miRTarBase - #MIRT672430 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol POLR2D   
Synonyms HSRBP4, HSRPB4, RBP4, RPB16
Description RNA polymerase II subunit D
Transcript NM_004805   
Expression
Putative miRNA Targets on POLR2D
3'UTR of POLR2D
(miRNA target sites are highlighted)
>POLR2D|NM_004805|3'UTR
   1 TCTCCAAACATCACTGCTGCTCGGAGAAACCACATCCCCAGGCATAACACCACCTTCCCACTGTCTGGGGCTGACTTGCA
  81 CAGAAATTCTGTTGAAGACAGTTGAGAATTCCTTTGGAGAAAACAGCCCAGCTTGGCGTGGGGTTAGGTTGCTGTTTCAA
 161 ATAACTCACAGGCCCAGGTGACATGGAATCTTGGAGCAGCCTTGTGCAGTGGCAGCCAGTGGCTTCCTGAACGTGCCTCT
 241 GCGAAGTGTGAGATGAGGGGTCACATAACCACACTGTTGACTACCTCATTCCTGGTTTTTGGCCTCCACATCATCTTTTT
 321 TCTTAATATTTCATGTTTTAATTTCAGGGTGTTTATACTTTTTGAAACTAGACCAGAAGATAGTAGACTTTATAGAGAAA
 401 GACCAGTTTTACCTAGATACTAAAGGAAGAATTAAACCGCTGTTAGTTTGAAATGCTTTTTTTTTTTTTTTTTAAATGGA
 481 GATAGGGTCTTAACTCTTGTCCAGGCTGGAGGAGTGCAGTCGTACAGTCATGGCTCACTGAAGTCTTGACCCCGCTGCCT
 561 CAGCCTCCCAAATAACTGGGGCCACAGGTGTGCACCACAACTCTCAGCTAATTTTTAAAATTTTTTATAGAGGTGGGGTT
 641 TTACTATGCTGTCCAGACTGGTCTTAAACTCCTGGGCTCAAGTGATCCCCCTGCCTTGGCCTCCCAAACTGGTGAGATTA
 721 CAGGCATGAGCCACCACAACTGGCCTGAAATTCTTAAAGGATGGGAGTGTCGATGACAGCACCTTGGCATCGTTGTGCCT
 801 AACCTGGGAGACGGAAGAAGCACGCCATGGGAAGTGTTTACACTTGGGGACAAGTGCTAAGTATTGTGGAGCCCATAGCC
 881 CCTTGAGATAGATGGCTACTTTGCCTTTCTTCTTGAACTGTCTTGCAGAATGTGGATTTGGGGTAAGTGGTCTTGAAGGA
 961 TTCATTTAGTCACCCTCAAATTAAGATTTTTACTTCATCTTTCTTGGGCCTGCACCTCCAAGATAACAAAGAAGAAGCAA
1041 TGGTCGTGCCAAAGAGGTCCACAACCAGGTGTGCACTGTTCACTGCAGCCCATTTGCTGTATGAACTGTGGTTGTTGTGT
1121 GCCCAATGACAAGGCTACTAAGAAATTCATCATTTGAAACGTAGAGGCCGCAGCAGTCAGCGATGTTTCTGAAATGAGCA
1201 TCCTTGACGCCTGTGTACTTCCCAGGCTGGATGTGAAGCTACATTACCATGTGAGTTGTGCCATTCACAGCACAGTGGTG
1281 AGGAATTGAGCTCATGAAGCAGGCAAGGACCGAACACCTCCACCCCAACGTAGACCTGCAGGTGCTGCCCCATGACCTCC
1361 ACCAAAGCCCATATAAGGAGCGGAGTTGTTAAGGACTGAAGAAAAACTTCTCTGGAGAAAAATAAAATTGCAATTCTACT
1441 TAAAAAAATTTTTTTTTTTTTTTACTTCATAGGCCAGGCTTGAAGTTCTGAACACTTTGAAGTCTCCAATTATGAGAGAT
1521 CCAGTCTAAGCCTCTGGCCTGCTAATTAGCAATAAGTGCTTTATTTGGAAGGAGGGAGTCATCCACTCTTGAGCCACTGC
1601 AGTGAAGTCACTTGATCTCAGTCTGGGGGAAAACACTTCAATAGCTAAACATTCTAGCTTTGATTTTTCTGAAGGGAATA
1681 CACTTGTTTTCAATTTTGGGGTTTTTCTTTGGGGCACTTGCTTGACTCTGTATGAACTTGTGATCCAAGGAAAAAGGAGA
1761 AAGAACAGTGTTGGCTTTTAAAATCAGGATGGTTTTATGTTTGCTACGAAATAAGGCAAGAATAAAAAATTCTTATTTTT
1841 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             | ||:: | |:| ||||| 
Target 5' tccAGACTGGTCTTAAACTCCt 3'
652 - 673 127.00 -11.80
2
miRNA  3' guuUGUGGUA------AC-AGUGUGAGgu 5'
             ||:||||      || |:|||||:  
Target 5' agcACGCCATGGGAAGTGTTTACACTTgg 3'
819 - 847 125.00 -14.30
3
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        |||||:| 
Target 5' cagtctgggggaaaACACTTCa 3'
1619 - 1640 124.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30743947 37 COSMIC
COSN30144381 45 COSMIC
COSN31554233 50 COSMIC
COSN30466089 59 COSMIC
COSN30158091 104 COSMIC
COSN31516980 106 COSMIC
COSN7336101 190 COSMIC
COSN30511924 274 COSMIC
COSN19488794 333 COSMIC
COSN20090636 1065 COSMIC
COSN5480404 1175 COSMIC
COSN26509140 1191 COSMIC
COSN22105241 1196 COSMIC
COSN31535773 1246 COSMIC
COSN7336100 1258 COSMIC
COSN1786495 1289 COSMIC
COSN29462489 1329 COSMIC
COSN29461629 1330 COSMIC
COSN30542723 1336 COSMIC
COSN22833259 1441 COSMIC
COSN27835427 1511 COSMIC
COSN9858441 1807 COSMIC
COSN7057907 1824 COSMIC
COSN29202573 2098 COSMIC
COSN2482806 2504 COSMIC
COSN29136180 3210 COSMIC
COSN21872483 3257 COSMIC
COSN19566650 3302 COSMIC
COSN9079460 3877 COSMIC
COSN4795934 3884 COSMIC
COSN31559940 4170 COSMIC
COSN26560205 4192 COSMIC
COSN31608214 4229 COSMIC
COSN31527227 4244 COSMIC
COSN26581514 4250 COSMIC
COSN26505519 4256 COSMIC
COSN28892544 4258 COSMIC
COSN26669021 4262 COSMIC
COSN26506457 4266 COSMIC
COSN31531172 4343 COSMIC
COSN31596483 4404 COSMIC
COSN31568089 4415 COSMIC
COSN20822708 4442 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1239560102 3 dbSNP
rs1393909476 7 dbSNP
rs763265191 10 dbSNP
rs773732805 12 dbSNP
rs770230619 13 dbSNP
rs748267959 16 dbSNP
rs768771447 22 dbSNP
rs747240892 23 dbSNP
rs13382312 27 dbSNP
rs1324022671 31 dbSNP
rs1443314854 32 dbSNP
rs754654970 32 dbSNP
rs751262784 34 dbSNP
rs1285699759 36 dbSNP
rs552904625 37 dbSNP
rs1325430320 38 dbSNP
rs750190934 43 dbSNP
rs779005799 45 dbSNP
rs1229311661 47 dbSNP
rs371001164 48 dbSNP
rs753809360 50 dbSNP
rs763570236 51 dbSNP
rs1012401448 54 dbSNP
rs947452647 69 dbSNP
rs960930385 70 dbSNP
rs1035257834 74 dbSNP
rs1453711768 76 dbSNP
rs148323792 78 dbSNP
rs956397980 79 dbSNP
rs1035903916 80 dbSNP
rs557296468 84 dbSNP
rs902485498 88 dbSNP
rs1190009588 90 dbSNP
rs1044126022 104 dbSNP
rs982085606 109 dbSNP
rs59041917 117 dbSNP
rs182279696 126 dbSNP
rs1039550494 128 dbSNP
rs942540221 133 dbSNP
rs756712004 137 dbSNP
rs552289031 138 dbSNP
rs1435870206 139 dbSNP
rs912417614 149 dbSNP
rs1297863420 158 dbSNP
rs1309730702 172 dbSNP
rs1227283308 176 dbSNP
rs1266563563 177 dbSNP
rs1337325319 183 dbSNP
rs1392461493 188 dbSNP
rs1212287297 201 dbSNP
rs1373481595 207 dbSNP
rs1011920176 216 dbSNP
rs1210023720 221 dbSNP
rs888161285 226 dbSNP
rs1050972205 233 dbSNP
rs1444199910 242 dbSNP
rs751049456 243 dbSNP
rs532240129 247 dbSNP
rs1474093454 248 dbSNP
rs1164006197 249 dbSNP
rs993970269 253 dbSNP
rs896962666 260 dbSNP
rs1040912475 263 dbSNP
rs1382811754 265 dbSNP
rs1381730889 283 dbSNP
rs566476864 284 dbSNP
rs918219739 287 dbSNP
rs1357979103 289 dbSNP
rs1231818330 308 dbSNP
rs974183092 310 dbSNP
rs1330283357 323 dbSNP
rs1366475469 329 dbSNP
rs1161250316 333 dbSNP
rs1049678537 334 dbSNP
rs1200591743 335 dbSNP
rs1259495031 337 dbSNP
rs1419594238 347 dbSNP
rs549440322 349 dbSNP
rs1187169595 351 dbSNP
rs914610447 358 dbSNP
rs989301433 362 dbSNP
rs1161474115 367 dbSNP
rs934788281 374 dbSNP
rs1469993461 394 dbSNP
rs1253825568 395 dbSNP
rs928765232 398 dbSNP
rs1377765584 401 dbSNP
rs143303718 403 dbSNP
rs1312830510 411 dbSNP
rs1365701473 419 dbSNP
rs1225900374 420 dbSNP
rs1262834915 422 dbSNP
rs149557883 425 dbSNP
rs41547213 437 dbSNP
rs185527010 438 dbSNP
rs1345143593 439 dbSNP
rs1237241803 444 dbSNP
rs1372752686 446 dbSNP
rs41542218 454 dbSNP
rs1385845631 455 dbSNP
rs1481492562 457 dbSNP
rs1388389899 473 dbSNP
rs1173555097 474 dbSNP
rs1418763087 474 dbSNP
rs1432946343 474 dbSNP
rs755224601 474 dbSNP
rs62158421 476 dbSNP
rs1026675760 477 dbSNP
rs1444784401 478 dbSNP
rs1296846807 479 dbSNP
rs1373090523 482 dbSNP
rs1290395842 484 dbSNP
rs994310364 485 dbSNP
rs1345038415 492 dbSNP
rs1182915505 494 dbSNP
rs1233016818 502 dbSNP
rs896916638 503 dbSNP
rs1379534663 504 dbSNP
rs1156968397 506 dbSNP
rs1250512172 508 dbSNP
rs1488698943 513 dbSNP
rs1194442809 514 dbSNP
rs1255200394 519 dbSNP
rs1019844015 522 dbSNP
rs1420802956 522 dbSNP
rs181677825 524 dbSNP
rs762481832 526 dbSNP
rs41552916 530 dbSNP
rs1354250229 537 dbSNP
rs1458741845 545 dbSNP
rs1049625941 547 dbSNP
rs1198475435 549 dbSNP
rs1011490105 552 dbSNP
rs545103463 553 dbSNP
rs111611959 554 dbSNP
rs1212686565 558 dbSNP
rs1206030962 572 dbSNP
rs1488252838 573 dbSNP
rs552967896 590 dbSNP
rs934715615 593 dbSNP
rs190117122 597 dbSNP
rs542586363 600 dbSNP
rs1284441050 616 dbSNP
rs1213615543 621 dbSNP
rs1467341751 622 dbSNP
rs1213332875 627 dbSNP
rs928737149 629 dbSNP
rs1046282848 635 dbSNP
rs1185219068 637 dbSNP
rs1419513028 646 dbSNP
rs1475733628 647 dbSNP
rs1167617521 650 dbSNP
rs1391799282 651 dbSNP
rs948856740 655 dbSNP
rs1318591810 657 dbSNP
rs1346397972 661 dbSNP
rs573926755 671 dbSNP
rs1269506264 676 dbSNP
rs1379866162 677 dbSNP
rs761127423 679 dbSNP
rs1291162334 680 dbSNP
rs985022956 682 dbSNP
rs1232837473 687 dbSNP
rs952303199 691 dbSNP
rs1274920666 694 dbSNP
rs1232148850 695 dbSNP
rs919557184 706 dbSNP
rs1242027118 707 dbSNP
rs1486310474 709 dbSNP
rs1328936564 716 dbSNP
rs1416082081 719 dbSNP
rs1297460393 731 dbSNP
rs1382531551 734 dbSNP
rs1158722553 745 dbSNP
rs762619641 768 dbSNP
rs1019369316 771 dbSNP
rs527320495 772 dbSNP
rs1416486033 780 dbSNP
rs1311004144 791 dbSNP
rs1376213747 792 dbSNP
rs1280348066 798 dbSNP
rs1353174672 801 dbSNP
rs748738327 804 dbSNP
rs10206169 805 dbSNP
rs1222117106 808 dbSNP
rs1283604864 809 dbSNP
rs557666580 812 dbSNP
rs138182238 813 dbSNP
rs1256032152 816 dbSNP
rs1172057897 817 dbSNP
rs953879403 823 dbSNP
rs1374936950 824 dbSNP
rs1194385326 827 dbSNP
rs578156291 829 dbSNP
rs1477727053 830 dbSNP
rs1261442836 834 dbSNP
rs1011437801 842 dbSNP
rs893069117 844 dbSNP
rs1436044346 845 dbSNP
rs1053487722 847 dbSNP
rs1391742021 848 dbSNP
rs998873388 851 dbSNP
rs1333801942 852 dbSNP
rs1440231981 853 dbSNP
rs907229718 856 dbSNP
rs1371737112 858 dbSNP
rs1236679402 866 dbSNP
rs145648124 867 dbSNP
rs1347839657 869 dbSNP
rs186687779 871 dbSNP
rs1275494298 878 dbSNP
rs1436440372 884 dbSNP
rs1180561880 889 dbSNP
rs1342473058 895 dbSNP
rs1455182166 897 dbSNP
rs1191263501 899 dbSNP
rs1394375464 908 dbSNP
rs1462401208 915 dbSNP
rs1169606003 917 dbSNP
rs916069115 942 dbSNP
rs1049271616 955 dbSNP
rs1330930809 972 dbSNP
rs930858766 974 dbSNP
rs1218841821 991 dbSNP
rs768851178 998 dbSNP
rs1276066894 1001 dbSNP
rs762822826 1005 dbSNP
rs1228719458 1008 dbSNP
rs1416606607 1009 dbSNP
rs1337846583 1016 dbSNP
rs972777363 1026 dbSNP
rs1273402735 1027 dbSNP
rs1469569518 1028 dbSNP
rs1333598126 1030 dbSNP
rs1412793905 1031 dbSNP
rs961066485 1034 dbSNP
rs114738582 1035 dbSNP
rs1168753500 1038 dbSNP
rs1371334757 1045 dbSNP
rs986497086 1046 dbSNP
rs953828389 1050 dbSNP
rs749461675 1056 dbSNP
rs1419795377 1057 dbSNP
rs546640055 1058 dbSNP
rs542171170 1065 dbSNP
rs1422000897 1075 dbSNP
rs1390022220 1077 dbSNP
rs1011365697 1078 dbSNP
rs1320832730 1079 dbSNP
rs1167475121 1086 dbSNP
rs957480747 1090 dbSNP
rs1294249888 1102 dbSNP
rs1804817 1113 dbSNP
rs999216159 1115 dbSNP
rs1440249402 1116 dbSNP
rs1252012749 1119 dbSNP
rs1264502248 1121 dbSNP
rs745691592 1126 dbSNP
rs550899590 1131 dbSNP
rs781055364 1148 dbSNP
rs530671349 1151 dbSNP
rs1012977508 1154 dbSNP
rs182501318 1160 dbSNP
rs546238576 1161 dbSNP
rs1214719312 1172 dbSNP
rs930836839 1181 dbSNP
rs898022711 1182 dbSNP
rs1036614811 1183 dbSNP
rs1382923102 1193 dbSNP
rs1399881910 1203 dbSNP
rs551129132 1205 dbSNP
rs944978608 1207 dbSNP
rs528588563 1208 dbSNP
rs986444785 1209 dbSNP
rs932361745 1212 dbSNP
rs115408243 1213 dbSNP
rs1167585031 1214 dbSNP
rs989888549 1223 dbSNP
rs957210603 1229 dbSNP
rs1352345826 1230 dbSNP
rs751555892 1249 dbSNP
rs1031962317 1259 dbSNP
rs977358425 1267 dbSNP
rs1271451541 1269 dbSNP
rs1484559461 1274 dbSNP
rs878935846 1275 dbSNP
rs529781372 1282 dbSNP
rs1471441218 1283 dbSNP
rs577270103 1287 dbSNP
rs56297132 1290 dbSNP
rs1178654641 1292 dbSNP
rs1184279381 1311 dbSNP
rs1457047080 1315 dbSNP
rs140697048 1320 dbSNP
rs1235935659 1322 dbSNP
rs1174813801 1325 dbSNP
rs14506 1328 dbSNP
rs1433224735 1329 dbSNP
rs73955342 1330 dbSNP
rs1027726938 1338 dbSNP
rs190379082 1340 dbSNP
rs897988749 1352 dbSNP
rs1375509224 1363 dbSNP
rs146891421 1382 dbSNP
rs1282353250 1391 dbSNP
rs944941209 1391 dbSNP
rs1209375776 1394 dbSNP
rs1251626556 1405 dbSNP
rs1353173841 1412 dbSNP
rs535202362 1415 dbSNP
rs183759731 1418 dbSNP
rs1310082835 1420 dbSNP
rs1236654597 1424 dbSNP
rs890728486 1425 dbSNP
rs1397397700 1430 dbSNP
rs1453062466 1431 dbSNP
rs1175990527 1433 dbSNP
rs1355409353 1441 dbSNP
rs1050692396 1442 dbSNP
rs1296080644 1446 dbSNP
rs1328226583 1447 dbSNP
rs572655048 1448 dbSNP
rs1061056 1449 dbSNP
rs1368178992 1449 dbSNP
rs1349736684 1450 dbSNP
rs1296215727 1453 dbSNP
rs935784662 1455 dbSNP
rs56204957 1457 dbSNP
rs796661767 1458 dbSNP
rs1256377692 1463 dbSNP
rs1254902581 1464 dbSNP
rs1457518456 1464 dbSNP
rs1487547691 1464 dbSNP
rs375411625 1464 dbSNP
rs1191115066 1465 dbSNP
rs1361659604 1465 dbSNP
rs1420917435 1469 dbSNP
rs977661995 1479 dbSNP
rs1169037442 1494 dbSNP
rs1438490500 1496 dbSNP
rs1423391164 1502 dbSNP
rs1461592971 1509 dbSNP
rs1327519395 1513 dbSNP
rs1377923065 1518 dbSNP
rs1195183730 1532 dbSNP
rs150244946 1538 dbSNP
rs1478144098 1539 dbSNP
rs1245923677 1549 dbSNP
rs1219026097 1552 dbSNP
rs73955341 1553 dbSNP
rs1286585932 1556 dbSNP
rs1277291542 1586 dbSNP
rs1335247477 1597 dbSNP
rs958676246 1603 dbSNP
rs537369642 1607 dbSNP
rs12900 1609 dbSNP
rs1027694446 1613 dbSNP
rs141059798 1614 dbSNP
rs377716757 1625 dbSNP
rs1305718941 1626 dbSNP
rs962444217 1630 dbSNP
rs1487112739 1637 dbSNP
rs551242304 1639 dbSNP
rs1262851484 1651 dbSNP
rs1367105908 1660 dbSNP
rs1015052016 1670 dbSNP
rs761252447 1678 dbSNP
rs1273450145 1681 dbSNP
rs59990298 1682 dbSNP
rs1159252179 1693 dbSNP
rs12621890 1697 dbSNP
rs1346488420 1700 dbSNP
rs1428497757 1713 dbSNP
rs1297508334 1717 dbSNP
rs1355847499 1730 dbSNP
rs890654839 1730 dbSNP
rs1361761268 1732 dbSNP
rs1050619808 1739 dbSNP
rs996425172 1740 dbSNP
rs1284985324 1745 dbSNP
rs899501226 1756 dbSNP
rs1358139977 1766 dbSNP
rs1177529457 1769 dbSNP
rs1414685823 1771 dbSNP
rs1423976758 1772 dbSNP
rs1190581950 1777 dbSNP
rs1235356305 1782 dbSNP
rs1472239075 1787 dbSNP
rs1177452271 1792 dbSNP
rs1409448891 1795 dbSNP
rs762226582 1798 dbSNP
rs777176390 1807 dbSNP
rs1157957671 1808 dbSNP
rs1376042495 1813 dbSNP
rs1436319911 1816 dbSNP
rs1331906995 1821 dbSNP
rs559109227 1822 dbSNP
rs569226993 1826 dbSNP
rs962482100 1829 dbSNP
rs1447498282 1835 dbSNP
rs183878555 1836 dbSNP
rs935725042 1838 dbSNP
rs1192948101 1841 dbSNP
rs1238136439 1841 dbSNP
rs1285904271 1841 dbSNP
rs1299064411 1841 dbSNP
rs990928194 1843 dbSNP
rs148883290 1845 dbSNP
rs924373671 1849 dbSNP
rs960838806 1853 dbSNP
rs1204768551 1857 dbSNP
rs1437249595 1857 dbSNP
rs192928554 1857 dbSNP
rs1177506903 1864 dbSNP
rs769196847 1867 dbSNP
rs1395190387 1876 dbSNP
rs1455496135 1880 dbSNP
rs949851248 1893 dbSNP
rs917110057 1894 dbSNP
rs556443972 1897 dbSNP
rs1276710242 1898 dbSNP
rs999751266 1900 dbSNP
rs774983179 1901 dbSNP
rs1308578499 1905 dbSNP
rs1371848865 1927 dbSNP
rs1235999097 1934 dbSNP
rs1341566984 1940 dbSNP
rs34630118 1944 dbSNP
rs1344733177 1946 dbSNP
rs920559095 1952 dbSNP
rs1277947756 1953 dbSNP
rs1022293316 1955 dbSNP
rs768565259 1984 dbSNP
rs1357838492 1986 dbSNP
rs1469422127 1991 dbSNP
rs543417291 1992 dbSNP
rs11674513 1993 dbSNP
rs1475606393 1994 dbSNP
rs1448058612 1996 dbSNP
rs1358046090 1998 dbSNP
rs1421254487 2001 dbSNP
rs112141091 2003 dbSNP
rs1330952533 2007 dbSNP
rs188786807 2010 dbSNP
rs1322118974 2012 dbSNP
rs1008997360 2013 dbSNP
rs954874027 2014 dbSNP
rs1029152724 2015 dbSNP
rs554116150 2018 dbSNP
rs1217565128 2019 dbSNP
rs1273499778 2024 dbSNP
rs1336286296 2028 dbSNP
rs112313482 2030 dbSNP
rs532800426 2040 dbSNP
rs929907648 2043 dbSNP
rs539264595 2044 dbSNP
rs1182544566 2045 dbSNP
rs1260701370 2055 dbSNP
rs1477377920 2057 dbSNP
rs534380672 2061 dbSNP
rs111994170 2077 dbSNP
rs1418906112 2077 dbSNP
rs1235777719 2081 dbSNP
rs72848837 2082 dbSNP
rs536678648 2086 dbSNP
rs917077953 2087 dbSNP
rs1055642087 2091 dbSNP
rs937199968 2092 dbSNP
rs1293505031 2093 dbSNP
rs916264452 2094 dbSNP
rs990503037 2110 dbSNP
rs867578462 2114 dbSNP
rs928099178 2115 dbSNP
rs1264302802 2119 dbSNP
rs1350783434 2123 dbSNP
rs780932927 2124 dbSNP
rs1283882853 2125 dbSNP
rs1487824960 2127 dbSNP
rs775901187 2138 dbSNP
rs966980206 2139 dbSNP
rs527268853 2149 dbSNP
rs1300556506 2152 dbSNP
rs72848836 2153 dbSNP
rs183329299 2154 dbSNP
rs1029079231 2157 dbSNP
rs1419449252 2162 dbSNP
rs757808039 2164 dbSNP
rs974900978 2169 dbSNP
rs531648217 2170 dbSNP
rs1393876477 2172 dbSNP
rs1330469331 2181 dbSNP
rs752275521 2182 dbSNP
rs1241743467 2185 dbSNP
rs372745209 2187 dbSNP
rs890583984 2191 dbSNP
rs1032993126 2193 dbSNP
rs1165449831 2196 dbSNP
rs75478287 2199 dbSNP
rs1482155034 2201 dbSNP
rs1198941385 2205 dbSNP
rs999804563 2209 dbSNP
rs902843915 2210 dbSNP
rs994435922 2223 dbSNP
rs1440373841 2230 dbSNP
rs1180632033 2240 dbSNP
rs1019981630 2258 dbSNP
rs1439571171 2265 dbSNP
rs1174832821 2266 dbSNP
rs897050883 2267 dbSNP
rs778615384 2276 dbSNP
rs193298177 2277 dbSNP
rs1396811291 2278 dbSNP
rs894781511 2281 dbSNP
rs1054722377 2293 dbSNP
rs1375532204 2310 dbSNP
rs939101455 2313 dbSNP
rs927754086 2318 dbSNP
rs1303403951 2319 dbSNP
rs1310204417 2320 dbSNP
rs899023766 2322 dbSNP
rs978273258 2324 dbSNP
rs1255598222 2328 dbSNP
rs1458353397 2331 dbSNP
rs1038022312 2334 dbSNP
rs1236372496 2349 dbSNP
rs1457376409 2358 dbSNP
rs548726359 2360 dbSNP
rs529403056 2364 dbSNP
rs1196956327 2372 dbSNP
rs570023006 2381 dbSNP
rs1374013051 2389 dbSNP
rs907835139 2391 dbSNP
rs562626327 2393 dbSNP
rs187731712 2394 dbSNP
rs1441078752 2395 dbSNP
rs922033917 2401 dbSNP
rs1365455603 2404 dbSNP
rs1386170748 2405 dbSNP
rs1320385908 2412 dbSNP
rs771195120 2415 dbSNP
rs1241638280 2416 dbSNP
rs1319756558 2430 dbSNP
rs1220627669 2436 dbSNP
rs1377212870 2439 dbSNP
rs767984218 2440 dbSNP
rs533205045 2441 dbSNP
rs1032549698 2450 dbSNP
rs1444084190 2454 dbSNP
rs1392700637 2462 dbSNP
rs978741094 2465 dbSNP
rs1191134407 2466 dbSNP
rs1017612865 2467 dbSNP
rs564469162 2468 dbSNP
rs987501135 2473 dbSNP
rs1422537093 2478 dbSNP
rs541749898 2478 dbSNP
rs545677846 2480 dbSNP
rs1013946080 2481 dbSNP
rs1348008782 2483 dbSNP
rs1160554712 2485 dbSNP
rs1026838779 2490 dbSNP
rs780062390 2497 dbSNP
rs1342139937 2498 dbSNP
rs1397979109 2503 dbSNP
rs1379731134 2505 dbSNP
rs1177077315 2506 dbSNP
rs1340069624 2508 dbSNP
rs1229120516 2510 dbSNP
rs1491561908 2513 dbSNP
rs1491231664 2514 dbSNP
rs1320002009 2515 dbSNP
rs895536367 2516 dbSNP
rs202050613 2518 dbSNP
rs527950116 2523 dbSNP
rs1489462441 2524 dbSNP
rs1209550005 2528 dbSNP
rs1262958938 2531 dbSNP
rs1487812205 2534 dbSNP
rs1288725819 2543 dbSNP
rs111579091 2544 dbSNP
rs1353846514 2546 dbSNP
rs1410904961 2554 dbSNP
rs1284684678 2562 dbSNP
rs1001326584 2565 dbSNP
rs896949894 2568 dbSNP
rs569224852 2569 dbSNP
rs542032235 2570 dbSNP
rs1385964120 2573 dbSNP
rs1005386351 2574 dbSNP
rs1300002651 2575 dbSNP
rs576558924 2582 dbSNP
rs556816578 2583 dbSNP
rs939052057 2584 dbSNP
rs906266620 2587 dbSNP
rs886377200 2588 dbSNP
rs1051686045 2590 dbSNP
rs1285686760 2597 dbSNP
rs1443360856 2603 dbSNP
rs1211796189 2618 dbSNP
rs1198629703 2619 dbSNP
rs1472167126 2635 dbSNP
rs182316486 2644 dbSNP
rs1265758204 2645 dbSNP
rs945152739 2648 dbSNP
rs915354047 2649 dbSNP
rs139757964 2650 dbSNP
rs1455645781 2650 dbSNP
rs1376334698 2652 dbSNP
rs1397697638 2654 dbSNP
rs71420810 2655 dbSNP
rs534611310 2657 dbSNP
rs1336375125 2658 dbSNP
rs1357684683 2663 dbSNP
rs1452231314 2666 dbSNP
rs1332067778 2667 dbSNP
rs1284691204 2671 dbSNP
rs910835593 2675 dbSNP
rs1202810560 2677 dbSNP
rs1309266009 2691 dbSNP
rs1022285934 2695 dbSNP
rs1346711563 2698 dbSNP
rs921959023 2698 dbSNP
rs1256275735 2700 dbSNP
rs1232032702 2701 dbSNP
rs1321236166 2702 dbSNP
rs974795207 2703 dbSNP
rs1198894139 2706 dbSNP
rs71343625 2708 dbSNP
rs35328801 2710 dbSNP
rs757574630 2710 dbSNP
rs375860432 2711 dbSNP
rs1177916240 2712 dbSNP
rs1388562917 2712 dbSNP
rs1170553173 2713 dbSNP
rs1296458808 2714 dbSNP
rs1424230831 2714 dbSNP
rs1469431842 2714 dbSNP
rs1444731403 2715 dbSNP
rs777503277 2715 dbSNP
rs1328746513 2716 dbSNP
rs1332221237 2717 dbSNP
rs936803222 2719 dbSNP
rs1439263646 2722 dbSNP
rs781259351 2724 dbSNP
rs1402979333 2725 dbSNP
rs1491044087 2725 dbSNP
rs756410884 2726 dbSNP
rs1172254821 2728 dbSNP
rs1323274879 2731 dbSNP
rs1169572522 2734 dbSNP
rs1194641612 2734 dbSNP
rs1196684265 2734 dbSNP
rs1197501870 2734 dbSNP
rs1218853548 2734 dbSNP
rs1226278919 2734 dbSNP
rs1245847961 2734 dbSNP
rs1259650779 2734 dbSNP
rs1267477992 2734 dbSNP
rs1453205687 2734 dbSNP
rs1464105380 2734 dbSNP
rs1478064541 2734 dbSNP
rs397871322 2734 dbSNP
rs772241773 2734 dbSNP
rs1464729157 2735 dbSNP
rs988115726 2735 dbSNP
rs1426308983 2736 dbSNP
rs1265447616 2737 dbSNP
rs956702903 2737 dbSNP
rs1289141238 2740 dbSNP
rs1488475511 2741 dbSNP
rs1477797917 2742 dbSNP
rs1218578322 2751 dbSNP
rs565602874 2752 dbSNP
rs1476938889 2755 dbSNP
rs954668810 2757 dbSNP
rs1369119474 2759 dbSNP
rs10639802 2766 dbSNP
rs34312606 2766 dbSNP
rs1161947486 2767 dbSNP
rs77758280 2768 dbSNP
rs967339001 2769 dbSNP
rs535317960 2770 dbSNP
rs1359033509 2783 dbSNP
rs1381245406 2784 dbSNP
rs569816738 2788 dbSNP
rs918184201 2788 dbSNP
rs959694096 2794 dbSNP
rs1314263382 2802 dbSNP
rs1354263977 2804 dbSNP
rs963496673 2805 dbSNP
rs1459654663 2809 dbSNP
rs1259753928 2811 dbSNP
rs1218975995 2813 dbSNP
rs1485457650 2823 dbSNP
rs1317246483 2830 dbSNP
rs73955339 2835 dbSNP
rs1257178989 2838 dbSNP
rs113823113 2841 dbSNP
rs1185451137 2842 dbSNP
rs762890627 2847 dbSNP
rs1262643594 2861 dbSNP
rs1333578451 2871 dbSNP
rs1450744132 2878 dbSNP
rs77940289 2879 dbSNP
rs1332489044 2882 dbSNP
rs1160988177 2884 dbSNP
rs1004733298 2887 dbSNP
rs547779703 2889 dbSNP
rs886300964 2892 dbSNP
rs1051612834 2893 dbSNP
rs1421896920 2895 dbSNP
rs528016114 2897 dbSNP
rs1003436008 2902 dbSNP
rs375263966 2903 dbSNP
rs906164541 2907 dbSNP
rs900501906 2909 dbSNP
rs1042057075 2922 dbSNP
rs1316090293 2937 dbSNP
rs1009726586 2956 dbSNP
rs893588807 2963 dbSNP
rs1198862751 2964 dbSNP
rs1458317922 2968 dbSNP
rs371895831 2971 dbSNP
rs542496486 2972 dbSNP
rs910742274 2973 dbSNP
rs1211627804 2977 dbSNP
rs1051988007 2981 dbSNP
rs1379760521 2982 dbSNP
rs1356894080 2988 dbSNP
rs77082794 2996 dbSNP
rs919213916 2999 dbSNP
rs554562130 3000 dbSNP
rs963786507 3016 dbSNP
rs992405652 3029 dbSNP
rs770572568 3036 dbSNP
rs1303052772 3039 dbSNP
rs746823040 3039 dbSNP
rs1446318883 3040 dbSNP
rs777523961 3054 dbSNP
rs772024455 3058 dbSNP
rs1262827858 3062 dbSNP
rs1318661536 3070 dbSNP
rs1200656142 3071 dbSNP
rs563091612 3076 dbSNP
rs543152636 3077 dbSNP
rs1325870856 3078 dbSNP
rs1406462276 3089 dbSNP
rs1390593734 3092 dbSNP
rs979811244 3097 dbSNP
rs1479691942 3104 dbSNP
rs577276927 3110 dbSNP
rs1016002954 3121 dbSNP
rs563752700 3124 dbSNP
rs1381597592 3131 dbSNP
rs1178940339 3132 dbSNP
rs1353421238 3134 dbSNP
rs1003382337 3136 dbSNP
rs1295281155 3150 dbSNP
rs970707484 3151 dbSNP
rs560675144 3153 dbSNP
rs1404150868 3156 dbSNP
rs115722543 3161 dbSNP
rs1009261560 3162 dbSNP
rs893528045 3163 dbSNP
rs72848835 3164 dbSNP
rs185774190 3166 dbSNP
rs1356029561 3172 dbSNP
rs1489956764 3175 dbSNP
rs1222155316 3176 dbSNP
rs1286804213 3178 dbSNP
rs1007327572 3180 dbSNP
rs889252456 3182 dbSNP
rs1239708472 3186 dbSNP
rs1184422671 3192 dbSNP
rs1371371344 3195 dbSNP
rs530435608 3201 dbSNP
rs1423956727 3202 dbSNP
rs1437575335 3205 dbSNP
rs1330865937 3206 dbSNP
rs576161128 3207 dbSNP
rs1362220215 3208 dbSNP
rs1422061029 3209 dbSNP
rs1000884652 3216 dbSNP
rs903878781 3217 dbSNP
rs898111370 3233 dbSNP
rs1158662897 3234 dbSNP
rs757520191 3238 dbSNP
rs1245895151 3242 dbSNP
rs942068164 3243 dbSNP
rs1287121232 3247 dbSNP
rs1042475799 3251 dbSNP
rs1213206425 3251 dbSNP
rs1183047791 3252 dbSNP
rs909237099 3254 dbSNP
rs559240054 3257 dbSNP
rs945489717 3260 dbSNP
rs1405298898 3262 dbSNP
rs1398800347 3264 dbSNP
rs1316470913 3265 dbSNP
rs918057127 3271 dbSNP
rs991507049 3277 dbSNP
rs1192545847 3278 dbSNP
rs1304595271 3279 dbSNP
rs937435188 3281 dbSNP
rs926454197 3288 dbSNP
rs938221725 3290 dbSNP
rs981999988 3292 dbSNP
rs1478256197 3294 dbSNP
rs1312369247 3295 dbSNP
rs971035293 3296 dbSNP
rs556284232 3297 dbSNP
rs1460531529 3300 dbSNP
rs1239982327 3304 dbSNP
rs941687607 3304 dbSNP
rs367576805 3305 dbSNP
rs1489195017 3310 dbSNP
rs1264000064 3313 dbSNP
rs1178925925 3318 dbSNP
rs1403996629 3325 dbSNP
rs1469391239 3333 dbSNP
rs1332605330 3337 dbSNP
rs1338000543 3339 dbSNP
rs6746537 3340 dbSNP
rs1315373580 3342 dbSNP
rs1279267235 3351 dbSNP
rs983212841 3359 dbSNP
rs957698741 3360 dbSNP
rs1322168953 3361 dbSNP
rs1198674550 3366 dbSNP
rs182800609 3370 dbSNP
rs372210466 3372 dbSNP
rs1435941670 3375 dbSNP
rs1032018662 3390 dbSNP
rs1181020662 3404 dbSNP
rs1007276463 3405 dbSNP
rs1247054077 3406 dbSNP
rs1030081900 3409 dbSNP
rs888908429 3412 dbSNP
rs975905042 3420 dbSNP
rs567080698 3423 dbSNP
rs1402412760 3424 dbSNP
rs1017506460 3430 dbSNP
rs371396904 3432 dbSNP
rs1341608054 3436 dbSNP
rs1408654174 3442 dbSNP
rs1298315278 3444 dbSNP
rs1429474526 3445 dbSNP
rs997724721 3446 dbSNP
rs903847881 3454 dbSNP
rs898053677 3462 dbSNP
rs1021384567 3475 dbSNP
rs1280945210 3484 dbSNP
rs1009617447 3494 dbSNP
rs1218873397 3497 dbSNP
rs1271375064 3497 dbSNP
rs1336952371 3504 dbSNP
rs1414668847 3505 dbSNP
rs191095651 3511 dbSNP
rs1453093894 3513 dbSNP
rs942291927 3516 dbSNP
rs1056618699 3520 dbSNP
rs547147593 3526 dbSNP
rs753269204 3534 dbSNP
rs1424188983 3535 dbSNP
rs1194671239 3547 dbSNP
rs765287134 3548 dbSNP
rs1484959093 3550 dbSNP
rs1474504537 3551 dbSNP
rs1167807542 3554 dbSNP
rs905383890 3558 dbSNP
rs1301609276 3564 dbSNP
rs759623631 3568 dbSNP
rs1400217451 3575 dbSNP
rs1211164850 3577 dbSNP
rs1324142607 3598 dbSNP
rs367960961 3604 dbSNP
rs1284301666 3607 dbSNP
rs1442002038 3624 dbSNP
rs928749876 3630 dbSNP
rs908844160 3631 dbSNP
rs1325390242 3643 dbSNP
rs187164436 3655 dbSNP
rs531982697 3665 dbSNP
rs949223908 3667 dbSNP
rs1220808278 3669 dbSNP
rs1488526979 3670 dbSNP
rs1217613612 3676 dbSNP
rs923036392 3676 dbSNP
rs1445329448 3686 dbSNP
rs1319245398 3687 dbSNP
rs181698848 3688 dbSNP
rs1369134854 3694 dbSNP
rs1278163449 3705 dbSNP
rs975831324 3706 dbSNP
rs988039915 3707 dbSNP
rs1420736817 3709 dbSNP
rs964493407 3711 dbSNP
rs1359324958 3712 dbSNP
rs1381331945 3717 dbSNP
rs1304019225 3718 dbSNP
rs776766874 3726 dbSNP
rs1448301882 3729 dbSNP
rs1384380769 3731 dbSNP
rs1450339658 3732 dbSNP
rs1314373264 3735 dbSNP
rs1404846676 3738 dbSNP
rs1017891369 3741 dbSNP
rs766647407 3743 dbSNP
rs1032010329 3750 dbSNP
rs1462768051 3752 dbSNP
rs985828814 3757 dbSNP
rs1243122004 3770 dbSNP
rs552701869 3772 dbSNP
rs1424038740 3773 dbSNP
rs968373407 3784 dbSNP
rs139586495 3793 dbSNP
rs997694719 3796 dbSNP
rs1426653482 3815 dbSNP
rs760858409 3815 dbSNP
rs563866324 3819 dbSNP
rs150565949 3828 dbSNP
rs1009584779 3836 dbSNP
rs896517981 3839 dbSNP
rs1377484844 3865 dbSNP
rs1393098273 3866 dbSNP
rs1318546348 3870 dbSNP
rs1015517100 3871 dbSNP
rs1006436855 3872 dbSNP
rs888061799 3876 dbSNP
rs1238603167 3877 dbSNP
rs533902821 3879 dbSNP
rs1200723625 3884 dbSNP
rs1325733182 3884 dbSNP
rs1001511667 3885 dbSNP
rs1481208743 3887 dbSNP
rs1038951025 3889 dbSNP
rs190667149 3891 dbSNP
rs1045786193 3892 dbSNP
rs946130443 3894 dbSNP
rs377642943 3896 dbSNP
rs561679242 3901 dbSNP
rs1400513802 3902 dbSNP
rs1418927974 3909 dbSNP
rs1199088934 3911 dbSNP
rs541768647 3913 dbSNP
rs1052736769 3914 dbSNP
rs11693759 3915 dbSNP
rs1175031632 3916 dbSNP
rs556108811 3917 dbSNP
rs1400411025 3920 dbSNP
rs1203047677 3922 dbSNP
rs1323959406 3923 dbSNP
rs1463452759 3924 dbSNP
rs1296453195 3934 dbSNP
rs925220975 3936 dbSNP
rs1387185623 3940 dbSNP
rs539674225 3952 dbSNP
rs1347576308 3954 dbSNP
rs1221917493 3956 dbSNP
rs370921164 3960 dbSNP
rs928959424 3973 dbSNP
rs1228344183 3977 dbSNP
rs554350595 3978 dbSNP
rs1451392506 3980 dbSNP
rs1271533505 3981 dbSNP
rs71307270 3981 dbSNP
rs1400839933 3982 dbSNP
rs1297337215 3985 dbSNP
rs1489679961 3985 dbSNP
rs1460412953 3986 dbSNP
rs1198317811 3988 dbSNP
rs1351511207 3995 dbSNP
rs1165604718 3996 dbSNP
rs1424154979 3998 dbSNP
rs1304663326 4000 dbSNP
rs1363503891 4000 dbSNP
rs1403319788 4000 dbSNP
rs1428368371 4000 dbSNP
rs1429821862 4000 dbSNP
rs1458376188 4000 dbSNP
rs532957837 4000 dbSNP
rs547298368 4000 dbSNP
rs751835593 4000 dbSNP
rs758357749 4000 dbSNP
rs76109896 4000 dbSNP
rs868570192 4000 dbSNP
rs1423812999 4004 dbSNP
rs1164318596 4006 dbSNP
rs1345956321 4008 dbSNP
rs1433190101 4010 dbSNP
rs1287119861 4011 dbSNP
rs922961421 4012 dbSNP
rs953001977 4014 dbSNP
rs548211440 4020 dbSNP
rs922945615 4024 dbSNP
rs534287753 4025 dbSNP
rs943132027 4028 dbSNP
rs74912284 4030 dbSNP
rs910348796 4041 dbSNP
rs1213232499 4045 dbSNP
rs979695407 4058 dbSNP
rs1461430176 4059 dbSNP
rs1185311729 4071 dbSNP
rs774448498 4073 dbSNP
rs12692069 4079 dbSNP
rs548521566 4080 dbSNP
rs1006372686 4083 dbSNP
rs1402606422 4085 dbSNP
rs1157284591 4088 dbSNP
rs562762807 4095 dbSNP
rs1475106803 4097 dbSNP
rs538169001 4100 dbSNP
rs1381174621 4116 dbSNP
rs1452555900 4126 dbSNP
rs1280446547 4127 dbSNP
rs1376060076 4128 dbSNP
rs1221711080 4132 dbSNP
rs142830769 4133 dbSNP
rs1323592573 4136 dbSNP
rs374477752 4140 dbSNP
rs1001753986 4143 dbSNP
rs1460762605 4144 dbSNP
rs761267224 4147 dbSNP
rs779520910 4156 dbSNP
rs1234379363 4160 dbSNP
rs960694926 4163 dbSNP
rs1175682867 4168 dbSNP
rs1046148278 4170 dbSNP
rs373843499 4171 dbSNP
rs775818281 4173 dbSNP
rs891910127 4174 dbSNP
rs755767424 4178 dbSNP
rs370439267 4179 dbSNP
rs112484012 4182 dbSNP
rs376067454 4183 dbSNP
rs1330228439 4185 dbSNP
rs138331589 4187 dbSNP
rs1288140501 4190 dbSNP
rs11688522 4191 dbSNP
rs887309589 4197 dbSNP
rs922924274 4198 dbSNP
rs568480457 4199 dbSNP
rs998431152 4204 dbSNP
rs1363801769 4220 dbSNP
rs1203512770 4222 dbSNP
rs901485106 4230 dbSNP
rs1040020762 4232 dbSNP
rs910308897 4233 dbSNP
rs112810975 4234 dbSNP
rs961806184 4235 dbSNP
rs186069108 4236 dbSNP
rs1422210520 4239 dbSNP
rs778191782 4240 dbSNP
rs11539730 4250 dbSNP
rs1307735563 4254 dbSNP
rs1366593982 4256 dbSNP
rs952183542 4259 dbSNP
rs11539731 4261 dbSNP
rs1242761265 4262 dbSNP
rs1034487834 4269 dbSNP
rs1329980955 4270 dbSNP
rs1430763984 4274 dbSNP
rs1268491963 4281 dbSNP
rs527340141 4282 dbSNP
rs960621028 4283 dbSNP
rs1001701719 4290 dbSNP
rs972094588 4299 dbSNP
rs980786189 4300 dbSNP
rs969469303 4302 dbSNP
rs1017418673 4305 dbSNP
rs1266156732 4308 dbSNP
rs561545711 4315 dbSNP
rs1005656829 4318 dbSNP
rs1024301180 4320 dbSNP
rs758820181 4322 dbSNP
rs951626214 4327 dbSNP
rs1010682845 4331 dbSNP
rs1389517300 4335 dbSNP
rs1025801298 4336 dbSNP
rs532188353 4337 dbSNP
rs998355820 4339 dbSNP
rs901452577 4349 dbSNP
rs180923762 4351 dbSNP
rs891861780 4361 dbSNP
rs1039989779 4370 dbSNP
rs1236397898 4374 dbSNP
rs1007626456 4387 dbSNP
rs888811163 4390 dbSNP
rs1043863811 4393 dbSNP
rs368974566 4395 dbSNP
rs1313795332 4398 dbSNP
rs1355821725 4399 dbSNP
rs1301643871 4401 dbSNP
rs1033070780 4406 dbSNP
rs1404258987 4409 dbSNP
rs1286413630 4413 dbSNP
rs1343517832 4421 dbSNP
rs1445416952 4431 dbSNP
rs946522846 4433 dbSNP
rs1202748203 4434 dbSNP
rs892270862 4435 dbSNP
rs1300140531 4441 dbSNP
rs1000294670 4442 dbSNP
rs939225269 4443 dbSNP
rs903657286 4447 dbSNP
rs1453988000 4451 dbSNP
rs1287403642 4456 dbSNP
rs1382105051 4459 dbSNP
rs1456297838 4461 dbSNP
rs1336841530 4462 dbSNP
rs1050256700 4464 dbSNP
rs1467764091 4465 dbSNP
rs1450358739 4482 dbSNP
rs376020399 4486 dbSNP
rs113884588 4489 dbSNP
rs901793867 4491 dbSNP
rs375801210 4493 dbSNP
rs1479760669 4499 dbSNP
rs1327372886 4502 dbSNP
rs1208145412 4508 dbSNP
rs546113173 4509 dbSNP
rs1463002579 4515 dbSNP
rs1199307014 4520 dbSNP
rs1255904305 4535 dbSNP
rs1195009802 4537 dbSNP
rs1420096665 4541 dbSNP
rs1183510668 4542 dbSNP
rs577159426 4554 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::|||||   :|||||| 
Target 5' aucAUGCCAUU---GCACUCCa 3'
10 - 28
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000272645.4 | 3UTR | UGAGCCAAGAUCAUGCCAUUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.859 8.5e-5 -0.676 5.6e-3 13 Click to see details
GSE28544 Breast cancer 0.684 1.1e-4 0.652 2.8e-4 24 Click to see details
GSE38226 Liver fibrosis 0.485 1.3e-2 0.398 3.7e-2 21 Click to see details
GSE27834 Pluripotent stem cells 0.546 1.4e-2 0.456 3.8e-2 16 Click to see details
GSE21687 Ependynoma primary tumors -0.229 3.4e-2 -0.174 8.5e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.367 4.2e-2 -0.567 2.4e-3 23 Click to see details
GSE17306 Multiple myeloma -0.198 8.6e-2 -0.122 2.0e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.183 2.0e-1 0.181 2.0e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.163 2.2e-1 -0.288 8.1e-2 25 Click to see details
GSE14794 Lymphoblastoid cells -0.058 2.9e-1 -0.011 4.6e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.098 3.2e-1 -0.093 3.3e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.15 3.2e-1 -0.168 3.0e-1 12 Click to see details
GSE17498 Multiple myeloma 0.072 3.3e-1 0.003 4.9e-1 40 Click to see details
GSE32688 Pancreatic cancer -0.055 3.8e-1 0.009 4.8e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.105 4.2e-1 -0.143 3.9e-1 6 Click to see details
GSE21849 B cell lymphoma 0.037 4.2e-1 0.061 3.8e-1 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.043 4.3e-1 0.023 4.6e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.27 0.03 0.067 0.32 49 Click to see details
STAD -0.637 0.04 -0.738 0.02 8 Click to see details
HNSC 0.941 0.11 0.500 0.33 3 Click to see details
ESCA 0.482 0.21 0.400 0.25 5 Click to see details
KIRP 0.295 0.22 -0.033 0.47 9 Click to see details
THCA -0.273 0.33 -0.100 0.44 5 Click to see details
KIRC -0.045 0.41 -0.027 0.44 29 Click to see details
CHOL 0.088 0.41 0.000 0.5 9 Click to see details
KICH 0.019 0.48 -0.095 0.41 8 Click to see details
KICH 0.019 0.48 -0.095 0.41 8 Click to see details
KICH 0.019 0.48 -0.095 0.41 8 Click to see details
KICH 0.019 0.48 -0.095 0.41 8 Click to see details
KICH 0.019 0.48 -0.095 0.41 8 Click to see details
KICH 0.019 0.48 -0.095 0.41 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18