Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT673171 [miRNA, hsa-miR-122-5p :: TMEM56, target gene]
miRTarBase - #MIRT673171 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMEM56   
Synonyms -
Description transmembrane protein 56
Transcript NM_152487   
Putative miRNA Targets on TMEM56
3'UTR of TMEM56
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            |:| : :|||||     ::|||||| 
374 - 401 136.00 -15.40
            |||| :::|||| ::|||||: 
705 - 728 136.00 -11.40
            ||:|: :| || |:|::|||| 
1216 - 1239 128.00 -7.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5745588 16 COSMIC
COSN31781976 45 COSMIC
COSN31581318 72 COSMIC
COSN8638906 83 COSMIC
COSN30506035 88 COSMIC
COSN20040306 129 COSMIC
COSN20040307 129 COSMIC
COSN23052335 293 COSMIC
COSN28196229 539 COSMIC
COSN4753547 609 COSMIC
COSN25434724 706 COSMIC
COSN28316956 894 COSMIC
COSN20095063 928 COSMIC
COSN1464242 1117 COSMIC
COSN21635657 1222 COSMIC
COSN1110419 1289 COSMIC
COSN6473896 1347 COSMIC
COSN24449460 1543 COSMIC
COSN4753548 1636 COSMIC
COSN6953275 2077 COSMIC
COSN29213195 2100 COSMIC
COSN29296751 2159 COSMIC
COSN28201511 2592 COSMIC
COSN20095069 2602 COSMIC
COSN6473897 3133 COSMIC
COSN6473898 3498 COSMIC
COSN6953276 3743 COSMIC
COSN27124283 3749 COSMIC
COSN6473899 3777 COSMIC
COSN8522278 3903 COSMIC
COSN21074572 3929 COSMIC
COSN23843373 4029 COSMIC
COSN16317742 4113 COSMIC
COSN1464243 4245 COSMIC
COSN10056652 5725 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752890074 5 dbSNP
rs866280876 12 dbSNP
rs564178331 13 dbSNP
rs191852720 14 dbSNP
rs760105294 22 dbSNP
rs766279115 23 dbSNP
rs753701254 28 dbSNP
rs755010531 30 dbSNP
rs1262296070 33 dbSNP
rs764984616 36 dbSNP
rs367661408 39 dbSNP
rs1416113152 43 dbSNP
rs757420134 46 dbSNP
rs1164428619 51 dbSNP
rs1417015633 55 dbSNP
rs1471120155 56 dbSNP
rs1316794584 68 dbSNP
rs1044725889 70 dbSNP
rs935350107 74 dbSNP
rs927109782 77 dbSNP
rs938545744 79 dbSNP
rs1211198961 81 dbSNP
rs1352467486 86 dbSNP
rs1281545328 87 dbSNP
rs144904166 94 dbSNP
rs917899926 98 dbSNP
rs1271425696 119 dbSNP
rs948203220 121 dbSNP
rs1414670465 129 dbSNP
rs566848217 133 dbSNP
rs765700032 136 dbSNP
rs746448421 139 dbSNP
rs1233033116 144 dbSNP
rs529416684 151 dbSNP
rs1486504861 152 dbSNP
rs996040183 157 dbSNP
rs1010069200 158 dbSNP
rs1164181421 159 dbSNP
rs1042357398 165 dbSNP
rs1474164412 190 dbSNP
rs1260842182 191 dbSNP
rs1419789383 194 dbSNP
rs1047363962 202 dbSNP
rs574083215 203 dbSNP
rs1217467369 205 dbSNP
rs903865303 206 dbSNP
rs1288477510 207 dbSNP
rs770397776 209 dbSNP
rs1001106985 215 dbSNP
rs1333251766 223 dbSNP
rs373312296 226 dbSNP
rs773785099 227 dbSNP
rs1452676690 229 dbSNP
rs1361678383 236 dbSNP
rs1008470478 239 dbSNP
rs568018618 240 dbSNP
rs532486973 245 dbSNP
rs1345898434 246 dbSNP
rs1325250833 247 dbSNP
rs1395944944 255 dbSNP
rs1008439593 256 dbSNP
rs1018644556 258 dbSNP
rs1436870998 260 dbSNP
rs1019799002 269 dbSNP
rs1384779414 274 dbSNP
rs1475509100 274 dbSNP
rs1245635809 283 dbSNP
rs995973304 286 dbSNP
rs1469413902 287 dbSNP
rs1275660676 288 dbSNP
rs552681128 292 dbSNP
rs556675625 293 dbSNP
rs1026628616 304 dbSNP
rs1368058428 305 dbSNP
rs1439557788 307 dbSNP
rs1302774768 313 dbSNP
rs570489449 324 dbSNP
rs1349577603 325 dbSNP
rs1326542187 338 dbSNP
rs967907975 342 dbSNP
rs776520065 346 dbSNP
rs1259927377 356 dbSNP
rs979973851 357 dbSNP
rs927245508 358 dbSNP
rs543183946 363 dbSNP
rs1467161779 364 dbSNP
rs956647022 365 dbSNP
rs992581611 368 dbSNP
rs992036581 374 dbSNP
rs1487325065 377 dbSNP
rs913064606 384 dbSNP
rs539461005 388 dbSNP
rs945451689 392 dbSNP
rs1308443155 393 dbSNP
rs1253747751 396 dbSNP
rs948017523 410 dbSNP
rs1304191975 411 dbSNP
rs1201308226 413 dbSNP
rs1371002517 414 dbSNP
rs1299806605 422 dbSNP
rs748251698 422 dbSNP
rs1374599672 428 dbSNP
rs1363522457 430 dbSNP
rs1046704535 431 dbSNP
rs1419009988 431 dbSNP
rs200878295 431 dbSNP
rs76251821 432 dbSNP
rs1249119313 438 dbSNP
rs919982569 442 dbSNP
rs1047291454 444 dbSNP
rs74520559 444 dbSNP
rs931513422 444 dbSNP
rs1454631817 446 dbSNP
rs903841354 450 dbSNP
rs1350251390 456 dbSNP
rs1160752118 459 dbSNP
rs936702192 469 dbSNP
rs944309652 482 dbSNP
rs1309120397 483 dbSNP
rs1041311063 484 dbSNP
rs901517059 486 dbSNP
rs1416263852 488 dbSNP
rs766228687 493 dbSNP
rs1325964619 498 dbSNP
rs1028758903 501 dbSNP
rs1372627742 508 dbSNP
rs1365008492 512 dbSNP
rs1161965573 524 dbSNP
rs17113161 536 dbSNP
rs1417607729 538 dbSNP
rs1186174337 547 dbSNP
rs1008495075 552 dbSNP
rs759517282 560 dbSNP
rs1486855127 564 dbSNP
rs528227090 591 dbSNP
rs1019767826 598 dbSNP
rs547991488 600 dbSNP
rs1030833303 602 dbSNP
rs1271143522 602 dbSNP
rs897335394 609 dbSNP
rs1334002110 611 dbSNP
rs369559530 611 dbSNP
rs564471556 611 dbSNP
rs993914774 618 dbSNP
rs573183603 626 dbSNP
rs1294467749 627 dbSNP
rs541610051 627 dbSNP
rs1025274806 632 dbSNP
rs1489511987 643 dbSNP
rs1194229822 645 dbSNP
rs969434619 651 dbSNP
rs1250111763 658 dbSNP
rs555581167 660 dbSNP
rs1419994411 668 dbSNP
rs1184761235 670 dbSNP
rs981151842 677 dbSNP
rs1416200979 678 dbSNP
rs575637589 679 dbSNP
rs1163380059 683 dbSNP
rs1476417588 687 dbSNP
rs1369378019 689 dbSNP
rs919926503 690 dbSNP
rs1426914641 693 dbSNP
rs1263965426 697 dbSNP
rs1209368442 704 dbSNP
rs952403472 710 dbSNP
rs370067640 718 dbSNP
rs1166367036 721 dbSNP
rs1356838393 722 dbSNP
rs559548493 723 dbSNP
rs1395964123 728 dbSNP
rs1327759449 737 dbSNP
rs982861045 738 dbSNP
rs1439597395 744 dbSNP
rs908743423 746 dbSNP
rs1324515325 753 dbSNP
rs1297209298 760 dbSNP
rs1033977238 773 dbSNP
rs1391935286 784 dbSNP
rs1167646874 810 dbSNP
rs944154289 811 dbSNP
rs959914753 813 dbSNP
rs1189441389 814 dbSNP
rs1453919943 816 dbSNP
rs1251185771 825 dbSNP
rs992716735 835 dbSNP
rs900057003 836 dbSNP
rs1452051221 837 dbSNP
rs1193926591 847 dbSNP
rs931678579 847 dbSNP
rs1392812378 852 dbSNP
rs1341195036 860 dbSNP
rs564119132 861 dbSNP
rs567978671 864 dbSNP
rs1000606352 866 dbSNP
rs945892738 870 dbSNP
rs892305793 876 dbSNP
rs1323536276 877 dbSNP
rs1225356266 895 dbSNP
rs978194274 897 dbSNP
rs1390089426 899 dbSNP
rs372571932 909 dbSNP
rs397980884 922 dbSNP
rs67578551 922 dbSNP
rs74229032 923 dbSNP
rs200310773 928 dbSNP
rs1169510327 932 dbSNP
rs1481066751 936 dbSNP
rs1434299061 939 dbSNP
rs572997752 941 dbSNP
rs540250945 942 dbSNP
rs1255835639 947 dbSNP
rs183670322 948 dbSNP
rs1189188316 949 dbSNP
rs375784666 961 dbSNP
rs1416633040 962 dbSNP
rs969740637 972 dbSNP
rs936742023 973 dbSNP
rs189314491 975 dbSNP
rs1027438438 989 dbSNP
rs889805883 992 dbSNP
rs1209734525 995 dbSNP
rs1169109885 1001 dbSNP
rs1373212613 1002 dbSNP
rs1463185710 1007 dbSNP
rs550285386 1008 dbSNP
rs982872320 1014 dbSNP
rs908588296 1016 dbSNP
rs41309183 1019 dbSNP
rs115557123 1023 dbSNP
rs994775673 1025 dbSNP
rs530507867 1026 dbSNP
rs1373945261 1029 dbSNP
rs761536181 1030 dbSNP
rs932919126 1037 dbSNP
rs1415160555 1046 dbSNP
rs1048137964 1051 dbSNP
rs1407303850 1053 dbSNP
rs1156770093 1058 dbSNP
rs1314590471 1063 dbSNP
rs888152024 1076 dbSNP
rs10874907 1077 dbSNP
rs553075840 1078 dbSNP
rs766736706 1089 dbSNP
rs1213958933 1096 dbSNP
rs1387114283 1098 dbSNP
rs572976114 1099 dbSNP
rs1210366188 1107 dbSNP
rs1294943111 1110 dbSNP
rs1445957334 1115 dbSNP
rs1281476555 1117 dbSNP
rs1308215945 1157 dbSNP
rs1331767761 1168 dbSNP
rs1289517651 1180 dbSNP
rs936304769 1181 dbSNP
rs1353928580 1185 dbSNP
rs1230816736 1190 dbSNP
rs1448978975 1192 dbSNP
rs1052157351 1195 dbSNP
rs1033947789 1198 dbSNP
rs1458757333 1201 dbSNP
rs1389372617 1210 dbSNP
rs1347563696 1216 dbSNP
rs959716201 1224 dbSNP
rs1013277306 1236 dbSNP
rs1474131762 1241 dbSNP
rs1415662020 1251 dbSNP
rs147949107 1255 dbSNP
rs1014105908 1260 dbSNP
rs182383183 1266 dbSNP
rs1212073599 1283 dbSNP
rs1324934134 1284 dbSNP
rs905024208 1288 dbSNP
rs967235268 1304 dbSNP
rs978963643 1305 dbSNP
rs1194781134 1306 dbSNP
rs374987887 1315 dbSNP
rs1002564140 1317 dbSNP
rs546619512 1318 dbSNP
rs1213576394 1320 dbSNP
rs1292406384 1328 dbSNP
rs1333187860 1328 dbSNP
rs952691747 1330 dbSNP
rs566766943 1341 dbSNP
rs11165338 1347 dbSNP
rs911209060 1348 dbSNP
rs1325185906 1353 dbSNP
rs1171314082 1364 dbSNP
rs1394120554 1365 dbSNP
rs1434998575 1367 dbSNP
rs1351431062 1369 dbSNP
rs965481385 1369 dbSNP
rs976844017 1369 dbSNP
rs944050873 1370 dbSNP
rs1343286492 1375 dbSNP
rs1041290151 1380 dbSNP
rs918872747 1383 dbSNP
rs1193582924 1390 dbSNP
rs930243299 1391 dbSNP
rs1248823320 1393 dbSNP
rs544849237 1396 dbSNP
rs1307272107 1400 dbSNP
rs575426194 1401 dbSNP
rs1232055613 1404 dbSNP
rs1343008683 1410 dbSNP
rs1302706721 1422 dbSNP
rs750798043 1426 dbSNP
rs1055490869 1432 dbSNP
rs1437407651 1436 dbSNP
rs575166239 1438 dbSNP
rs1352510474 1439 dbSNP
rs753357901 1445 dbSNP
rs1429938936 1453 dbSNP
rs544132666 1461 dbSNP
rs1171123245 1463 dbSNP
rs1434390199 1468 dbSNP
rs1281150399 1489 dbSNP
rs1192261874 1490 dbSNP
rs1480534397 1491 dbSNP
rs1315516967 1492 dbSNP
rs1250016415 1493 dbSNP
rs1019950892 1502 dbSNP
rs949179012 1504 dbSNP
rs780541644 1509 dbSNP
rs1000133360 1511 dbSNP
rs1465818484 1513 dbSNP
rs1314001216 1515 dbSNP
rs752960795 1515 dbSNP
rs1223101502 1521 dbSNP
rs1033238398 1538 dbSNP
rs537668975 1548 dbSNP
rs985531013 1563 dbSNP
rs1374542322 1564 dbSNP
rs1251877344 1577 dbSNP
rs761373869 1596 dbSNP
rs1310682794 1605 dbSNP
rs911341786 1607 dbSNP
rs1454447088 1620 dbSNP
rs1192628961 1627 dbSNP
rs1405455100 1628 dbSNP
rs1399904981 1636 dbSNP
rs1159694403 1638 dbSNP
rs1410238288 1660 dbSNP
rs905031789 1664 dbSNP
rs1459857584 1665 dbSNP
rs563526976 1668 dbSNP
rs1370414288 1669 dbSNP
rs1048806054 1672 dbSNP
rs977117242 1677 dbSNP
rs1437381465 1679 dbSNP
rs765209464 1681 dbSNP
rs1371579971 1683 dbSNP
rs1223598017 1688 dbSNP
rs930190470 1707 dbSNP
rs1290131424 1710 dbSNP
rs1048659542 1714 dbSNP
rs557798321 1743 dbSNP
rs1212437409 1748 dbSNP
rs1015625571 1749 dbSNP
rs937538249 1750 dbSNP
rs998686135 1753 dbSNP
rs185714665 1754 dbSNP
rs1387184243 1758 dbSNP
rs1223231746 1763 dbSNP
rs895532168 1763 dbSNP
rs1458130341 1766 dbSNP
rs141873857 1769 dbSNP
rs1041748034 1772 dbSNP
rs902869125 1774 dbSNP
rs1256958210 1778 dbSNP
rs1000505522 1782 dbSNP
rs1186072031 1815 dbSNP
rs28608074 1817 dbSNP
rs978924583 1836 dbSNP
rs560160455 1841 dbSNP
rs1177546552 1844 dbSNP
rs1032959274 1863 dbSNP
rs888945947 1871 dbSNP
rs1413959928 1886 dbSNP
rs1007436819 1922 dbSNP
rs1033130637 1945 dbSNP
rs1263406226 1969 dbSNP
rs1164142786 1972 dbSNP
rs1246556592 1973 dbSNP
rs577214913 1975 dbSNP
rs989021465 1977 dbSNP
rs965417858 1978 dbSNP
rs1352954596 1991 dbSNP
rs976873750 2002 dbSNP
rs1394218299 2004 dbSNP
rs949045333 2006 dbSNP
rs1459764593 2011 dbSNP
rs750333302 2016 dbSNP
rs1026041567 2017 dbSNP
rs1369326679 2022 dbSNP
rs567843199 2033 dbSNP
rs1447778785 2040 dbSNP
rs982270619 2041 dbSNP
rs951436731 2043 dbSNP
rs1309011297 2046 dbSNP
rs574243644 2051 dbSNP
rs1352782347 2062 dbSNP
rs1211491659 2076 dbSNP
rs1356773663 2088 dbSNP
rs543340843 2093 dbSNP
rs937855097 2098 dbSNP
rs893559395 2111 dbSNP
rs1048286511 2123 dbSNP
rs1229560108 2128 dbSNP
rs145504065 2129 dbSNP
rs1436468235 2134 dbSNP
rs1331102014 2144 dbSNP
rs1322131509 2149 dbSNP
rs939957490 2150 dbSNP
rs1391866513 2151 dbSNP
rs1297852647 2153 dbSNP
rs1204862907 2176 dbSNP
rs1428012610 2188 dbSNP
rs937598505 2192 dbSNP
rs1484569128 2209 dbSNP
rs991584342 2211 dbSNP
rs1418514499 2212 dbSNP
rs917428847 2219 dbSNP
rs1473762651 2223 dbSNP
rs1375918845 2226 dbSNP
rs1165040869 2228 dbSNP
rs1200890943 2228 dbSNP
rs1451995542 2232 dbSNP
rs1417540529 2239 dbSNP
rs1409591003 2251 dbSNP
rs879026807 2252 dbSNP
rs77066992 2262 dbSNP
rs1041494688 2265 dbSNP
rs1274903687 2268 dbSNP
rs776432155 2270 dbSNP
rs1028839786 2272 dbSNP
rs1332067305 2277 dbSNP
rs935716662 2277 dbSNP
rs1054369657 2283 dbSNP
rs1307748294 2287 dbSNP
rs1408238323 2292 dbSNP
rs1312755888 2311 dbSNP
rs888995049 2321 dbSNP
rs1434239502 2323 dbSNP
rs1450864526 2329 dbSNP
rs1267893941 2354 dbSNP
rs1400122606 2357 dbSNP
rs1174265622 2360 dbSNP
rs1007487637 2367 dbSNP
rs1000672233 2371 dbSNP
rs1018758474 2378 dbSNP
rs1363013614 2385 dbSNP
rs901693859 2389 dbSNP
rs998658317 2390 dbSNP
rs989029446 2415 dbSNP
rs759286057 2416 dbSNP
rs970815906 2417 dbSNP
rs951450552 2421 dbSNP
rs1202721645 2425 dbSNP
rs984100001 2430 dbSNP
rs1227009249 2443 dbSNP
rs1016899871 2450 dbSNP
rs1289267833 2457 dbSNP
rs981769424 2463 dbSNP
rs1444058877 2472 dbSNP
rs958919221 2480 dbSNP
rs1191002020 2486 dbSNP
rs926268814 2487 dbSNP
rs991720016 2498 dbSNP
rs959175164 2500 dbSNP
rs1475129839 2513 dbSNP
rs917399277 2513 dbSNP
rs1169427530 2515 dbSNP
rs950276969 2528 dbSNP
rs1415102470 2532 dbSNP
rs1387890172 2541 dbSNP
rs531897982 2548 dbSNP
rs1173369453 2560 dbSNP
rs924427013 2561 dbSNP
rs190671156 2572 dbSNP
rs564123561 2575 dbSNP
rs1238707309 2578 dbSNP
rs935750417 2583 dbSNP
rs559382366 2584 dbSNP
rs1036970312 2596 dbSNP
rs1445908442 2600 dbSNP
rs58151655 2601 dbSNP
rs933888803 2602 dbSNP
rs533104297 2603 dbSNP
rs1331699128 2609 dbSNP
rs1269098516 2614 dbSNP
rs546607384 2623 dbSNP
rs1354593555 2635 dbSNP
rs1286159889 2638 dbSNP
rs910230096 2642 dbSNP
rs943241253 2643 dbSNP
rs1435215703 2645 dbSNP
rs760879229 2659 dbSNP
rs1437127405 2662 dbSNP
rs1389122292 2663 dbSNP
rs1040337518 2664 dbSNP
rs1368291637 2686 dbSNP
rs1233194294 2689 dbSNP
rs1256353004 2694 dbSNP
rs1163458887 2700 dbSNP
rs901659944 2704 dbSNP
rs1187239550 2706 dbSNP
rs1245629538 2706 dbSNP
rs993377667 2725 dbSNP
rs1054437204 2735 dbSNP
rs566494988 2747 dbSNP
rs887165759 2768 dbSNP
rs1005606990 2783 dbSNP
rs1229064824 2785 dbSNP
rs1341570940 2786 dbSNP
rs891964972 2806 dbSNP
rs1016867290 2815 dbSNP
rs1365928859 2819 dbSNP
rs775441694 2823 dbSNP
rs1434096773 2833 dbSNP
rs1283518706 2844 dbSNP
rs535363373 2845 dbSNP
rs1351376736 2851 dbSNP
rs1323848040 2853 dbSNP
rs1428657575 2862 dbSNP
rs1387784601 2863 dbSNP
rs1170008368 2864 dbSNP
rs1211752503 2867 dbSNP
rs1464463254 2869 dbSNP
rs1189277039 2870 dbSNP
rs1250024158 2873 dbSNP
rs151102425 2875 dbSNP
rs1452806245 2879 dbSNP
rs1248770496 2880 dbSNP
rs1193304040 2900 dbSNP
rs1024523128 2914 dbSNP
rs1013111068 2915 dbSNP
rs1467927576 2917 dbSNP
rs1024595640 2922 dbSNP
rs1272748431 2930 dbSNP
rs1207456328 2936 dbSNP
rs1002174766 2938 dbSNP
rs1300559316 2939 dbSNP
rs762786252 2939 dbSNP
rs1217369419 2943 dbSNP
rs1384843513 2950 dbSNP
rs971971780 2957 dbSNP
rs977576297 2962 dbSNP
rs1275149663 2983 dbSNP
rs1033389351 2987 dbSNP
rs1458266182 2991 dbSNP
rs924780433 2999 dbSNP
rs549531667 3000 dbSNP
rs41301255 3003 dbSNP
rs1358029911 3005 dbSNP
rs989915012 3006 dbSNP
rs961213720 3025 dbSNP
rs1439628882 3031 dbSNP
rs972589890 3033 dbSNP
rs1200685905 3039 dbSNP
rs537611008 3050 dbSNP
rs1472462501 3054 dbSNP
rs1249953638 3056 dbSNP
rs1207525532 3061 dbSNP
rs922412737 3069 dbSNP
rs1255444114 3078 dbSNP
rs943044780 3082 dbSNP
rs111721730 3083 dbSNP
rs1278792957 3086 dbSNP
rs1207959133 3098 dbSNP
rs1329741511 3105 dbSNP
rs1313944971 3107 dbSNP
rs1279223143 3115 dbSNP
rs181364338 3117 dbSNP
rs368581989 3118 dbSNP
rs1289866124 3121 dbSNP
rs933965298 3128 dbSNP
rs1300498006 3131 dbSNP
rs1377825649 3131 dbSNP
rs12749053 3133 dbSNP
rs534068497 3135 dbSNP
rs1177760520 3137 dbSNP
rs929222816 3146 dbSNP
rs1184644914 3148 dbSNP
rs935963319 3149 dbSNP
rs1435180897 3150 dbSNP
rs1180067944 3152 dbSNP
rs1484262798 3162 dbSNP
rs1047529900 3172 dbSNP
rs185939907 3176 dbSNP
rs1326841158 3181 dbSNP
rs1269723103 3182 dbSNP
rs1162014655 3189 dbSNP
rs1414930124 3209 dbSNP
rs1460496606 3217 dbSNP
rs1397320175 3222 dbSNP
rs767801574 3226 dbSNP
rs1337999211 3230 dbSNP
rs1434952745 3236 dbSNP
rs1386929936 3249 dbSNP
rs1010260501 3251 dbSNP
rs1454614842 3260 dbSNP
rs1368160768 3276 dbSNP
rs1162903482 3283 dbSNP
rs1392408904 3287 dbSNP
rs1005574472 3289 dbSNP
rs1243771176 3290 dbSNP
rs750851384 3297 dbSNP
rs553735115 3307 dbSNP
rs1038448588 3316 dbSNP
rs1001827163 3318 dbSNP
rs574009141 3330 dbSNP
rs1012911995 3331 dbSNP
rs756440757 3333 dbSNP
rs1246487059 3337 dbSNP
rs1230092850 3339 dbSNP
rs971637430 3348 dbSNP
rs999523647 3358 dbSNP
rs1031813868 3362 dbSNP
rs957546954 3367 dbSNP
rs961140921 3370 dbSNP
rs530700299 3374 dbSNP
rs1017398243 3380 dbSNP
rs189964465 3386 dbSNP
rs754431628 3390 dbSNP
rs1292023282 3395 dbSNP
rs955351698 3399 dbSNP
rs1385946020 3403 dbSNP
rs1194348465 3411 dbSNP
rs964370983 3418 dbSNP
rs755408257 3423 dbSNP
rs181301723 3444 dbSNP
rs576667355 3458 dbSNP
rs1193772995 3460 dbSNP
rs1483587664 3469 dbSNP
rs1184921675 3473 dbSNP
rs150123536 3474 dbSNP
rs1211282146 3488 dbSNP
rs376506947 3489 dbSNP
rs1164832537 3495 dbSNP
rs1273466410 3496 dbSNP
rs1202467499 3497 dbSNP
rs34037437 3498 dbSNP
rs941904756 3505 dbSNP
rs546744133 3511 dbSNP
rs990135527 3512 dbSNP
rs186005966 3523 dbSNP
rs560013286 3531 dbSNP
rs1460140964 3543 dbSNP
rs1366491134 3547 dbSNP
rs913214199 3554 dbSNP
rs1038416445 3561 dbSNP
rs1427952980 3576 dbSNP
rs1372443166 3577 dbSNP
rs1168449154 3588 dbSNP
rs1370868266 3604 dbSNP
rs1375728895 3606 dbSNP
rs1200823797 3608 dbSNP
rs76064624 3610 dbSNP
rs1046223999 3620 dbSNP
rs190973784 3632 dbSNP
rs948811831 3633 dbSNP
rs1179516105 3638 dbSNP
rs1483761802 3639 dbSNP
rs1273025391 3640 dbSNP
rs1045702417 3647 dbSNP
rs1196889818 3648 dbSNP
rs569086885 3655 dbSNP
rs145449779 3659 dbSNP
rs1313509876 3661 dbSNP
rs999097393 3666 dbSNP
rs1287999679 3667 dbSNP
rs745665631 3678 dbSNP
rs1408181936 3692 dbSNP
rs113921650 3694 dbSNP
rs1337628213 3697 dbSNP
rs1032368311 3712 dbSNP
rs1413977189 3720 dbSNP
rs893299575 3735 dbSNP
rs1274227854 3746 dbSNP
rs1174213989 3747 dbSNP
rs75464599 3749 dbSNP
rs1410887319 3750 dbSNP
rs769689179 3758 dbSNP
rs1473329580 3759 dbSNP
rs1233093180 3762 dbSNP
rs184025251 3764 dbSNP
rs976255640 3765 dbSNP
rs1029980758 3771 dbSNP
rs1483208888 3774 dbSNP
rs1206080058 3775 dbSNP
rs1324745836 3776 dbSNP
rs71654417 3777 dbSNP
rs140220985 3778 dbSNP
rs1226803398 3781 dbSNP
rs1353196942 3791 dbSNP
rs567662484 3795 dbSNP
rs1280349302 3796 dbSNP
rs536600351 3797 dbSNP
rs1447461493 3816 dbSNP
rs1338731098 3817 dbSNP
rs983381421 3821 dbSNP
rs1338643002 3823 dbSNP
rs1257588851 3832 dbSNP
rs909174533 3838 dbSNP
rs1156766016 3841 dbSNP
rs1402219883 3842 dbSNP
rs1408327848 3843 dbSNP
rs1426225641 3852 dbSNP
rs1471542048 3857 dbSNP
rs1369643639 3858 dbSNP
rs1185980569 3860 dbSNP
rs1462107294 3861 dbSNP
rs145262676 3866 dbSNP
rs990581390 3867 dbSNP
rs576664528 3870 dbSNP
rs1449064464 3882 dbSNP
rs768459445 3883 dbSNP
rs1171519744 3884 dbSNP
rs1227920860 3884 dbSNP
rs138091330 3887 dbSNP
rs1466430929 3890 dbSNP
rs1246789447 3895 dbSNP
rs955251312 3906 dbSNP
rs369452019 3909 dbSNP
rs934691003 3913 dbSNP
rs1381373724 3921 dbSNP
rs957305592 3924 dbSNP
rs990022646 3925 dbSNP
rs1053370114 3930 dbSNP
rs1366907123 3932 dbSNP
rs1380630773 3933 dbSNP
rs913269492 3945 dbSNP
rs562938011 3946 dbSNP
rs1390142164 3947 dbSNP
rs1297027187 3948 dbSNP
rs1163091866 3949 dbSNP
rs1230980893 3950 dbSNP
rs1221131920 3952 dbSNP
rs1278615065 3959 dbSNP
rs1294213896 3963 dbSNP
rs1011843120 3964 dbSNP
rs1223375211 3975 dbSNP
rs1341519185 3977 dbSNP
rs981551650 3983 dbSNP
rs778453774 3990 dbSNP
rs1211358275 3992 dbSNP
rs1258323561 3996 dbSNP
rs761947215 4019 dbSNP
rs1362405081 4024 dbSNP
rs535574487 4031 dbSNP
rs1056390846 4032 dbSNP
rs1347076149 4036 dbSNP
rs1303344287 4044 dbSNP
rs1428592720 4048 dbSNP
rs868162015 4060 dbSNP
rs1207514805 4061 dbSNP
rs1248176132 4072 dbSNP
rs887943405 4079 dbSNP
rs1412080290 4083 dbSNP
rs1420836098 4088 dbSNP
rs1191048899 4092 dbSNP
rs1479644260 4093 dbSNP
rs942296234 4104 dbSNP
rs541661083 4105 dbSNP
rs531440745 4108 dbSNP
rs560153994 4109 dbSNP
rs1200346410 4110 dbSNP
rs1482787840 4116 dbSNP
rs10518566 4117 dbSNP
rs1206552568 4133 dbSNP
rs760799348 4134 dbSNP
rs1424123513 4136 dbSNP
rs950413253 4142 dbSNP
rs1347133157 4147 dbSNP
rs1408774458 4150 dbSNP
rs542605265 4158 dbSNP
rs562388093 4165 dbSNP
rs1015892697 4184 dbSNP
rs568713771 4189 dbSNP
rs1175950853 4207 dbSNP
rs1178080983 4214 dbSNP
rs1468588766 4215 dbSNP
rs1343343316 4223 dbSNP
rs1431853520 4238 dbSNP
rs867680332 4255 dbSNP
rs1472353058 4259 dbSNP
rs1456678478 4260 dbSNP
rs963234252 4261 dbSNP
rs61771761 4273 dbSNP
rs916395208 4274 dbSNP
rs774511715 4276 dbSNP
rs1018100857 4278 dbSNP
rs1201633690 4283 dbSNP
rs1325434568 4286 dbSNP
rs551293166 4289 dbSNP
rs957193045 4292 dbSNP
rs1301535245 4301 dbSNP
rs970994368 4304 dbSNP
rs1308657314 4308 dbSNP
rs1011454324 4317 dbSNP
rs1220202255 4322 dbSNP
rs1020118039 4325 dbSNP
rs1451011176 4330 dbSNP
rs967365615 4342 dbSNP
rs1337867232 4344 dbSNP
rs1457038367 4358 dbSNP
rs1412045161 4374 dbSNP
rs981540455 4388 dbSNP
rs981879487 4403 dbSNP
rs557586561 4405 dbSNP
rs1296874924 4425 dbSNP
rs1413109980 4436 dbSNP
rs934764018 4444 dbSNP
rs959082302 4445 dbSNP
rs1207926845 4452 dbSNP
rs1484759693 4457 dbSNP
rs1465865234 4465 dbSNP
rs188624493 4468 dbSNP
rs1245791346 4473 dbSNP
rs1309886334 4475 dbSNP
rs914595204 4479 dbSNP
rs1385706573 4481 dbSNP
rs527441881 4482 dbSNP
rs942139547 4484 dbSNP
rs142663896 4485 dbSNP
rs1383190189 4495 dbSNP
rs369832964 4499 dbSNP
rs1454452700 4501 dbSNP
rs536387270 4502 dbSNP
rs919478683 4503 dbSNP
rs1161826377 4511 dbSNP
rs191049504 4512 dbSNP
rs900664735 4526 dbSNP
rs1412717833 4527 dbSNP
rs570092606 4538 dbSNP
rs1426552622 4540 dbSNP
rs998134513 4550 dbSNP
rs1487986794 4551 dbSNP
rs1289132929 4562 dbSNP
rs1224122156 4567 dbSNP
rs1051942251 4568 dbSNP
rs1293163506 4570 dbSNP
rs1321777157 4571 dbSNP
rs1007084972 4575 dbSNP
rs539055853 4576 dbSNP
rs1298268041 4578 dbSNP
rs1039393149 4580 dbSNP
rs1437535925 4599 dbSNP
rs546145162 4600 dbSNP
rs1426651495 4626 dbSNP
rs1366230487 4654 dbSNP
rs886156976 4656 dbSNP
rs1295635394 4662 dbSNP
rs1004651600 4664 dbSNP
rs1015856764 4665 dbSNP
rs963035658 4680 dbSNP
rs1349027539 4681 dbSNP
rs1460349761 4688 dbSNP
rs1374711119 4696 dbSNP
rs765690326 4697 dbSNP
rs1289557757 4699 dbSNP
rs892974874 4703 dbSNP
rs1266388873 4717 dbSNP
rs1201070711 4732 dbSNP
rs1490378373 4742 dbSNP
rs1023540795 4749 dbSNP
rs1193560852 4751 dbSNP
rs1020062774 4754 dbSNP
rs1253567728 4764 dbSNP
rs1228679854 4767 dbSNP
rs970583653 4772 dbSNP
rs1002789588 4774 dbSNP
rs1288579089 4776 dbSNP
rs144771501 4779 dbSNP
rs572787119 4790 dbSNP
rs1328340497 4810 dbSNP
rs1223391080 4811 dbSNP
rs1036135191 4813 dbSNP
rs958700743 4817 dbSNP
rs991576389 4818 dbSNP
rs909273476 4826 dbSNP
rs1178143971 4828 dbSNP
rs74391727 4835 dbSNP
rs1182768160 4839 dbSNP
rs1253919824 4842 dbSNP
rs988919312 4847 dbSNP
rs972253388 4848 dbSNP
rs914564021 4849 dbSNP
rs1253316921 4853 dbSNP
rs1406107715 4855 dbSNP
rs947405409 4857 dbSNP
rs554912516 4861 dbSNP
rs933604448 4866 dbSNP
rs1461151251 4880 dbSNP
rs1369054330 4893 dbSNP
rs1052012920 4897 dbSNP
rs1324623421 4907 dbSNP
rs867522371 4916 dbSNP
rs1237035645 4929 dbSNP
rs922141141 4931 dbSNP
rs1329491013 4936 dbSNP
rs933597248 4956 dbSNP
rs1052337012 4964 dbSNP
rs942341474 4972 dbSNP
rs1403648827 4973 dbSNP
rs1039445111 4978 dbSNP
rs1470099987 4982 dbSNP
rs892918108 4989 dbSNP
rs886625784 4991 dbSNP
rs1470896744 5011 dbSNP
rs1363804987 5017 dbSNP
rs182935805 5028 dbSNP
rs61771762 5030 dbSNP
rs1037441130 5036 dbSNP
rs898826042 5049 dbSNP
rs1461311096 5054 dbSNP
rs1241829495 5055 dbSNP
rs1206013301 5056 dbSNP
rs375320132 5058 dbSNP
rs1283075430 5074 dbSNP
rs1283850612 5086 dbSNP
rs79144744 5091 dbSNP
rs1352936689 5094 dbSNP
rs1280148554 5097 dbSNP
rs1380551414 5106 dbSNP
rs903008410 5106 dbSNP
rs1003213508 5113 dbSNP
rs1453136728 5119 dbSNP
rs776326445 5122 dbSNP
rs761271900 5124 dbSNP
rs906408234 5126 dbSNP
rs1229614797 5146 dbSNP
rs1003474374 5153 dbSNP
rs1341139608 5173 dbSNP
rs575606987 5179 dbSNP
rs1031233932 5181 dbSNP
rs956595397 5183 dbSNP
rs756699718 5185 dbSNP
rs1162450856 5187 dbSNP
rs780669002 5189 dbSNP
rs745600762 5193 dbSNP
rs1012895753 5195 dbSNP
rs1016257680 5196 dbSNP
rs1445647562 5199 dbSNP
rs988888222 5199 dbSNP
rs1021758521 5204 dbSNP
rs963478473 5208 dbSNP
rs1449011194 5219 dbSNP
rs71654418 5235 dbSNP
rs750386442 5243 dbSNP
rs1293904233 5246 dbSNP
rs1246539145 5260 dbSNP
rs1186760997 5268 dbSNP
rs1236905637 5269 dbSNP
rs1361027328 5277 dbSNP
rs375692487 5286 dbSNP
rs982895294 5299 dbSNP
rs1026930489 5300 dbSNP
rs954866835 5301 dbSNP
rs1326698033 5307 dbSNP
rs921970814 5309 dbSNP
rs1302119537 5314 dbSNP
rs1422237917 5315 dbSNP
rs933547387 5317 dbSNP
rs570798090 5318 dbSNP
rs1388524591 5339 dbSNP
rs1406396810 5348 dbSNP
rs1419407297 5364 dbSNP
rs1429392952 5372 dbSNP
rs987761669 5377 dbSNP
rs1169620995 5390 dbSNP
rs988130331 5412 dbSNP
rs1372856652 5423 dbSNP
rs1413206589 5431 dbSNP
rs1198925363 5434 dbSNP
rs1334089717 5441 dbSNP
rs1340511042 5450 dbSNP
rs908020788 5462 dbSNP
rs1271070810 5476 dbSNP
rs1223305271 5477 dbSNP
rs1306916373 5479 dbSNP
rs148256772 5483 dbSNP
rs1216158606 5484 dbSNP
rs1339772184 5490 dbSNP
rs1282276831 5491 dbSNP
rs1402638132 5495 dbSNP
rs1346860222 5496 dbSNP
rs1303291286 5507 dbSNP
rs1037408706 5511 dbSNP
rs12136639 5512 dbSNP
rs187576664 5517 dbSNP
rs1354522475 5523 dbSNP
rs561535004 5531 dbSNP
rs1412033867 5539 dbSNP
rs866905333 5541 dbSNP
rs947172516 5545 dbSNP
rs1479613040 5546 dbSNP
rs906217463 5561 dbSNP
rs1191889576 5563 dbSNP
rs141883381 5568 dbSNP
rs1231126539 5589 dbSNP
rs1199763322 5590 dbSNP
rs1438187563 5591 dbSNP
rs938508427 5597 dbSNP
rs1030952177 5599 dbSNP
rs560960298 5604 dbSNP
rs892292395 5622 dbSNP
rs1221447946 5624 dbSNP
rs1010706532 5625 dbSNP
rs1212294596 5626 dbSNP
rs150648051 5627 dbSNP
rs1370491263 5630 dbSNP
rs968762520 5637 dbSNP
rs41306159 5643 dbSNP
rs899155132 5644 dbSNP
rs1029388672 5648 dbSNP
rs1336563008 5650 dbSNP
rs1401645038 5650 dbSNP
rs954760250 5658 dbSNP
rs1408640691 5660 dbSNP
rs570178221 5661 dbSNP
rs908156083 5679 dbSNP
rs1026358290 5681 dbSNP
rs549949017 5684 dbSNP
rs1178889323 5690 dbSNP
rs955062527 5697 dbSNP
rs987627559 5703 dbSNP
rs1018172102 5704 dbSNP
rs1201574465 5704 dbSNP
rs1172458224 5707 dbSNP
rs1462451493 5712 dbSNP
rs964970937 5712 dbSNP
rs989684406 5714 dbSNP
rs1314631436 5720 dbSNP
rs538994821 5721 dbSNP
rs940948335 5725 dbSNP
rs1355651349 5731 dbSNP
rs774366958 5735 dbSNP
rs1223848291 5736 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuugugGUAACA-----GUGUGAGGu 5'
                 :|||||     ::|||||| 
Target 5' -------UAUUGUGCCACUGCACUCCa 3'
1 - 20
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084045
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000370203.4 | 3UTR | UAUUGUGCCACUGCACUCCAGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.898 3.1e-9 0.845 2.0e-7 23 Click to see details
GSE38226 Liver fibrosis 0.479 1.4e-2 0.567 3.7e-3 21 Click to see details
GSE32688 Pancreatic cancer 0.368 1.9e-2 0.199 1.4e-1 32 Click to see details
GSE28544 Breast cancer -0.401 2.6e-2 -0.402 2.6e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.223 3.8e-2 0.210 4.8e-2 64 Click to see details
GSE28260 Renal cortex and medulla 0.466 5.4e-2 0.330 1.4e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.422 8.6e-2 0.402 9.8e-2 12 Click to see details
GSE27834 Pluripotent stem cells -0.336 1.0e-1 -0.379 7.4e-2 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.159 2.2e-1 0.136 2.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.156 2.3e-1 -0.153 2.3e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.19 3.6e-1 0.086 4.4e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells 0.072 3.7e-1 -0.005 4.9e-1 24 Click to see details
GSE17306 Multiple myeloma -0.047 3.7e-1 0.032 4.1e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.008 4.7e-1 -0.059 2.9e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.007 4.9e-1 0.048 4.2e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.007 4.9e-1 0.048 4.2e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.629 0 0.422 0 49 Click to see details
STAD -0.683 0.03 -0.429 0.14 8 Click to see details
KIRP -0.375 0.16 -0.667 0.02 9 Click to see details
KIRC -0.148 0.22 0.022 0.45 29 Click to see details
HNSC 0.685 0.26 0.500 0.33 3 Click to see details
KICH -0.196 0.32 -0.310 0.23 8 Click to see details
ESCA 0.189 0.38 0.300 0.31 5 Click to see details
THCA 0.172 0.39 0.200 0.37 5 Click to see details
CHOL -0.007 0.49 0.200 0.3 9 Click to see details
CHOL -0.007 0.49 0.200 0.3 9 Click to see details
CHOL -0.007 0.49 0.200 0.3 9 Click to see details
CHOL -0.007 0.49 0.200 0.3 9 Click to see details
CHOL -0.007 0.49 0.200 0.3 9 Click to see details
CHOL -0.007 0.49 0.200 0.3 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36