460292 3950 dbSNP
rs989942676 3952 dbSNP
rs76637247 3953 dbSNP
rs908401115 3965 dbSNP
rs1263004805 3971 dbSNP
rs983971222 3975 dbSNP
rs879875996 3977 dbSNP
rs952687732 3980 dbSNP
rs1028388064 3981 dbSNP
rs1445621610 3983 dbSNP
rs115557799 3984 dbSNP
rs567081319 3990 dbSNP
rs965492174 4005 dbSNP
rs1019340036 4006 dbSNP
rs1453123225 4008 dbSNP
rs998608740 4011 dbSNP
rs1180097866 4014 dbSNP
rs1452248550 4022 dbSNP
rs1251828453 4027 dbSNP
rs1198955241 4029 dbSNP
rs1453769683 4038 dbSNP
rs955347393 4038 dbSNP
rs902660771 4041 dbSNP
rs1383170364 4048 dbSNP
rs1423260282 4054 dbSNP
rs1397635183 4055 dbSNP
rs1304383792 4063 dbSNP
rs1334843145 4067 dbSNP
rs1282793041 4071 dbSNP
rs993867353 4081 dbSNP
rs898213003 4083 dbSNP
rs7020585 4090 dbSNP
rs1011562878 4093 dbSNP
rs1184014552 4107 dbSNP
rs1354831076 4108 dbSNP
rs752354367 4113 dbSNP
rs539559360 4115 dbSNP
rs767199260 4118 dbSNP
rs568999806 4121 dbSNP
rs550532062 4122 dbSNP
rs938060963 4126 dbSNP
rs1232357893 4132 dbSNP
rs371697282 4134 dbSNP
rs1370619808 4138 dbSNP
rs1479501031 4159 dbSNP
rs906553216 4176 dbSNP
rs1175615388 4178 dbSNP
rs1406815081 4178 dbSNP
rs1467359847 4187 dbSNP
rs1046439662 4195 dbSNP
rs902775932 4196 dbSNP
rs1042755898 4208 dbSNP
rs1289836988 4215 dbSNP
rs1343088488 4219 dbSNP
rs1222429634 4224 dbSNP
rs1438720266 4230 dbSNP
rs1332707193 4232 dbSNP
rs528919235 4234 dbSNP
rs1480518796 4238 dbSNP
rs1206056476 4242 dbSNP
rs1254329250 4247 dbSNP
rs1479491185 4252 dbSNP
rs1419074484 4253 dbSNP
rs915294239 4254 dbSNP
rs1360911617 4264 dbSNP
rs140548707 4270 dbSNP
rs370076085 4270 dbSNP
rs908367142 4280 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |:| || 
Target 5' gcagugagccgagauCGCGCCa 3'
11 - 32
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000423591.1 | 3UTR | GGUGGAGGUUGCAGUGAGCCGAGAUCGCGCCAUUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*