miRTarBase - #MIRT673737 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TCF23   
Synonyms OUT, TCF-23, bHLHa24
Description transcription factor 23
Transcript NM_175769   
Expression
Putative miRNA Targets on TCF23
3'UTR of TCF23
(miRNA target sites are highlighted)
>TCF23|NM_175769|3'UTR
   1 TTATCACACTCGCCCTTTTCTCCTAGACTGTGACTCATGCTTATGGGCCTGGATTTTCTACCAGCCCCCAGATTCTCAGC
  81 CATC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugugguAACAGUGUGAGgu 5'
                   || ||||||||  
Target 5' ---------TTATCACACTCgc 3'
1 - 13 137.00 -11.80
2
miRNA  3' guuUGUGGUAAC--AGUGUGAGgu 5'
             | ||:: ||  |||::||:  
Target 5' cctAGACTG-TGACTCATGCTTat 3'
22 - 44 88.00 -5.10
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:| ||     || |:||: 
Target 5' ccAGCCCC-----CAGATTCTc 3'
61 - 77 83.00 -6.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27330997 669 COSMIC
COSN32062217 669 COSMIC
COSN7243637 670 COSMIC
COSN1834533 892 COSMIC
COSN22597703 900 COSMIC
COSN4803608 1176 COSMIC
COSN16561734 1617 COSMIC
COSN25572003 1760 COSMIC
COSN26517331 2078 COSMIC
COSN24935517 2134 COSMIC
COSN25903185 2237 COSMIC
COSN24911691 2340 COSMIC
COSN9369064 2820 COSMIC
COSN16036690 2829 COSMIC
COSN7243638 3286 COSMIC
COSN9998204 3588 COSMIC
COSN26753555 3763 COSMIC
COSN9369065 3930 COSMIC
COSN21186006 4019 COSMIC
COSN24997474 4091 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765424459 1 dbSNP
rs967921869 8 dbSNP
rs750404362 12 dbSNP
rs763569309 13 dbSNP
rs1393698367 15 dbSNP
rs1193378875 16 dbSNP
rs1244419706 16 dbSNP
rs766945109 17 dbSNP
rs373302796 26 dbSNP
rs200195487 30 dbSNP
rs77788988 32 dbSNP
rs749054320 33 dbSNP
rs781392389 33 dbSNP
rs1269558929 35 dbSNP
rs1222265936 37 dbSNP
rs770825252 41 dbSNP
rs1179362647 42 dbSNP
rs371833017 44 dbSNP
rs777345663 45 dbSNP
rs1163649767 46 dbSNP
rs929097236 47 dbSNP
rs1459796102 49 dbSNP
rs959358122 59 dbSNP
rs887453794 63 dbSNP
rs941594544 65 dbSNP
rs1294958227 67 dbSNP
rs1013251769 68 dbSNP
rs1039046354 69 dbSNP
rs1326535363 78 dbSNP
rs905470649 89 dbSNP
rs1358024843 114 dbSNP
rs1374161468 118 dbSNP
rs1002772132 119 dbSNP
rs561663589 120 dbSNP
rs182503007 121 dbSNP
rs971655988 129 dbSNP
rs971946968 133 dbSNP
rs558273508 152 dbSNP
rs1185025453 158 dbSNP
rs1293798550 159 dbSNP
rs919080152 161 dbSNP
rs147834205 162 dbSNP
rs1009661619 163 dbSNP
rs1242478155 170 dbSNP
rs374255240 173 dbSNP
rs984504377 187 dbSNP
rs1195396432 196 dbSNP
rs910223682 200 dbSNP
rs1440692185 204 dbSNP
rs1279524165 206 dbSNP
rs1486347477 209 dbSNP
rs1211431582 214 dbSNP
rs35499496 215 dbSNP
rs1231792083 217 dbSNP
rs1349813631 220 dbSNP
rs141315442 234 dbSNP
rs979479090 238 dbSNP
rs1383462565 263 dbSNP
rs1271490504 265 dbSNP
rs1041037441 269 dbSNP
rs1354196630 280 dbSNP
rs1444043406 290 dbSNP
rs1164794021 291 dbSNP
rs1387685917 299 dbSNP
rs1377688364 311 dbSNP
rs923521619 327 dbSNP
rs547539046 330 dbSNP
rs1409661514 331 dbSNP
rs1420483558 343 dbSNP
rs945599240 346 dbSNP
rs923111618 349 dbSNP
rs1318143679 350 dbSNP
rs1188608435 360 dbSNP
rs185658808 361 dbSNP
rs529952487 365 dbSNP
rs904013875 366 dbSNP
rs1000988473 367 dbSNP
rs941675189 370 dbSNP
rs1055173599 375 dbSNP
rs113470370 387 dbSNP
rs1316491370 388 dbSNP
rs759971684 389 dbSNP
rs1333555137 391 dbSNP
rs905437477 395 dbSNP
rs1348532349 399 dbSNP
rs1223129052 403 dbSNP
rs938277065 405 dbSNP
rs13421825 407 dbSNP
rs1013564329 408 dbSNP
rs112397770 415 dbSNP
rs189629689 416 dbSNP
rs993815443 419 dbSNP
rs1241470152 421 dbSNP
rs1417297574 422 dbSNP
rs1021031295 426 dbSNP
rs1026145579 432 dbSNP
rs1001266350 437 dbSNP
rs1176486969 462 dbSNP
rs569981502 468 dbSNP
rs1461021042 471 dbSNP
rs146964019 480 dbSNP
rs1234347980 498 dbSNP
rs552409618 505 dbSNP
rs1211476777 509 dbSNP
rs1467731997 518 dbSNP
rs571571585 521 dbSNP
rs1469065671 525 dbSNP
rs530787801 531 dbSNP
rs538626035 535 dbSNP
rs964748179 536 dbSNP
rs975795504 541 dbSNP
rs1402755938 554 dbSNP
rs1281604386 558 dbSNP
rs768086095 566 dbSNP
rs1439044650 569 dbSNP
rs1404958317 570 dbSNP
rs1326739047 574 dbSNP
rs1452905402 582 dbSNP
rs534412583 583 dbSNP
rs922916139 586 dbSNP
rs368596385 595 dbSNP
rs1343451477 596 dbSNP
rs1158321125 619 dbSNP
rs950572691 620 dbSNP
rs1409946893 622 dbSNP
rs552687679 623 dbSNP
rs79462572 624 dbSNP
rs572197870 625 dbSNP
rs1352599010 627 dbSNP
rs1484617402 629 dbSNP
rs1221511616 630 dbSNP
rs1259584915 630 dbSNP
rs1215755580 631 dbSNP
rs200149597 633 dbSNP
rs1232545574 635 dbSNP
rs1288671017 635 dbSNP
rs200918898 636 dbSNP
rs1323168587 638 dbSNP
rs201451191 640 dbSNP
rs111812514 642 dbSNP
rs139640315 642 dbSNP
rs200042724 642 dbSNP
rs879203755 642 dbSNP
rs1260491043 643 dbSNP
rs1204485402 646 dbSNP
rs1280834107 654 dbSNP
rs756849192 658 dbSNP
rs10677208 660 dbSNP
rs1209286925 660 dbSNP
rs1265980353 660 dbSNP
rs963195644 660 dbSNP
rs1281444377 664 dbSNP
rs1352831814 665 dbSNP
rs371959918 665 dbSNP
rs770864790 665 dbSNP
rs1295021845 669 dbSNP
rs59891169 669 dbSNP
rs4508557 670 dbSNP
rs145910571 674 dbSNP
rs377580310 676 dbSNP
rs936788160 686 dbSNP
rs1375876927 695 dbSNP
rs926984951 700 dbSNP
rs1460203580 701 dbSNP
rs1055233649 708 dbSNP
rs938232365 713 dbSNP
rs767588103 715 dbSNP
rs536492258 718 dbSNP
rs750674408 720 dbSNP
rs554865607 727 dbSNP
rs1485614414 728 dbSNP
rs1042612592 731 dbSNP
rs1202533026 741 dbSNP
rs993433191 758 dbSNP
rs1026156873 763 dbSNP
rs887628018 774 dbSNP
rs1228361081 780 dbSNP
rs1320129174 783 dbSNP
rs1291476798 788 dbSNP
rs1282412811 799 dbSNP
rs1345837979 803 dbSNP
rs1005983477 805 dbSNP
rs1017371417 809 dbSNP
rs1336007306 810 dbSNP
rs1389465496 819 dbSNP
rs372465663 846 dbSNP
rs1395430360 847 dbSNP
rs1298416089 848 dbSNP
rs964519827 849 dbSNP
rs574269212 853 dbSNP
rs1391703061 863 dbSNP
rs1163555545 873 dbSNP
rs1337675280 887 dbSNP
rs541641520 888 dbSNP
rs1273794586 889 dbSNP
rs1419210036 892 dbSNP
rs1190146062 896 dbSNP
rs1030035915 899 dbSNP
rs1484358432 907 dbSNP
rs1220835281 912 dbSNP
rs1417724071 919 dbSNP
rs150950165 920 dbSNP
rs997365809 926 dbSNP
rs1459238592 927 dbSNP
rs1308799523 958 dbSNP
rs1271410794 968 dbSNP
rs1213136117 970 dbSNP
rs773362328 978 dbSNP
rs1335475685 985 dbSNP
rs1285897610 986 dbSNP
rs1236735234 988 dbSNP
rs1334983046 992 dbSNP
rs1030188448 994 dbSNP
rs760198982 997 dbSNP
rs1391823316 998 dbSNP
rs1004667541 999 dbSNP
rs1371035729 1007 dbSNP
rs1392191961 1011 dbSNP
rs1165537550 1023 dbSNP
rs1452219130 1038 dbSNP
rs1363632577 1040 dbSNP
rs1474860095 1042 dbSNP
rs565547102 1050 dbSNP
rs1168059234 1054 dbSNP
rs1016140499 1062 dbSNP
rs925496049 1064 dbSNP
rs1193179582 1069 dbSNP
rs936889701 1070 dbSNP
rs1203359824 1074 dbSNP
rs963423129 1082 dbSNP
rs1261154336 1084 dbSNP
rs1302425317 1101 dbSNP
rs1242049237 1105 dbSNP
rs1365983324 1106 dbSNP
rs576944898 1113 dbSNP
rs1302258973 1114 dbSNP
rs1406594195 1134 dbSNP
rs991015669 1136 dbSNP
rs541014560 1137 dbSNP
rs979886854 1142 dbSNP
rs926926608 1144 dbSNP
rs916728185 1147 dbSNP
rs763767074 1155 dbSNP
rs949537144 1157 dbSNP
rs1324970461 1161 dbSNP
rs559534150 1162 dbSNP
rs1393604891 1170 dbSNP
rs1046880905 1180 dbSNP
rs1226955124 1182 dbSNP
rs897163422 1187 dbSNP
rs529811404 1197 dbSNP
rs1270863512 1198 dbSNP
rs1248580894 1200 dbSNP
rs1191099761 1204 dbSNP
rs1446429363 1205 dbSNP
rs1344330481 1208 dbSNP
rs992521668 1214 dbSNP
rs548222659 1215 dbSNP
rs1291630961 1216 dbSNP
rs74494058 1220 dbSNP
rs777882784 1221 dbSNP
rs1212049961 1226 dbSNP
rs1346666668 1229 dbSNP
rs887716735 1234 dbSNP
rs560822127 1235 dbSNP
rs1326440637 1237 dbSNP
rs1017423993 1243 dbSNP
rs900329064 1245 dbSNP
rs1374069502 1246 dbSNP
rs1039137949 1248 dbSNP
rs1415318643 1255 dbSNP
rs997277343 1259 dbSNP
rs1275506 1261 dbSNP
rs1358260669 1263 dbSNP
rs1442186077 1264 dbSNP
rs997460785 1268 dbSNP
rs966415229 1276 dbSNP
rs1475135374 1282 dbSNP
rs1424367968 1289 dbSNP
rs977775678 1292 dbSNP
rs1228807592 1293 dbSNP
rs1051750834 1304 dbSNP
rs1459373105 1314 dbSNP
rs182316661 1334 dbSNP
rs886358481 1341 dbSNP
rs1270461486 1342 dbSNP
rs368097329 1347 dbSNP
rs1004762455 1354 dbSNP
rs1339518996 1357 dbSNP
rs1279505652 1360 dbSNP
rs1221056324 1375 dbSNP
rs958310503 1376 dbSNP
rs371172904 1380 dbSNP
rs1293135704 1385 dbSNP
rs770771428 1396 dbSNP
rs547381088 1398 dbSNP
rs575458412 1400 dbSNP
rs565688509 1403 dbSNP
rs1001796715 1407 dbSNP
rs916758774 1409 dbSNP
rs1401180238 1423 dbSNP
rs1172888664 1424 dbSNP
rs949551323 1428 dbSNP
rs1314432472 1429 dbSNP
rs140723821 1431 dbSNP
rs778739440 1439 dbSNP
rs1230923087 1450 dbSNP
rs1203427131 1454 dbSNP
rs982233954 1455 dbSNP
rs918645642 1458 dbSNP
rs555012661 1462 dbSNP
rs1048408959 1463 dbSNP
rs1259338057 1465 dbSNP
rs1229347434 1468 dbSNP
rs1381841601 1469 dbSNP
rs576584765 1471 dbSNP
rs1205376766 1474 dbSNP
rs537630854 1485 dbSNP
rs1377918909 1489 dbSNP
rs1333531455 1491 dbSNP
rs959810882 1502 dbSNP
rs1393766700 1503 dbSNP
rs1249559176 1505 dbSNP
rs992491938 1507 dbSNP
rs1405583181 1513 dbSNP
rs1176398530 1518 dbSNP
rs1439997118 1519 dbSNP
rs1239626216 1527 dbSNP
rs1019964958 1537 dbSNP
rs1182514970 1559 dbSNP
rs966918476 1578 dbSNP
rs1265478794 1579 dbSNP
rs1243200328 1587 dbSNP
rs909876342 1591 dbSNP
rs941990042 1611 dbSNP
rs1324009952 1613 dbSNP
rs1039322800 1622 dbSNP
rs1206698962 1630 dbSNP
rs374760794 1633 dbSNP
rs900341083 1635 dbSNP
rs997729041 1638 dbSNP
rs373205113 1640 dbSNP
rs1370393478 1641 dbSNP
rs1156764575 1651 dbSNP
rs1363045564 1657 dbSNP
rs577603215 1659 dbSNP
rs1343362178 1662 dbSNP
rs936837487 1665 dbSNP
rs1454080028 1670 dbSNP
rs780641374 1677 dbSNP
rs187931821 1678 dbSNP
rs1453395229 1681 dbSNP
rs1391161965 1684 dbSNP
rs553009893 1686 dbSNP
rs933448524 1689 dbSNP
rs574446916 1691 dbSNP
rs886453377 1692 dbSNP
rs1216460325 1694 dbSNP
rs750145073 1695 dbSNP
rs1288561555 1703 dbSNP
rs1232431158 1719 dbSNP
rs1311814748 1720 dbSNP
rs543341501 1730 dbSNP
rs1037604684 1731 dbSNP
rs541577278 1742 dbSNP
rs1398338389 1744 dbSNP
rs1359886963 1745 dbSNP
rs1012512462 1746 dbSNP
rs1024280482 1752 dbSNP
rs745598394 1756 dbSNP
rs1240254428 1757 dbSNP
rs1310827481 1759 dbSNP
rs1433782779 1769 dbSNP
rs982708884 1772 dbSNP
rs758213696 1773 dbSNP
rs775027394 1782 dbSNP
rs1426239026 1789 dbSNP
rs1418113055 1791 dbSNP
rs1193624208 1792 dbSNP
rs563373661 1793 dbSNP
rs895528163 1799 dbSNP
rs1252031880 1801 dbSNP
rs116392875 1809 dbSNP
rs909887619 1817 dbSNP
rs978859073 1818 dbSNP
rs1483926351 1821 dbSNP
rs1032583854 1831 dbSNP
rs1305871791 1836 dbSNP
rs1175438405 1842 dbSNP
rs942669293 1847 dbSNP
rs1249795705 1853 dbSNP
rs1277614493 1857 dbSNP
rs1038963540 1864 dbSNP
rs1219229585 1868 dbSNP
rs1419571144 1872 dbSNP
rs1342283511 1874 dbSNP
rs958568657 1883 dbSNP
rs921820811 1884 dbSNP
rs933240178 1885 dbSNP
rs974937935 1904 dbSNP
rs1402580586 1911 dbSNP
rs1184160351 1917 dbSNP
rs933376379 1928 dbSNP
rs1426927633 1936 dbSNP
rs894553056 1943 dbSNP
rs1296781900 1944 dbSNP
rs1360202950 1945 dbSNP
rs987532556 1946 dbSNP
rs1052066802 1954 dbSNP
rs1479785960 1957 dbSNP
rs907987383 1967 dbSNP
rs75044493 1971 dbSNP
rs1038140251 1975 dbSNP
rs1249427592 1976 dbSNP
rs564083996 1977 dbSNP
rs1467690132 1979 dbSNP
rs1484123048 1989 dbSNP
rs1053499945 2000 dbSNP
rs937295507 2006 dbSNP
rs893491187 2013 dbSNP
rs528373354 2017 dbSNP
rs769116281 2019 dbSNP
rs369867438 2020 dbSNP
rs1410958192 2027 dbSNP
rs115590878 2028 dbSNP
rs1003788070 2029 dbSNP
rs1270072210 2031 dbSNP
rs377262036 2032 dbSNP
rs1020020802 2038 dbSNP
rs1398093803 2039 dbSNP
rs1383993642 2051 dbSNP
rs1336561615 2055 dbSNP
rs1468685700 2056 dbSNP
rs951511969 2059 dbSNP
rs984178861 2066 dbSNP
rs909941990 2068 dbSNP
rs964032684 2069 dbSNP
rs975843646 2074 dbSNP
rs1425260881 2075 dbSNP
rs1313569604 2079 dbSNP
rs999829111 2088 dbSNP
rs1201877371 2089 dbSNP
rs922620828 2091 dbSNP
rs933272584 2103 dbSNP
rs1249855693 2109 dbSNP
rs1205740742 2114 dbSNP
rs1033092677 2123 dbSNP
rs1480952459 2130 dbSNP
rs958309660 2131 dbSNP
rs1239559199 2138 dbSNP
rs1247253700 2140 dbSNP
rs769848845 2144 dbSNP
rs1029101939 2153 dbSNP
rs923775774 2157 dbSNP
rs1367920386 2162 dbSNP
rs987613729 2167 dbSNP
rs1479959663 2173 dbSNP
rs907933243 2179 dbSNP
rs1199850959 2181 dbSNP
rs962442538 2184 dbSNP
rs973426957 2185 dbSNP
rs935121037 2194 dbSNP
rs1053550196 2195 dbSNP
rs1391878178 2202 dbSNP
rs920626997 2206 dbSNP
rs893581218 2211 dbSNP
rs1259727238 2233 dbSNP
rs1372513361 2234 dbSNP
rs947818827 2236 dbSNP
rs530076058 2237 dbSNP
rs1244174147 2238 dbSNP
rs1344770884 2240 dbSNP
rs1310351572 2245 dbSNP
rs1271213977 2249 dbSNP
rs1364128279 2252 dbSNP
rs1045165651 2254 dbSNP
rs1315579110 2260 dbSNP
rs1404777638 2263 dbSNP
rs115303008 2269 dbSNP
rs1004207565 2270 dbSNP
rs372930025 2287 dbSNP
rs1422446145 2303 dbSNP
rs1421384666 2306 dbSNP
rs1025819424 2313 dbSNP
rs570120610 2320 dbSNP
rs1371304997 2328 dbSNP
rs1294247848 2331 dbSNP
rs902893984 2336 dbSNP
rs1268373686 2339 dbSNP
rs1000390599 2340 dbSNP
rs1484195371 2342 dbSNP
rs1005652892 2343 dbSNP
rs112050287 2344 dbSNP
rs899523432 2346 dbSNP
rs996545888 2347 dbSNP
rs1402705727 2350 dbSNP
rs559192321 2353 dbSNP
rs964131080 2357 dbSNP
rs954968322 2364 dbSNP
rs1008981915 2365 dbSNP
rs1026970792 2367 dbSNP
rs1223034455 2379 dbSNP
rs975519865 2390 dbSNP
rs571014167 2392 dbSNP
rs1470304769 2394 dbSNP
rs1030078117 2399 dbSNP
rs1184929762 2400 dbSNP
rs1197429534 2408 dbSNP
rs1233702274 2420 dbSNP
rs1418939152 2420 dbSNP
rs191865531 2423 dbSNP
rs1436447401 2427 dbSNP
rs1170543321 2439 dbSNP
rs1383969938 2445 dbSNP
rs987806108 2448 dbSNP
rs1424581730 2452 dbSNP
rs1204860387 2455 dbSNP
rs184056843 2456 dbSNP
rs1261941614 2466 dbSNP
rs917136244 2470 dbSNP
rs552548762 2472 dbSNP
rs1333770303 2475 dbSNP
rs989339499 2476 dbSNP
rs1470239085 2479 dbSNP
rs915072722 2484 dbSNP
rs1287874683 2491 dbSNP
rs947837208 2494 dbSNP
rs1408917030 2498 dbSNP
rs1044783111 2499 dbSNP
rs1468859770 2500 dbSNP
rs1245342374 2505 dbSNP
rs924472404 2510 dbSNP
rs1436695727 2519 dbSNP
rs1461237217 2520 dbSNP
rs935749336 2521 dbSNP
rs1312271940 2524 dbSNP
rs1318209727 2525 dbSNP
rs906200557 2532 dbSNP
rs939003360 2533 dbSNP
rs1348166658 2534 dbSNP
rs116023076 2538 dbSNP
rs556816958 2539 dbSNP
rs1453149433 2540 dbSNP
rs866771666 2548 dbSNP
rs1291762604 2560 dbSNP
rs868735443 2561 dbSNP
rs1317795790 2576 dbSNP
rs113898045 2577 dbSNP
rs575292318 2581 dbSNP
rs1387359632 2582 dbSNP
rs1164563324 2584 dbSNP
rs1444419814 2596 dbSNP
rs899958693 2598 dbSNP
rs2009249 2599 dbSNP
rs1167771476 2602 dbSNP
rs1213948254 2609 dbSNP
rs1009138494 2613 dbSNP
rs1214512125 2621 dbSNP
rs1487083496 2623 dbSNP
rs1293525422 2625 dbSNP
rs1246368780 2626 dbSNP
rs1358474406 2632 dbSNP
rs1312736689 2633 dbSNP
rs1216243980 2639 dbSNP
rs997346993 2640 dbSNP
rs1029717117 2642 dbSNP
rs955574843 2645 dbSNP
rs998888264 2648 dbSNP
rs1031662686 2649 dbSNP
rs1444578303 2653 dbSNP
rs898011218 2654 dbSNP
rs956644995 2658 dbSNP
rs1429602829 2662 dbSNP
rs1419470737 2665 dbSNP
rs989396671 2666 dbSNP
rs150076930 2669 dbSNP
rs1476565012 2670 dbSNP
rs1399368736 2674 dbSNP
rs1158796592 2682 dbSNP
rs1222768770 2691 dbSNP
rs1490101530 2696 dbSNP
rs528526803 2696 dbSNP
rs969216108 2696 dbSNP
rs753928856 2698 dbSNP
rs927712755 2707 dbSNP
rs939080448 2715 dbSNP
rs1206413001 2732 dbSNP
rs958824037 2735 dbSNP
rs1458475980 2736 dbSNP
rs991447493 2742 dbSNP
rs1334135299 2752 dbSNP
rs1284074237 2756 dbSNP
rs1381315973 2758 dbSNP
rs1046744117 2763 dbSNP
rs1343921026 2773 dbSNP
rs1300227394 2775 dbSNP
rs908215453 2776 dbSNP
rs1024349851 2785 dbSNP
rs1354408679 2787 dbSNP
rs1168962021 2788 dbSNP
rs1471282819 2797 dbSNP
rs1285828744 2799 dbSNP
rs941618223 2803 dbSNP
rs563948649 2804 dbSNP
rs1264866903 2812 dbSNP
rs528235668 2828 dbSNP
rs997000120 2829 dbSNP
rs1250622277 2831 dbSNP
rs540156328 2837 dbSNP
rs1325651929 2843 dbSNP
rs977362003 2844 dbSNP
rs866907755 2847 dbSNP
rs1223022135 2850 dbSNP
rs4640347 2851 dbSNP
rs2004455 2852 dbSNP
rs1309443653 2855 dbSNP
rs998929518 2858 dbSNP
rs1373054438 2863 dbSNP
rs561627936 2864 dbSNP
rs1268525399 2871 dbSNP
rs369889097 2872 dbSNP
rs1455032535 2873 dbSNP
rs1407523295 2874 dbSNP
rs935805681 2874 dbSNP
rs1468852836 2875 dbSNP
rs1375510350 2881 dbSNP
rs1330148546 2883 dbSNP
rs1160846603 2884 dbSNP
rs990008956 2885 dbSNP
rs1176591774 2889 dbSNP
rs920974857 2889 dbSNP
rs932443617 2889 dbSNP
rs1050711175 2894 dbSNP
rs563838456 2894 dbSNP
rs1431648568 2896 dbSNP
rs1188305963 2900 dbSNP
rs1031718637 2904 dbSNP
rs890820605 2904 dbSNP
rs1316604928 2909 dbSNP
rs1307490825 2923 dbSNP
rs1469046890 2924 dbSNP
rs75643667 2927 dbSNP
rs1384121549 2929 dbSNP
rs1036998280 2941 dbSNP
rs1394877190 2948 dbSNP
rs1399427292 2949 dbSNP
rs1010838895 2960 dbSNP
rs1453974254 2961 dbSNP
rs1473369797 2962 dbSNP
rs540710363 2970 dbSNP
rs1446245769 2973 dbSNP
rs1404745295 2974 dbSNP
rs969647329 2982 dbSNP
rs1182909762 2985 dbSNP
rs1440690506 2990 dbSNP
rs980654426 2997 dbSNP
rs78694483 3003 dbSNP
rs116616760 3013 dbSNP
rs1485642719 3016 dbSNP
rs1284175782 3027 dbSNP
rs982456647 3040 dbSNP
rs1360619518 3041 dbSNP
rs1314871988 3049 dbSNP
rs1243236033 3050 dbSNP
rs1352762396 3054 dbSNP
rs1328754388 3056 dbSNP
rs1297052845 3059 dbSNP
rs1315869794 3072 dbSNP
rs908225396 3080 dbSNP
rs894560257 3082 dbSNP
rs531040029 3086 dbSNP
rs1352031394 3091 dbSNP
rs1426237952 3092 dbSNP
rs552666241 3096 dbSNP
rs1013037907 3098 dbSNP
rs1281560856 3101 dbSNP
rs1344542068 3102 dbSNP
rs1201173287 3112 dbSNP
rs1024297416 3116 dbSNP
rs1261217060 3121 dbSNP
rs138945095 3124 dbSNP
rs751518900 3138 dbSNP
rs1291471868 3143 dbSNP
rs977435540 3155 dbSNP
rs1433066293 3162 dbSNP
rs921551635 3167 dbSNP
rs1342033035 3172 dbSNP
rs1252426768 3173 dbSNP
rs1031974995 3197 dbSNP
rs1275823624 3202 dbSNP
rs1204987660 3206 dbSNP
rs535204387 3212 dbSNP
rs1345802399 3216 dbSNP
rs1398474827 3223 dbSNP
rs990389292 3223 dbSNP
rs1168430785 3224 dbSNP
rs1197681262 3225 dbSNP
rs547903076 3228 dbSNP
rs188214019 3229 dbSNP
rs377515068 3230 dbSNP
rs1480866151 3232 dbSNP
rs1268479137 3234 dbSNP
rs986537841 3240 dbSNP
rs1439930002 3262 dbSNP
rs1251779916 3265 dbSNP
rs1173882134 3270 dbSNP
rs1195722653 3276 dbSNP
rs1316652429 3278 dbSNP
rs998945554 3286 dbSNP
rs912330413 3287 dbSNP
rs1416698168 3296 dbSNP
rs1409307637 3297 dbSNP
rs1053161532 3306 dbSNP
rs1308518705 3307 dbSNP
rs939659607 3314 dbSNP
rs893157016 3316 dbSNP
rs1329359051 3318 dbSNP
rs1011561725 3319 dbSNP
rs1023369625 3330 dbSNP
rs898030868 3332 dbSNP
rs1330798495 3341 dbSNP
rs1470354798 3349 dbSNP
rs1234163176 3358 dbSNP
rs1171039899 3364 dbSNP
rs1276691080 3373 dbSNP
rs568724776 3380 dbSNP
rs1233795102 3399 dbSNP
rs535150126 3404 dbSNP
rs1178458233 3436 dbSNP
rs930947927 3451 dbSNP
rs149443948 3455 dbSNP
rs1228340411 3456 dbSNP
rs1239190900 3459 dbSNP
rs1277385563 3459 dbSNP
rs1279888993 3459 dbSNP
rs1461383106 3459 dbSNP
rs770756000 3459 dbSNP
rs894673275 3461 dbSNP
rs1338634849 3463 dbSNP
rs1276030590 3475 dbSNP
rs575089978 3478 dbSNP
rs1220808171 3479 dbSNP
rs1267096361 3483 dbSNP
rs1019448150 3484 dbSNP
rs1045821779 3494 dbSNP
rs1402639552 3495 dbSNP
rs1200467436 3497 dbSNP
rs907295954 3499 dbSNP
rs1438239438 3509 dbSNP
rs1239892059 3513 dbSNP
rs367924905 3513 dbSNP
rs1184750073 3514 dbSNP
rs999224405 3515 dbSNP
rs1031712463 3517 dbSNP
rs1168650879 3520 dbSNP
rs1207462569 3522 dbSNP
rs1392017663 3523 dbSNP
rs72810784 3528 dbSNP
rs34244070 3531 dbSNP
rs1215546869 3534 dbSNP
rs1351237599 3534 dbSNP
rs1316977585 3536 dbSNP
rs1162445515 3539 dbSNP
rs1011523199 3542 dbSNP
rs1391095745 3545 dbSNP
rs1282464210 3553 dbSNP
rs1345952173 3554 dbSNP
rs1387591871 3561 dbSNP
rs1418175025 3564 dbSNP
rs1325716853 3565 dbSNP
rs1164664479 3568 dbSNP
rs1423710562 3571 dbSNP
rs1412302940 3572 dbSNP
rs1179554416 3573 dbSNP
rs1028556533 3575 dbSNP
rs1192472174 3580 dbSNP
rs1263365824 3580 dbSNP
rs1487134150 3581 dbSNP
rs1324885043 3585 dbSNP
rs1434511244 3586 dbSNP
rs953857955 3591 dbSNP
rs1298421124 3593 dbSNP
rs986608045 3596 dbSNP
rs1216336181 3606 dbSNP
rs1362746321 3608 dbSNP
rs1244349227 3611 dbSNP
rs193192660 3612 dbSNP
rs1357449456 3614 dbSNP
rs866914340 3615 dbSNP
rs1348585673 3630 dbSNP
rs1173164846 3631 dbSNP
rs1411080064 3632 dbSNP
rs1423702953 3636 dbSNP
rs34730887 3637 dbSNP
rs919635224 3640 dbSNP
rs1188704409 3643 dbSNP
rs930877074 3651 dbSNP
rs1488038241 3655 dbSNP
rs921134982 3657 dbSNP
rs1442706572 3660 dbSNP
rs1206522590 3663 dbSNP
rs1186697176 3665 dbSNP
rs1257469122 3666 dbSNP
rs1216907493 3668 dbSNP
rs1368851182 3669 dbSNP
rs1459292358 3670 dbSNP
rs1156558616 3672 dbSNP
rs1386815995 3673 dbSNP
rs1300325031 3676 dbSNP
rs1169286672 3678 dbSNP
rs1346591336 3678 dbSNP
rs759423403 3678 dbSNP
rs1456905218 3684 dbSNP
rs1321319881 3693 dbSNP
rs957792147 3694 dbSNP
rs989662786 3696 dbSNP
rs1422776804 3697 dbSNP
rs1312571801 3701 dbSNP
rs1341574270 3702 dbSNP
rs1247497696 3703 dbSNP
rs1259318230 3705 dbSNP
rs1237516155 3706 dbSNP
rs1328062183 3710 dbSNP
rs1462711177 3712 dbSNP
rs916182117 3714 dbSNP
rs540025104 3720 dbSNP
rs1309555518 3722 dbSNP
rs948833838 3722 dbSNP
rs1459549733 3724 dbSNP
rs1045937206 3730 dbSNP
rs1329913796 3737 dbSNP
rs868376548 3741 dbSNP
rs1403708652 3747 dbSNP
rs905138556 3755 dbSNP
rs1302974805 3756 dbSNP
rs1465207842 3758 dbSNP
rs1256823784 3759 dbSNP
rs1002523321 3763 dbSNP
rs1440088187 3763 dbSNP
rs184149178 3766 dbSNP
rs960493280 3767 dbSNP
rs1176695276 3771 dbSNP
rs982508717 3772 dbSNP
rs1015272573 3773 dbSNP
rs573877007 3774 dbSNP
rs544132074 3800 dbSNP
rs563714087 3802 dbSNP
rs530780285 3804 dbSNP
rs920918808 3807 dbSNP
rs932955446 3809 dbSNP
rs1053516630 3815 dbSNP
rs1307609247 3816 dbSNP
rs987421848 3817 dbSNP
rs893160803 3818 dbSNP
rs1012009734 3819 dbSNP
rs1403611451 3821 dbSNP
rs1398244714 3826 dbSNP
rs187265756 3832 dbSNP
rs191356095 3833 dbSNP
rs1376443431 3838 dbSNP
rs1299653483 3841 dbSNP
rs1420003218 3844 dbSNP
rs1007975666 3856 dbSNP
rs377465176 3862 dbSNP
rs1156663707 3873 dbSNP
rs1228645744 3874 dbSNP
rs1053213932 3875 dbSNP
rs893250238 3889 dbSNP
rs1186859937 3893 dbSNP
rs1422138476 3894 dbSNP
rs947441435 3898 dbSNP
rs1194644294 3910 dbSNP
rs1488116473 3928 dbSNP
rs972536616 3929 dbSNP
rs1320929428 3930 dbSNP
rs1044437794 3932 dbSNP
rs528734812 3939 dbSNP
rs905857241 3952 dbSNP
rs781097544 3955 dbSNP
rs1035319426 3964 dbSNP
rs1357606857 3968 dbSNP
rs896340674 3981 dbSNP
rs1004025318 3984 dbSNP
rs547210071 3991 dbSNP
rs867264346 3993 dbSNP
rs568511921 3998 dbSNP
rs974224230 3999 dbSNP
rs536155142 4003 dbSNP
rs953810960 4005 dbSNP
rs1388312681 4006 dbSNP
rs987085273 4007 dbSNP
rs948990134 4021 dbSNP
rs1456386130 4023 dbSNP
rs745483390 4029 dbSNP
rs550957273 4030 dbSNP
rs1477596645 4038 dbSNP
rs1414519538 4039 dbSNP
rs1431654719 4050 dbSNP
rs533456770 4056 dbSNP
rs912797173 4062 dbSNP
rs1267180367 4065 dbSNP
rs934723891 4068 dbSNP
rs568855074 4069 dbSNP
rs1468057764 4082 dbSNP
rs1259393758 4093 dbSNP
rs1306664341 4096 dbSNP
rs1370458162 4104 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:||| |   :|||||| 
Target 5' aucACGCCACU---GCACUCC- 3'
19 - 36
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000296096.5 | 3UTR | AGGUUGCAGUGAGCCAAGAUCACGCCACUGCACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*