miRTarBase - #MIRT669547 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ALG14   
Synonyms CMS15
Description ALG14, UDP-N-acetylglucosaminyltransferase subunit
Transcript NM_144988   
Expression
Putative miRNA Targets on ALG14
3'UTR of ALG14
(miRNA target sites are highlighted)
>ALG14|NM_144988|3'UTR
   1 CAAATGGCAACTGACTTCTTTAGAATTTTGCAGTTAACAGTAGTATGTACTCAAATTGGGGGGAAAAAAACCCTACATGT
  81 TTCTTGTAAAGGCGTCTGACAGTCCTGAGAATTATTGATGGTAAGGAATAAAAAATGTACAGATGACTCAGTGAAGAAAC
 161 TGAGGCTTCTCTTATGAAACAAACATTGATAAACGTAACTACTAAATGTTTATGCCTCTGTAAACCAAATTTCTTTTCTA
 241 GATAAAAATATGTATTACTACCTGCAAATTTTCTTCTGGCTGTTTTAGTAGTATTTTTTTTACAGAACTAAATATAGAGT
 321 TTGTATGATTAGTAATATTTCCTGTCCTACAGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUA-ACAGUGUGAGGu 5'
            || : |:| ||  ||| ||| 
Target 5' gtAAAGGCGTCTG--ACAGTCCt 3'
86 - 106 116.00 -9.60
2
miRNA  3' guuUGUGGUAA-CAGUGUGAGGu 5'
             ::|: ||| || |:|:|:| 
Target 5' tttGTATGATTAGTAATATTTCc 3'
320 - 342 111.00 -7.10
3
miRNA  3' guUUGUGGUAACAGUGUGAGgu 5'
            |||| :| | | ::||||  
Target 5' ttAACAGTAGTAT-GTACTCaa 3'
34 - 54 107.00 -8.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30153180 15 COSMIC
COSN30515902 18 COSMIC
COSN30179173 42 COSMIC
COSN30147861 52 COSMIC
COSN30549051 63 COSMIC
COSN13568707 64 COSMIC
COSN20058687 64 COSMIC
COSN13568706 70 COSMIC
COSN31574926 93 COSMIC
COSN18777830 353 COSMIC
COSN5170286 862 COSMIC
COSN16972339 1608 COSMIC
COSN224001 1677 COSMIC
COSN19113489 1742 COSMIC
COSN27162061 2878 COSMIC
COSN5170285 3556 COSMIC
COSN16258416 3651 COSMIC
COSN10056626 3766 COSMIC
COSN27536585 4216 COSMIC
COSN27369678 4217 COSMIC
COSN22520017 4242 COSMIC
COSN18771601 4994 COSMIC
COSN14464629 5094 COSMIC
COSN23199822 5685 COSMIC
COSN1464198 6172 COSMIC
COSN26266840 6662 COSMIC
COSN6050957 7139 COSMIC
COSN16143630 7196 COSMIC
COSN6473781 7203 COSMIC
COSN25770585 7215 COSMIC
COSN6473780 7340 COSMIC
COSN22454313 7382 COSMIC
COSN6050956 7672 COSMIC
COSN22570032 7989 COSMIC
COSN24322274 8169 COSMIC
rs7539517 7761 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs112335700 7 dbSNP
rs1040766612 8 dbSNP
rs760367713 8 dbSNP
rs757661309 12 dbSNP
rs143040411 13 dbSNP
rs1465850129 14 dbSNP
rs764623435 17 dbSNP
rs1213590030 18 dbSNP
rs763442364 21 dbSNP
rs886374685 26 dbSNP
rs775600527 35 dbSNP
rs765319440 39 dbSNP
rs777079109 43 dbSNP
rs376803101 45 dbSNP
rs1361464482 46 dbSNP
rs759471629 47 dbSNP
rs1437458066 50 dbSNP
rs1279173114 52 dbSNP
rs79206206 54 dbSNP
rs1339038861 55 dbSNP
rs552681984 56 dbSNP
rs1455898175 64 dbSNP
rs979844768 64 dbSNP
rs1320134914 65 dbSNP
rs1383711492 66 dbSNP
rs946171388 68 dbSNP
rs949825162 70 dbSNP
rs547996899 71 dbSNP
rs916976401 71 dbSNP
rs539550497 72 dbSNP
rs1396086570 75 dbSNP
rs913400574 77 dbSNP
rs955691169 88 dbSNP
rs570453160 94 dbSNP
rs1235211331 115 dbSNP
rs1472453960 123 dbSNP
rs1170444352 126 dbSNP
rs1177696695 129 dbSNP
rs557052288 143 dbSNP
rs1463142662 147 dbSNP
rs1423918650 149 dbSNP
rs1169643232 155 dbSNP
rs369799841 156 dbSNP
rs1057266366 175 dbSNP
rs778761373 185 dbSNP
rs1259497203 187 dbSNP
rs1471488235 190 dbSNP
rs538442637 194 dbSNP
rs569443425 195 dbSNP
rs1029149108 196 dbSNP
rs112318591 201 dbSNP
rs1358633094 207 dbSNP
rs180812585 208 dbSNP
rs1290752023 221 dbSNP
rs1255476834 229 dbSNP
rs149024884 232 dbSNP
rs558518381 233 dbSNP
rs973348525 236 dbSNP
rs1258919397 240 dbSNP
rs1275964261 259 dbSNP
rs1441331296 267 dbSNP
rs1204523048 282 dbSNP
rs1253902669 284 dbSNP
rs1471539238 288 dbSNP
rs1005295750 294 dbSNP
rs1218442590 301 dbSNP
rs886409306 302 dbSNP
rs566886425 314 dbSNP
rs1014756147 315 dbSNP
rs994694124 316 dbSNP
rs1424632790 319 dbSNP
rs1410609361 324 dbSNP
rs1246080987 330 dbSNP
rs987329231 331 dbSNP
rs905733510 332 dbSNP
rs1340389429 337 dbSNP
rs144953323 340 dbSNP
rs1392600297 342 dbSNP
rs533507065 343 dbSNP
rs1400621317 344 dbSNP
rs564250428 347 dbSNP
rs1218057617 352 dbSNP
rs1442345077 353 dbSNP
rs1343772875 354 dbSNP
rs56812521 354 dbSNP
rs1419678866 355 dbSNP
rs1276100723 357 dbSNP
rs1163621080 360 dbSNP
rs1482057679 361 dbSNP
rs1204324632 363 dbSNP
rs1472460760 370 dbSNP
rs1164766854 377 dbSNP
rs1170599702 377 dbSNP
rs1196400518 377 dbSNP
rs1246360050 377 dbSNP
rs1267875349 377 dbSNP
rs1276951325 377 dbSNP
rs1388375848 377 dbSNP
rs1393429765 377 dbSNP
rs1429732736 377 dbSNP
rs1453112776 377 dbSNP
rs1475837535 377 dbSNP
rs1485883356 377 dbSNP
rs1491070927 377 dbSNP
rs368855559 377 dbSNP
rs386367730 377 dbSNP
rs6694639 378 dbSNP
rs1366624390 380 dbSNP
rs1207866463 387 dbSNP
rs1185564149 388 dbSNP
rs1052837357 393 dbSNP
rs1190738049 396 dbSNP
rs1441577592 400 dbSNP
rs934354348 402 dbSNP
rs1239040338 403 dbSNP
rs544253800 405 dbSNP
rs1198182412 407 dbSNP
rs530640275 410 dbSNP
rs1275511422 414 dbSNP
rs1210791823 415 dbSNP
rs1448942497 415 dbSNP
rs979705997 425 dbSNP
rs1282907755 430 dbSNP
rs1163079000 431 dbSNP
rs904196443 435 dbSNP
rs6682185 436 dbSNP
rs1240593803 454 dbSNP
rs1022254721 456 dbSNP
rs777842823 458 dbSNP
rs1010437015 460 dbSNP
rs561512206 464 dbSNP
rs1457499985 465 dbSNP
rs1322136890 473 dbSNP
rs377102175 476 dbSNP
rs542143955 479 dbSNP
rs1444215578 482 dbSNP
rs922151986 496 dbSNP
rs1242480988 515 dbSNP
rs975335438 520 dbSNP
rs1210290534 521 dbSNP
rs1266485434 527 dbSNP
rs1464571530 528 dbSNP
rs1201134372 532 dbSNP
rs1324022799 543 dbSNP
rs892075667 551 dbSNP
rs1422636856 560 dbSNP
rs1057211907 562 dbSNP
rs772241066 563 dbSNP
rs1404519176 571 dbSNP
rs1243365228 586 dbSNP
rs966199110 586 dbSNP
rs1157324945 588 dbSNP
rs938872190 592 dbSNP
rs866394057 597 dbSNP
rs905930395 601 dbSNP
rs1044495018 608 dbSNP
rs931269976 623 dbSNP
rs1160177422 627 dbSNP
rs573034996 632 dbSNP
rs1421604886 645 dbSNP
rs919937985 646 dbSNP
rs1380923046 647 dbSNP
rs190035377 655 dbSNP
rs372329053 656 dbSNP
rs940572911 658 dbSNP
rs545475878 659 dbSNP
rs1346394890 660 dbSNP
rs576723802 664 dbSNP
rs184668543 668 dbSNP
rs994767434 672 dbSNP
rs905805513 676 dbSNP
rs987277105 685 dbSNP
rs954540065 686 dbSNP
rs1044279536 687 dbSNP
rs1288370540 691 dbSNP
rs1484294629 698 dbSNP
rs6694535 699 dbSNP
rs1418199776 702 dbSNP
rs575943041 703 dbSNP
rs1355048805 704 dbSNP
rs895640584 710 dbSNP
rs974521419 714 dbSNP
rs529238012 720 dbSNP
rs1237299452 721 dbSNP
rs140689657 739 dbSNP
rs1306002665 755 dbSNP
rs1349634371 760 dbSNP
rs1220104924 761 dbSNP
rs1303689414 766 dbSNP
rs1275035144 778 dbSNP
rs1275396284 792 dbSNP
rs1435526459 792 dbSNP
rs536192057 793 dbSNP
rs892025245 794 dbSNP
rs934382088 795 dbSNP
rs1193229002 801 dbSNP
rs1269049509 806 dbSNP
rs1420300340 808 dbSNP
rs1431050523 820 dbSNP
rs1172516193 822 dbSNP
rs1390229604 825 dbSNP
rs1431611040 826 dbSNP
rs1057049344 827 dbSNP
rs1035918284 831 dbSNP
rs1353791290 837 dbSNP
rs1436952299 841 dbSNP
rs1158172529 847 dbSNP
rs1002963522 848 dbSNP
rs906036240 857 dbSNP
rs567043355 858 dbSNP
rs1045000601 862 dbSNP
rs1322796154 863 dbSNP
rs1224278450 864 dbSNP
rs1042760884 866 dbSNP
rs1173323102 872 dbSNP
rs931405413 881 dbSNP
rs1192601083 882 dbSNP
rs1248176454 894 dbSNP
rs898601680 899 dbSNP
rs1186061957 900 dbSNP
rs193190557 909 dbSNP
rs1405841608 919 dbSNP
rs1166705548 920 dbSNP
rs1196286508 923 dbSNP
rs922182820 932 dbSNP
rs146844717 933 dbSNP
rs1213866804 936 dbSNP
rs906425652 937 dbSNP
rs1269629715 938 dbSNP
rs1278906379 939 dbSNP
rs1380574059 943 dbSNP
rs1218206365 946 dbSNP
rs974988682 947 dbSNP
rs12027212 948 dbSNP
rs944904909 948 dbSNP
rs1465939608 949 dbSNP
rs201130274 949 dbSNP
rs1206320999 950 dbSNP
rs550678498 950 dbSNP
rs1183514973 951 dbSNP
rs950816551 951 dbSNP
rs1159562517 952 dbSNP
rs1474764843 952 dbSNP
rs1391147871 954 dbSNP
rs1400355619 955 dbSNP
rs1027670801 956 dbSNP
rs1273929562 956 dbSNP
rs1282945818 956 dbSNP
rs1359797034 956 dbSNP
rs1491076534 956 dbSNP
rs57730557 956 dbSNP
rs71789346 956 dbSNP
rs796772518 956 dbSNP
rs1339801635 957 dbSNP
rs1491253302 957 dbSNP
rs1491323941 958 dbSNP
rs1398249102 959 dbSNP
rs1211541928 961 dbSNP
rs115022928 965 dbSNP
rs1334923675 967 dbSNP
rs969995424 968 dbSNP
rs940019643 970 dbSNP
rs1471765921 974 dbSNP
rs1414179890 978 dbSNP
rs1426051277 985 dbSNP
rs1423302342 987 dbSNP
rs1416258058 991 dbSNP
rs907763801 997 dbSNP
rs1173328655 1000 dbSNP
rs1051688636 1001 dbSNP
rs1014168202 1004 dbSNP
rs561576758 1012 dbSNP
rs921785459 1016 dbSNP
rs1362694343 1019 dbSNP
rs778852785 1023 dbSNP
rs975011084 1024 dbSNP
rs1208798048 1025 dbSNP
rs1440383495 1033 dbSNP
rs548082441 1039 dbSNP
rs188250905 1061 dbSNP
rs1259549918 1069 dbSNP
rs754857007 1070 dbSNP
rs201529145 1075 dbSNP
rs1253790986 1077 dbSNP
rs1481952271 1078 dbSNP
rs955716313 1081 dbSNP
rs1035866035 1088 dbSNP
rs1479107286 1089 dbSNP
rs1170934341 1095 dbSNP
rs1394540619 1097 dbSNP
rs1431016649 1105 dbSNP
rs780811977 1107 dbSNP
rs932313158 1109 dbSNP
rs1379792628 1112 dbSNP
rs1409771304 1115 dbSNP
rs1003079150 1117 dbSNP
rs1290761941 1118 dbSNP
rs546047110 1127 dbSNP
rs1023118110 1137 dbSNP
rs996099794 1139 dbSNP
rs1369605695 1145 dbSNP
rs1228406669 1153 dbSNP
rs1276703123 1156 dbSNP
rs576928517 1160 dbSNP
rs944962673 1166 dbSNP
rs912100413 1178 dbSNP
rs983656197 1180 dbSNP
rs67037422 1184 dbSNP
rs920685317 1184 dbSNP
rs1191975854 1194 dbSNP
rs1252530641 1198 dbSNP
rs1450176549 1213 dbSNP
rs1190529932 1216 dbSNP
rs1388892725 1218 dbSNP
rs563256702 1224 dbSNP
rs758812017 1225 dbSNP
rs898554701 1226 dbSNP
rs1393305527 1229 dbSNP
rs1466482428 1230 dbSNP
rs1399938220 1238 dbSNP
rs1393202092 1244 dbSNP
rs1435214062 1249 dbSNP
rs1037129246 1251 dbSNP
rs1168975529 1253 dbSNP
rs1324659681 1264 dbSNP
rs1004181681 1266 dbSNP
rs970069701 1268 dbSNP
rs543570355 1273 dbSNP
rs1051135600 1276 dbSNP
rs1471498016 1279 dbSNP
rs1465479672 1281 dbSNP
rs1210711500 1287 dbSNP
rs1239641998 1295 dbSNP
rs1428496778 1299 dbSNP
rs1188849458 1313 dbSNP
rs750770334 1315 dbSNP
rs1198815818 1328 dbSNP
rs1445724001 1341 dbSNP
rs1474437815 1350 dbSNP
rs574580939 1352 dbSNP
rs939833122 1363 dbSNP
rs1255986381 1366 dbSNP
rs909623708 1369 dbSNP
rs1322300269 1374 dbSNP
rs1311871560 1375 dbSNP
rs1227832559 1376 dbSNP
rs1380602987 1377 dbSNP
rs1342516020 1378 dbSNP
rs1334755231 1379 dbSNP
rs200252153 1379 dbSNP
rs34544830 1379 dbSNP
rs1231254454 1382 dbSNP
rs1031986300 1387 dbSNP
rs185009013 1388 dbSNP
rs1376420389 1389 dbSNP
rs1296857731 1390 dbSNP
rs1459737932 1391 dbSNP
rs1259103998 1392 dbSNP
rs1484953128 1393 dbSNP
rs56027924 1393 dbSNP
rs66473748 1393 dbSNP
rs866471595 1393 dbSNP
rs869065768 1393 dbSNP
rs1413134728 1394 dbSNP
rs368148066 1394 dbSNP
rs1472748099 1395 dbSNP
rs1174199181 1398 dbSNP
rs920959554 1398 dbSNP
rs1351005468 1399 dbSNP
rs1172608884 1402 dbSNP
rs1164627720 1403 dbSNP
rs192374043 1403 dbSNP
rs1404314717 1408 dbSNP
rs1412832510 1417 dbSNP
rs1312108702 1422 dbSNP
rs1350876909 1429 dbSNP
rs74101946 1430 dbSNP
rs996597544 1433 dbSNP
rs921868405 1435 dbSNP
rs1316505816 1436 dbSNP
rs1178705537 1463 dbSNP
rs1257805043 1467 dbSNP
rs1346406304 1468 dbSNP
rs1210782581 1471 dbSNP
rs899521797 1473 dbSNP
rs1235947914 1479 dbSNP
rs1484245972 1483 dbSNP
rs762331998 1484 dbSNP
rs1248010034 1490 dbSNP
rs72720235 1497 dbSNP
rs1488657939 1499 dbSNP
rs1169245415 1500 dbSNP
rs1199010384 1500 dbSNP
rs1264808059 1508 dbSNP
rs947222416 1520 dbSNP
rs750142342 1530 dbSNP
rs553412413 1537 dbSNP
rs540092754 1549 dbSNP
rs988524419 1550 dbSNP
rs943679070 1561 dbSNP
rs1372919804 1569 dbSNP
rs1387545296 1581 dbSNP
rs1428795795 1584 dbSNP
rs201913644 1593 dbSNP
rs1368869315 1596 dbSNP
rs1275996085 1597 dbSNP
rs187846098 1600 dbSNP
rs1376486620 1601 dbSNP
rs1305082085 1606 dbSNP
rs1388904761 1607 dbSNP
rs1192407961 1608 dbSNP
rs1452046753 1608 dbSNP
rs375420936 1608 dbSNP
rs74101945 1608 dbSNP
rs1328179316 1609 dbSNP
rs1353697279 1609 dbSNP
rs1491585752 1609 dbSNP
rs751618933 1609 dbSNP
rs756826529 1618 dbSNP
rs1295394680 1619 dbSNP
rs1440296639 1619 dbSNP
rs34405745 1619 dbSNP
rs397789053 1619 dbSNP
rs867181561 1619 dbSNP
rs1322698785 1620 dbSNP
rs868195882 1620 dbSNP
rs1293306829 1624 dbSNP
rs1047930548 1626 dbSNP
rs929507745 1628 dbSNP
rs1184706215 1629 dbSNP
rs1486841538 1629 dbSNP
rs764201161 1629 dbSNP
rs968954126 1629 dbSNP
rs1403704393 1637 dbSNP
rs1461091831 1639 dbSNP
rs1321366057 1645 dbSNP
rs770433671 1648 dbSNP
rs920758910 1650 dbSNP
rs1037772441 1651 dbSNP
rs955831336 1653 dbSNP
rs1362984832 1659 dbSNP
rs1235564759 1661 dbSNP
rs1291785381 1663 dbSNP
rs928298555 1664 dbSNP
rs1418519261 1666 dbSNP
rs1268288753 1672 dbSNP
rs1448227958 1675 dbSNP
rs184924319 1676 dbSNP
rs1177714366 1677 dbSNP
rs140170217 1686 dbSNP
rs1189854061 1704 dbSNP
rs1266493982 1708 dbSNP
rs992863211 1711 dbSNP
rs1160184839 1714 dbSNP
rs760053786 1716 dbSNP
rs537196531 1717 dbSNP
rs1158426470 1721 dbSNP
rs12131726 1729 dbSNP
rs963210952 1733 dbSNP
rs777275371 1734 dbSNP
rs568208915 1737 dbSNP
rs1417135762 1740 dbSNP
rs151108791 1742 dbSNP
rs548625476 1750 dbSNP
rs891249827 1763 dbSNP
rs766906449 1768 dbSNP
rs528293437 1769 dbSNP
rs1353012981 1773 dbSNP
rs1352331120 1775 dbSNP
rs1221612196 1792 dbSNP
rs997272308 1797 dbSNP
rs1348569158 1798 dbSNP
rs796826809 1800 dbSNP
rs1278012576 1805 dbSNP
rs1485228649 1807 dbSNP
rs1182568135 1824 dbSNP
rs1234844164 1826 dbSNP
rs1176738708 1827 dbSNP
rs900390093 1833 dbSNP
rs1021450681 1834 dbSNP
rs372581571 1840 dbSNP
rs559461357 1848 dbSNP
rs552220510 1849 dbSNP
rs963845870 1851 dbSNP
rs532424093 1852 dbSNP
rs1007901642 1859 dbSNP
rs772397803 1862 dbSNP
rs886764098 1863 dbSNP
rs892971758 1868 dbSNP
rs1398864415 1869 dbSNP
rs7551774 1870 dbSNP
rs1235773053 1880 dbSNP
rs1301184396 1886 dbSNP
rs934399584 1898 dbSNP
rs1196198807 1905 dbSNP
rs1304076038 1906 dbSNP
rs928408918 1907 dbSNP
rs981104820 1908 dbSNP
rs948402638 1909 dbSNP
rs1455651694 1915 dbSNP
rs1191777017 1917 dbSNP
rs551718215 1919 dbSNP
rs974732398 1921 dbSNP
rs963031693 1932 dbSNP
rs1170057705 1934 dbSNP
rs1394771815 1941 dbSNP
rs182469782 1967 dbSNP
rs564627815 1977 dbSNP
rs774353428 1995 dbSNP
rs955418892 2016 dbSNP
rs1029766056 2017 dbSNP
rs996825781 2025 dbSNP
rs768582908 2029 dbSNP
rs749287507 2030 dbSNP
rs914466558 2036 dbSNP
rs1337209202 2042 dbSNP
rs1213714684 2049 dbSNP
rs1274067590 2052 dbSNP
rs779948834 2054 dbSNP
rs893085952 2055 dbSNP
rs1052863474 2060 dbSNP
rs1252431458 2063 dbSNP
rs1448139882 2067 dbSNP
rs934510646 2068 dbSNP
rs1371783549 2070 dbSNP
rs1475302063 2072 dbSNP
rs1259814470 2075 dbSNP
rs560823569 2077 dbSNP
rs1418170785 2079 dbSNP
rs1008388083 2086 dbSNP
rs906931367 2087 dbSNP
rs755980441 2101 dbSNP
rs1483725512 2103 dbSNP
rs1045896516 2106 dbSNP
rs1025250470 2109 dbSNP
rs541092844 2111 dbSNP
rs201647839 2121 dbSNP
rs10718566 2122 dbSNP
rs1429809264 2122 dbSNP
rs397769492 2122 dbSNP
rs201383876 2123 dbSNP
rs1279392366 2135 dbSNP
rs1218634941 2136 dbSNP
rs755522872 2149 dbSNP
rs1314310621 2157 dbSNP
rs1231675114 2171 dbSNP
rs868858102 2177 dbSNP
rs1351506045 2181 dbSNP
rs1013095850 2182 dbSNP
rs894628453 2188 dbSNP
rs549855138 2206 dbSNP
rs546022184 2212 dbSNP
rs573373824 2212 dbSNP
rs78169992 2214 dbSNP
rs1041758028 2237 dbSNP
rs1162354041 2238 dbSNP
rs1416639586 2243 dbSNP
rs1159754929 2251 dbSNP
rs1382751614 2254 dbSNP
rs769353525 2257 dbSNP
rs947330688 2262 dbSNP
rs914499988 2266 dbSNP
rs1292928477 2269 dbSNP
rs371549968 2280 dbSNP
rs975727691 2282 dbSNP
rs142813220 2290 dbSNP
rs1370091498 2292 dbSNP
rs1241323435 2293 dbSNP
rs982919994 2303 dbSNP
rs1189747475 2304 dbSNP
rs1424425739 2311 dbSNP
rs1212218224 2313 dbSNP
rs1242776070 2318 dbSNP
rs1484902594 2328 dbSNP
rs912364131 2337 dbSNP
rs1255083994 2340 dbSNP
rs1419273819 2343 dbSNP
rs1183420920 2349 dbSNP
rs1361549711 2355 dbSNP
rs1419096457 2359 dbSNP
rs1174194978 2363 dbSNP
rs1377139259 2379 dbSNP
rs1432658303 2386 dbSNP
rs986594104 2396 dbSNP
rs1397539406 2410 dbSNP
rs951145655 2412 dbSNP
rs1459257330 2430 dbSNP
rs1259176390 2435 dbSNP
rs1025325843 2445 dbSNP
rs955533367 2446 dbSNP
rs973714459 2447 dbSNP
rs879358150 2448 dbSNP
rs1210669458 2459 dbSNP
rs962320792 2465 dbSNP
rs1267712673 2472 dbSNP
rs1197181787 2497 dbSNP
rs1244906467 2502 dbSNP
rs577120052 2503 dbSNP
rs964197087 2504 dbSNP
rs1396852588 2515 dbSNP
rs368611199 2517 dbSNP
rs1022706956 2523 dbSNP
rs556978958 2525 dbSNP
rs1448617617 2528 dbSNP
rs1377159216 2535 dbSNP
rs893028828 2541 dbSNP
rs1296680560 2555 dbSNP
rs1399771985 2564 dbSNP
rs894667466 2571 dbSNP
rs114152337 2574 dbSNP
rs1369493448 2575 dbSNP
rs1234185341 2577 dbSNP
rs763766973 2590 dbSNP
rs907046063 2598 dbSNP
rs1407967778 2603 dbSNP
rs1392826444 2605 dbSNP
rs1225630990 2613 dbSNP
rs1249287033 2617 dbSNP
rs903270338 2618 dbSNP
rs1213820951 2624 dbSNP
rs757969118 2633 dbSNP
rs1041789227 2635 dbSNP
rs780863387 2639 dbSNP
rs1458479032 2640 dbSNP
rs1467133347 2654 dbSNP
rs1190553873 2659 dbSNP
rs1420069950 2665 dbSNP
rs1384760359 2666 dbSNP
rs867724857 2671 dbSNP
rs1168010418 2673 dbSNP
rs754444807 2677 dbSNP
rs766763234 2679 dbSNP
rs1462143749 2684 dbSNP
rs947403774 2689 dbSNP
rs1392374343 2695 dbSNP
rs894253584 2698 dbSNP
rs1039646396 2703 dbSNP
rs1038425728 2712 dbSNP
rs1364644427 2720 dbSNP
rs941018442 2721 dbSNP
rs1295273549 2722 dbSNP
rs1316979902 2724 dbSNP
rs908761105 2728 dbSNP
rs987058464 2734 dbSNP
rs929774325 2738 dbSNP
rs76650128 2744 dbSNP
rs1486789433 2750 dbSNP
rs1047348310 2759 dbSNP
rs1262188573 2765 dbSNP
rs1475697560 2782 dbSNP
rs1167381938 2789 dbSNP
rs1415885850 2791 dbSNP
rs1270108789 2792 dbSNP
rs568083684 2793 dbSNP
rs1474558836 2794 dbSNP
rs1356251720 2797 dbSNP
rs934271475 2798 dbSNP
rs1298041448 2801 dbSNP
rs527618394 2814 dbSNP
rs1023703504 2815 dbSNP
rs1416944161 2816 dbSNP
rs991785250 2822 dbSNP
rs1376466519 2824 dbSNP
rs922754962 2833 dbSNP
rs1227282477 2834 dbSNP
rs1284320178 2840 dbSNP
rs1318721713 2859 dbSNP
rs959227472 2864 dbSNP
rs1241647518 2868 dbSNP
rs975638481 2877 dbSNP
rs1485885974 2897 dbSNP
rs964459739 2897 dbSNP
rs1255716873 2899 dbSNP
rs1472577060 2900 dbSNP
rs1177909904 2904 dbSNP
rs915345252 2910 dbSNP
rs1417323470 2927 dbSNP
rs1308021404 2929 dbSNP
rs1376541522 2930 dbSNP
rs989408781 2939 dbSNP
rs1439775335 2941 dbSNP
rs1311409152 2942 dbSNP
rs1332539223 2943 dbSNP
rs376925669 2945 dbSNP
rs761132522 2949 dbSNP
rs554778002 2959 dbSNP
rs1279695592 2963 dbSNP
rs1375435811 2964 dbSNP
rs998725558 2965 dbSNP
rs1307866228 2967 dbSNP
rs971372594 2970 dbSNP
rs1348022277 2977 dbSNP
rs1011646971 2981 dbSNP
rs148497069 2991 dbSNP
rs1442141078 2993 dbSNP
rs1012776332 2998 dbSNP
rs747202460 3005 dbSNP
rs893168641 3008 dbSNP
rs1040121355 3010 dbSNP
rs201207199 3016 dbSNP
rs1395725821 3017 dbSNP
rs1410806190 3017 dbSNP
rs1455657820 3017 dbSNP
rs35557702 3017 dbSNP
rs542720073 3017 dbSNP
rs796901925 3017 dbSNP
rs1329280143 3019 dbSNP
rs1356109806 3024 dbSNP
rs1381175957 3025 dbSNP
rs1444436379 3026 dbSNP
rs144734151 3029 dbSNP
rs565763156 3031 dbSNP
rs552344516 3041 dbSNP
rs894188416 3045 dbSNP
rs1371024334 3051 dbSNP
rs1235862261 3052 dbSNP
rs767789951 3053 dbSNP
rs143105059 3058 dbSNP
rs1343840439 3064 dbSNP
rs1248884672 3072 dbSNP
rs1214848825 3073 dbSNP
rs886771920 3077 dbSNP
rs891041320 3088 dbSNP
rs1198516632 3093 dbSNP
rs1254192483 3101 dbSNP
rs1050992171 3112 dbSNP
rs1191821495 3121 dbSNP
rs929847993 3124 dbSNP
rs918419111 3128 dbSNP
rs1169906348 3130 dbSNP
rs569975169 3133 dbSNP
rs1046799488 3134 dbSNP
rs1038108782 3141 dbSNP
rs1463884444 3147 dbSNP
rs1267336945 3157 dbSNP
rs1218196290 3158 dbSNP
rs550053084 3159 dbSNP
rs6687235 3163 dbSNP
rs2797623 3164 dbSNP
rs1221780357 3174 dbSNP
rs12076668 3177 dbSNP
rs540804947 3189 dbSNP
rs1275274657 3214 dbSNP
rs1232217043 3216 dbSNP
rs1343595744 3218 dbSNP
rs1274269997 3219 dbSNP
rs1299905887 3221 dbSNP
rs774549420 3235 dbSNP
rs1208628039 3245 dbSNP
rs527360419 3249 dbSNP
rs942893400 3252 dbSNP
rs1447682542 3256 dbSNP
rs1317715726 3264 dbSNP
rs1261314752 3266 dbSNP
rs147399959 3268 dbSNP
rs989525587 3275 dbSNP
rs956824495 3277 dbSNP
rs1462921636 3279 dbSNP
rs370742438 3281 dbSNP
rs768779041 3287 dbSNP
rs545979927 3291 dbSNP
rs1319807103 3297 dbSNP
rs1337954572 3320 dbSNP
rs981687219 3325 dbSNP
rs576986409 3326 dbSNP
rs1357801202 3327 dbSNP
rs775440779 3334 dbSNP
rs190685818 3336 dbSNP
rs971701899 3348 dbSNP
rs1265391016 3351 dbSNP
rs1478433116 3369 dbSNP
rs1241073933 3374 dbSNP
rs1024244086 3381 dbSNP
rs1013129958 3393 dbSNP
rs1488075523 3394 dbSNP
rs1211918710 3412 dbSNP
rs958569167 3424 dbSNP
rs769573720 3427 dbSNP
rs745692664 3432 dbSNP
rs188396567 3449 dbSNP
rs1011721875 3452 dbSNP
rs12119383 3457 dbSNP
rs182825109 3473 dbSNP
rs886887605 3474 dbSNP
rs1418681405 3486 dbSNP
rs1025299063 3492 dbSNP
rs1377597459 3505 dbSNP
rs1394663920 3506 dbSNP
rs997871776 3508 dbSNP
rs901391306 3531 dbSNP
rs1241873337 3536 dbSNP
rs1307140768 3546 dbSNP
rs1039961253 3556 dbSNP
rs942822253 3558 dbSNP
rs893970503 3577 dbSNP
rs191966031 3582 dbSNP
rs147780364 3584 dbSNP
rs1255283366 3586 dbSNP
rs897023565 3591 dbSNP
rs1335037812 3593 dbSNP
rs6692792 3604 dbSNP
rs1180474620 3619 dbSNP
rs1377900876 3623 dbSNP
rs1469619556 3631 dbSNP
rs935403984 3637 dbSNP
rs1379007443 3638 dbSNP
rs924051514 3641 dbSNP
rs982054787 3642 dbSNP
rs1397712027 3645 dbSNP
rs1393608176 3648 dbSNP
rs1329938918 3649 dbSNP
rs949420905 3653 dbSNP
rs1235120850 3661 dbSNP
rs916322502 3664 dbSNP
rs1310651661 3667 dbSNP
rs1054872469 3673 dbSNP
rs1255162760 3691 dbSNP
rs917114753 3694 dbSNP
rs939052447 3700 dbSNP
rs117910560 3712 dbSNP
rs1236297587 3719 dbSNP
rs1456879341 3724 dbSNP
rs74101940 3730 dbSNP
rs1016765148 3735 dbSNP
rs983980029 3739 dbSNP
rs1184288124 3740 dbSNP
rs1473464493 3741 dbSNP
rs1237709190 3744 dbSNP
rs1182526845 3748 dbSNP
rs1459694061 3749 dbSNP
rs1259812391 3750 dbSNP
rs1169081936 3755 dbSNP
rs1168152441 3757 dbSNP
rs1478588690 3761 dbSNP
rs913462498 3761 dbSNP
rs1270743571 3762 dbSNP
rs367921877 3762 dbSNP
rs951089525 3762 dbSNP
rs1025414345 3765 dbSNP
rs1386386200 3765 dbSNP
rs139371329 3766 dbSNP
rs61322014 3766 dbSNP
rs9324351 3766 dbSNP
rs1212897996 3767 dbSNP
rs1381348751 3768 dbSNP
rs1478637068 3770 dbSNP
rs900837007 3770 dbSNP
rs1018395539 3771 dbSNP
rs1423414224 3771 dbSNP
rs1462397894 3781 dbSNP
rs1007133476 3784 dbSNP
rs1452263714 3784 dbSNP
rs1491436061 3785 dbSNP
rs866411987 3785 dbSNP
rs1186521488 3786 dbSNP
rs1233774726 3786 dbSNP
rs1289594689 3786 dbSNP
rs1306010113 3786 dbSNP
rs1314789584 3786 dbSNP
rs1339633415 3786 dbSNP
rs1342603991 3786 dbSNP
rs1398442878 3786 dbSNP
rs1412266139 3786 dbSNP
rs1457479310 3786 dbSNP
rs1491350738 3786 dbSNP
rs66813692 3786 dbSNP
rs957528096 3786 dbSNP
rs560069094 3787 dbSNP
rs6669087 3787 dbSNP
rs1236179525 3788 dbSNP
rs1333839661 3789 dbSNP
rs1466434254 3797 dbSNP
rs1362586223 3798 dbSNP
rs1418058861 3799 dbSNP
rs1297846500 3805 dbSNP
rs985560686 3806 dbSNP
rs1448489643 3812 dbSNP
rs1304442833 3815 dbSNP
rs1376869342 3816 dbSNP
rs1227722503 3819 dbSNP
rs1309314386 3823 dbSNP
rs538839535 3828 dbSNP
rs1355266564 3830 dbSNP
rs1168880401 3831 dbSNP
rs894089592 3841 dbSNP
rs199910049 3843 dbSNP
rs1212675025 3848 dbSNP
rs1406605249 3849 dbSNP
rs1236141381 3850 dbSNP
rs2766011 3853 dbSNP
rs1178320586 3857 dbSNP
rs1162357195 3861 dbSNP
rs1029607020 3862 dbSNP
rs1395918725 3867 dbSNP
rs550115811 3875 dbSNP
rs1416437912 3877 dbSNP
rs866200332 3878 dbSNP
rs902577913 3880 dbSNP
rs1447146501 3885 dbSNP
rs1239583515 3899 dbSNP
rs138655638 3900 dbSNP
rs1307976687 3913 dbSNP
rs567178914 3915 dbSNP
rs1480156299 3918 dbSNP
rs1231113367 3922 dbSNP
rs1223768759 3931 dbSNP
rs1276901652 3943 dbSNP
rs1312000409 3947 dbSNP
rs1205771809 3949 dbSNP
rs949539852 3951 dbSNP
rs1240581785 3958 dbSNP
rs916578490 3961 dbSNP
rs1005830857 3972 dbSNP
rs894974949 3988 dbSNP
rs6684009 4004 dbSNP
rs1479112201 4007 dbSNP
rs1171068226 4010 dbSNP
rs1422737449 4029 dbSNP
rs1413712769 4033 dbSNP
rs939098993 4052 dbSNP
rs1402360974 4054 dbSNP
rs1357598190 4065 dbSNP
rs527436827 4066 dbSNP
rs12121738 4069 dbSNP
rs544659703 4074 dbSNP
rs913495532 4095 dbSNP
rs1260458934 4114 dbSNP
rs532581313 4117 dbSNP
rs951199745 4120 dbSNP
rs1290630258 4135 dbSNP
rs112532463 4141 dbSNP
rs1196954271 4148 dbSNP
rs1246350358 4150 dbSNP
rs1475901061 4152 dbSNP
rs1194093818 4157 dbSNP
rs985979704 4160 dbSNP
rs1463969632 4161 dbSNP
rs1169907246 4170 dbSNP
rs1390756331 4172 dbSNP
rs1406609507 4178 dbSNP
rs976528394 4179 dbSNP
rs955499204 4180 dbSNP
rs1348927630 4187 dbSNP
rs563522158 4191 dbSNP
rs965538884 4208 dbSNP
rs1381795871 4209 dbSNP
rs1158807469 4210 dbSNP
rs1017928167 4212 dbSNP
rs1405598119 4215 dbSNP
rs201980571 4216 dbSNP
rs10688407 4217 dbSNP
rs961350156 4217 dbSNP
rs71813336 4218 dbSNP
rs527493985 4219 dbSNP
rs958259789 4219 dbSNP
rs553903233 4221 dbSNP
rs894998749 4221 dbSNP
rs1368985410 4222 dbSNP
rs1488789711 4223 dbSNP
rs1268048073 4227 dbSNP
rs1033531513 4231 dbSNP
rs1419887439 4232 dbSNP
rs199939255 4232 dbSNP
rs540480495 4232 dbSNP
rs377181005 4235 dbSNP
rs1242515236 4237 dbSNP
rs1003763977 4239 dbSNP
rs1488127133 4242 dbSNP
rs899555710 4242 dbSNP
rs906283499 4244 dbSNP
rs1240110822 4246 dbSNP
rs1241935242 4249 dbSNP
rs1042125758 4250 dbSNP
rs575072187 4251 dbSNP
rs1160010192 4256 dbSNP
rs999609864 4271 dbSNP
rs1418770359 4273 dbSNP
rs1173500061 4276 dbSNP
rs1404845458 4277 dbSNP
rs893474745 4278 dbSNP
rs1334103153 4280 dbSNP
rs1377657637 4283 dbSNP
rs1449089719 4286 dbSNP
rs1307251459 4287 dbSNP
rs141631818 4290 dbSNP
rs1047034229 4291 dbSNP
rs1256331206 4300 dbSNP
rs1346891156 4305 dbSNP
rs1013657524 4308 dbSNP
rs911437007 4309 dbSNP
rs541423422 4310 dbSNP
rs1458210383 4316 dbSNP
rs1179958195 4321 dbSNP
rs1235876430 4322 dbSNP
rs934116199 4327 dbSNP
rs766267016 4329 dbSNP
rs1361984707 4335 dbSNP
rs1199166011 4343 dbSNP
rs922698308 4349 dbSNP
rs942037745 4350 dbSNP
rs1452666729 4351 dbSNP
rs1343042532 4352 dbSNP
rs909764079 4376 dbSNP
rs1467692538 4396 dbSNP
rs1048346905 4401 dbSNP
rs1376294979 4402 dbSNP
rs572303556 4406 dbSNP
rs929919525 4416 dbSNP
rs762643256 4418 dbSNP
rs1303698704 4428 dbSNP
rs2797622 4430 dbSNP
rs909871237 4435 dbSNP
rs1428532511 4438 dbSNP
rs1197107172 4447 dbSNP
rs1478759528 4458 dbSNP
rs1255553271 4463 dbSNP
rs984496717 4464 dbSNP
rs1265501588 4465 dbSNP
rs147981154 4471 dbSNP
rs1199128403 4473 dbSNP
rs965139146 4481 dbSNP
rs576340250 4489 dbSNP
rs556373220 4490 dbSNP
rs386633604 4491 dbSNP
rs536200971 4497 dbSNP
rs764263765 4498 dbSNP
rs796780785 4499 dbSNP
rs1324638289 4503 dbSNP
rs1353955129 4506 dbSNP
rs970541685 4513 dbSNP
rs1222289417 4524 dbSNP
rs1295429704 4532 dbSNP
rs1342918878 4533 dbSNP
rs1404618592 4538 dbSNP
rs1295724828 4552 dbSNP
rs1340925721 4554 dbSNP
rs1381124853 4557 dbSNP
rs1032006951 4558 dbSNP
rs1220334071 4558 dbSNP
rs1306916483 4576 dbSNP
rs1009303052 4581 dbSNP
rs999724435 4582 dbSNP
rs1266752552 4584 dbSNP
rs1487285334 4585 dbSNP
rs893504477 4586 dbSNP
rs763047193 4589 dbSNP
rs775378515 4591 dbSNP
rs1405165719 4598 dbSNP
rs1264288305 4620 dbSNP
rs1053471911 4623 dbSNP
rs1025121707 4635 dbSNP
rs1007616435 4658 dbSNP
rs1014188238 4659 dbSNP
rs890048027 4662 dbSNP
rs1166973083 4667 dbSNP
rs1366836954 4672 dbSNP
rs1424209289 4673 dbSNP
rs1299051435 4674 dbSNP
rs1360862189 4676 dbSNP
rs1401620101 4681 dbSNP
rs895200841 4689 dbSNP
rs1361163965 4702 dbSNP
rs1228864406 4715 dbSNP
rs567544616 4720 dbSNP
rs1050399193 4721 dbSNP
rs1055623455 4722 dbSNP
rs1244715601 4724 dbSNP
rs185679594 4725 dbSNP
rs759459324 4727 dbSNP
rs922753770 4729 dbSNP
rs2797621 4735 dbSNP
rs770681269 4736 dbSNP
rs940119948 4738 dbSNP
rs1047796931 4740 dbSNP
rs929867167 4741 dbSNP
rs140280499 4743 dbSNP
rs1040861308 4746 dbSNP
rs1159404238 4747 dbSNP
rs984140745 4750 dbSNP
rs76912221 4754 dbSNP
rs1320663193 4758 dbSNP
rs1344425476 4762 dbSNP
rs910940654 4765 dbSNP
rs985611845 4767 dbSNP
rs1226077354 4770 dbSNP
rs12058601 4772 dbSNP
rs191048470 4773 dbSNP
rs12058599 4774 dbSNP
rs77833164 4779 dbSNP
rs1221754379 4783 dbSNP
rs1283955505 4790 dbSNP
rs1381557425 4791 dbSNP
rs1254768535 4793 dbSNP
rs1461316042 4797 dbSNP
rs1334485985 4799 dbSNP
rs779567762 4801 dbSNP
rs957794365 4806 dbSNP
rs1448664461 4807 dbSNP
rs1406907152 4813 dbSNP
rs1025658929 4814 dbSNP
rs1007236595 4815 dbSNP
rs561627535 4821 dbSNP
rs1469270285 4824 dbSNP
rs959806358 4825 dbSNP
rs1033894640 4835 dbSNP
rs1331394230 4835 dbSNP
rs1460402328 4838 dbSNP
rs1439507310 4839 dbSNP
rs200164310 4839 dbSNP
rs541334161 4839 dbSNP
rs572420168 4840 dbSNP
rs565264564 4841 dbSNP
rs545548078 4842 dbSNP
rs576610126 4848 dbSNP
rs1006304482 4849 dbSNP
rs558045855 4851 dbSNP
rs1050032050 4853 dbSNP
rs556438818 4854 dbSNP
rs1199858943 4856 dbSNP
rs1242722104 4857 dbSNP
rs1456515780 4859 dbSNP
rs556414990 4860 dbSNP
rs887892771 4864 dbSNP
rs536457715 4865 dbSNP
rs1439864784 4868 dbSNP
rs573710013 4869 dbSNP
rs1037178041 4873 dbSNP
rs757793988 4874 dbSNP
rs778215814 4878 dbSNP
rs1401770084 4882 dbSNP
rs754503121 4895 dbSNP
rs1327676536 4896 dbSNP
rs1041368661 4897 dbSNP
rs1048948428 4908 dbSNP
rs1266745986 4910 dbSNP
rs1246026684 4921 dbSNP
rs1219727119 4923 dbSNP
rs372890541 4926 dbSNP
rs926599337 4946 dbSNP
rs889609824 4957 dbSNP
rs879724189 4958 dbSNP
rs1290738043 4959 dbSNP
rs982055081 4959 dbSNP
rs1220573215 4961 dbSNP
rs1266440631 4962 dbSNP
rs1049576772 4978 dbSNP
rs1425682694 4981 dbSNP
rs1312396795 4982 dbSNP
rs913799601 4987 dbSNP
rs34667912 4990 dbSNP
rs1406692114 4991 dbSNP
rs1448734556 4992 dbSNP
rs1336057172 4993 dbSNP
rs1327926419 4994 dbSNP
rs554059836 5003 dbSNP
rs1400992626 5004 dbSNP
rs533826478 5006 dbSNP
rs1439669538 5008 dbSNP
rs986263946 5008 dbSNP
rs1243974494 5011 dbSNP
rs1291323703 5016 dbSNP
rs1354771807 5016 dbSNP
rs953100953 5017 dbSNP
rs1263642354 5018 dbSNP
rs570936987 5022 dbSNP
rs1425330790 5025 dbSNP
rs1384865614 5043 dbSNP
rs1192413048 5051 dbSNP
rs375175574 5060 dbSNP
rs1237496234 5066 dbSNP
rs750947322 5080 dbSNP
rs997113718 5081 dbSNP
rs1161206561 5082 dbSNP
rs1384210597 5087 dbSNP
rs1419986912 5091 dbSNP
rs901435916 5096 dbSNP
rs1383296430 5106 dbSNP
rs945042553 5115 dbSNP
rs537588357 5117 dbSNP
rs1335461913 5127 dbSNP
rs1342272954 5128 dbSNP
rs1450537171 5130 dbSNP
rs1364793211 5139 dbSNP
rs1377897793 5139 dbSNP
rs918134598 5151 dbSNP
rs1262224326 5152 dbSNP
rs781706076 5157 dbSNP
rs1271633078 5159 dbSNP
rs1004371037 5161 dbSNP
rs888609135 5162 dbSNP
rs796977596 5170 dbSNP
rs1242035499 5173 dbSNP
rs568619613 5173 dbSNP
rs548755342 5174 dbSNP
rs1362361267 5177 dbSNP
rs1453496783 5180 dbSNP
rs148224960 5181 dbSNP
rs1327514488 5182 dbSNP
rs952087016 5193 dbSNP
rs1468745992 5214 dbSNP
rs1336124960 5220 dbSNP
rs1278779880 5222 dbSNP
rs905248178 5223 dbSNP
rs1449203001 5242 dbSNP
rs1236564972 5243 dbSNP
rs1332787083 5245 dbSNP
rs1046453019 5253 dbSNP
rs544523939 5253 dbSNP
rs949328251 5255 dbSNP
rs1026415262 5258 dbSNP
rs145412634 5262 dbSNP
rs1201721758 5263 dbSNP
rs1261912145 5273 dbSNP
rs901843135 5278 dbSNP
rs988050441 5299 dbSNP
rs548103689 5305 dbSNP
rs1301353999 5318 dbSNP
rs751874883 5323 dbSNP
rs1402706429 5340 dbSNP
rs936559593 5342 dbSNP
rs925093186 5348 dbSNP
rs1479715614 5356 dbSNP
rs1158379902 5358 dbSNP
rs527957885 5359 dbSNP
rs1463587326 5361 dbSNP
rs1049525997 5371 dbSNP
rs1383657140 5376 dbSNP
rs549588728 5377 dbSNP
rs953264916 5386 dbSNP
rs565326397 5389 dbSNP
rs778460120 5393 dbSNP
rs1323927446 5396 dbSNP
rs1266213332 5402 dbSNP
rs1217271985 5408 dbSNP
rs1347183698 5408 dbSNP
rs1447253226 5409 dbSNP
rs1283064160 5410 dbSNP
rs1203182037 5411 dbSNP
rs1325339378 5412 dbSNP
rs1318599763 5413 dbSNP
rs1228955453 5418 dbSNP
rs545412644 5422 dbSNP
rs575105335 5422 dbSNP
rs376837400 5423 dbSNP
rs1042121049 5424 dbSNP
rs1271427014 5424 dbSNP
rs35295125 5424 dbSNP
rs386367728 5424 dbSNP
rs386367729 5424 dbSNP
rs559803060 5424 dbSNP
rs781508570 5426 dbSNP
rs1015837005 5429 dbSNP
rs756645115 5430 dbSNP
rs531699034 5433 dbSNP
rs888650879 5456 dbSNP
rs1281495560 5458 dbSNP
rs1402864079 5467 dbSNP
rs1302374387 5468 dbSNP
rs763098768 5476 dbSNP
rs1432923032 5481 dbSNP
rs1027580600 5484 dbSNP
rs369616362 5489 dbSNP
rs1327269263 5490 dbSNP
rs74369904 5503 dbSNP
rs765291666 5504 dbSNP
rs984929680 5506 dbSNP
rs61772638 5520 dbSNP
rs573798706 5521 dbSNP
rs776475618 5525 dbSNP
rs375381664 5537 dbSNP
rs372317766 5539 dbSNP
rs770950086 5543 dbSNP
rs150049358 5550 dbSNP
rs1427769002 5557 dbSNP
rs547112747 5566 dbSNP
rs1261056703 5571 dbSNP
rs527246410 5584 dbSNP
rs577504854 5586 dbSNP
rs892471460 5595 dbSNP
rs1383600050 5607 dbSNP
rs565055754 5608 dbSNP
rs936597290 5612 dbSNP
rs925198431 5615 dbSNP
rs1050686657 5618 dbSNP
rs771851274 5619 dbSNP
rs1287054517 5622 dbSNP
rs1361271648 5623 dbSNP
rs931799764 5630 dbSNP
rs1316599906 5632 dbSNP
rs1028202511 5656 dbSNP
rs1287134543 5657 dbSNP
rs975801481 5661 dbSNP
rs373402790 5665 dbSNP
rs747818879 5666 dbSNP
rs1042238652 5674 dbSNP
rs557588021 5682 dbSNP
rs896261792 5693 dbSNP
rs537450200 5697 dbSNP
rs1340076443 5698 dbSNP
rs984445174 5706 dbSNP
rs568484373 5711 dbSNP
rs1002795107 5714 dbSNP
rs969577665 5719 dbSNP
rs545827127 5720 dbSNP
rs1445317964 5723 dbSNP
rs1049343690 5734 dbSNP
rs535184777 5735 dbSNP
rs919411352 5738 dbSNP
rs1403298033 5747 dbSNP
rs1404557949 5755 dbSNP
rs892522904 5762 dbSNP
rs1375155728 5763 dbSNP
rs1173085285 5783 dbSNP
rs1222407087 5787 dbSNP
rs1306794171 5826 dbSNP
rs1411014713 5826 dbSNP
rs1052451637 5827 dbSNP
rs181012859 5838 dbSNP
rs547672310 5845 dbSNP
rs966501383 5854 dbSNP
rs903774439 5861 dbSNP
rs528034449 5862 dbSNP
rs1199425504 5863 dbSNP
rs986501466 5867 dbSNP
rs1234805520 5869 dbSNP
rs77027408 5870 dbSNP
rs531763862 5871 dbSNP
rs139276963 5874 dbSNP
rs531414382 5875 dbSNP
rs1468825540 5880 dbSNP
rs923088852 5883 dbSNP
rs1234535435 5884 dbSNP
rs1355897282 5896 dbSNP
rs1205213719 5902 dbSNP
rs1297920638 5913 dbSNP
rs1020728330 5920 dbSNP
rs13343089 5922 dbSNP
rs1281925643 5923 dbSNP
rs189119211 5931 dbSNP
rs1272431225 5932 dbSNP
rs1323518132 5944 dbSNP
rs940457712 5945 dbSNP
rs768097593 5948 dbSNP
rs1436254897 5949 dbSNP
rs984866761 5950 dbSNP
rs951714265 5952 dbSNP
rs1490454650 5953 dbSNP
rs1056225715 5963 dbSNP
rs1002238704 5966 dbSNP
rs1377528578 5968 dbSNP
rs1167955749 5975 dbSNP
rs529363295 5989 dbSNP
rs1421061808 5992 dbSNP
rs13343085 5999 dbSNP
rs1366511202 6009 dbSNP
rs1301736478 6016 dbSNP
rs1345402952 6040 dbSNP
rs1432150672 6046 dbSNP
rs1271956825 6047 dbSNP
rs1337548927 6063 dbSNP
rs1214140854 6068 dbSNP
rs1025159986 6069 dbSNP
rs1361930521 6075 dbSNP
rs184953112 6085 dbSNP
rs1326313968 6089 dbSNP
rs2766010 6090 dbSNP
rs1385484710 6091 dbSNP
rs1243286067 6116 dbSNP
rs1474143041 6116 dbSNP
rs1185490299 6120 dbSNP
rs956775559 6122 dbSNP
rs1426208876 6142 dbSNP
rs930863564 6151 dbSNP
rs542413975 6154 dbSNP
rs1320859762 6155 dbSNP
rs1401740037 6155 dbSNP
rs919527775 6161 dbSNP
rs1430084163 6166 dbSNP
rs1409961248 6168 dbSNP
rs1036907861 6169 dbSNP
rs1385222186 6171 dbSNP
rs1050795342 6191 dbSNP
rs996094516 6193 dbSNP
rs1355392443 6205 dbSNP
rs901740310 6210 dbSNP
rs1286256116 6212 dbSNP
rs1445263002 6216 dbSNP
rs1480287146 6218 dbSNP
rs533366471 6221 dbSNP
rs944900309 6222 dbSNP
rs911924246 6229 dbSNP
rs1231056510 6231 dbSNP
rs796370866 6232 dbSNP
rs781574758 6234 dbSNP
rs59054466 6236 dbSNP
rs940488735 6237 dbSNP
rs373902312 6240 dbSNP
rs554201154 6247 dbSNP
rs1368192986 6248 dbSNP
rs886198151 6251 dbSNP
rs181189917 6255 dbSNP
rs1048798384 6256 dbSNP
rs747382996 6257 dbSNP
rs926962166 6258 dbSNP
rs981461022 6261 dbSNP
rs144754017 6262 dbSNP
rs967917186 6271 dbSNP
rs1336644593 6273 dbSNP
rs1309652338 6280 dbSNP
rs1239476052 6285 dbSNP
rs140791247 6303 dbSNP
rs918133330 6307 dbSNP
rs1224643277 6313 dbSNP
rs1373273659 6314 dbSNP
rs1286935777 6323 dbSNP
rs1020886358 6332 dbSNP
rs1462273481 6339 dbSNP
rs988347567 6343 dbSNP
rs992332383 6345 dbSNP
rs112751436 6346 dbSNP
rs956847909 6346 dbSNP
rs867766954 6347 dbSNP
rs1472520860 6356 dbSNP
rs1001953249 6362 dbSNP
rs1029007576 6372 dbSNP
rs74525588 6379 dbSNP
rs80144846 6380 dbSNP
rs201377149 6381 dbSNP
rs75981115 6381 dbSNP
rs996110713 6381 dbSNP
rs535177551 6382 dbSNP
rs1409071950 6386 dbSNP
rs1027300696 6389 dbSNP
rs994516739 6390 dbSNP
rs898045022 6393 dbSNP
rs1221133676 6397 dbSNP
rs577920076 6398 dbSNP
rs1346558189 6403 dbSNP
rs1197203833 6409 dbSNP
rs147263581 6423 dbSNP
rs1415303233 6430 dbSNP
rs1482935745 6431 dbSNP
rs944991555 6440 dbSNP
rs890618882 6454 dbSNP
rs1200684443 6469 dbSNP
rs528270796 6470 dbSNP
rs1418231415 6476 dbSNP
rs752912657 6477 dbSNP
rs534396839 6480 dbSNP
rs12563809 6481 dbSNP
rs1051059963 6486 dbSNP
rs1049310558 6487 dbSNP
rs932052393 6488 dbSNP
rs1408981815 6489 dbSNP
rs7555380 6494 dbSNP
rs1480717518 6501 dbSNP
rs978706175 6513 dbSNP
rs765468593 6526 dbSNP
rs1198754287 6530 dbSNP
rs1487644563 6538 dbSNP
rs755042391 6538 dbSNP
rs753905213 6541 dbSNP
rs988074161 6542 dbSNP
rs1216968509 6557 dbSNP
rs1294442721 6563 dbSNP
rs918205358 6564 dbSNP
rs960942105 6568 dbSNP
rs552121593 6572 dbSNP
rs7552973 6574 dbSNP
rs569278035 6575 dbSNP
rs549096207 6576 dbSNP
rs1389762881 6580 dbSNP
rs1027412840 6581 dbSNP
rs1367230888 6585 dbSNP
rs370796659 6586 dbSNP
rs897485251 6590 dbSNP
rs1029452793 6591 dbSNP
rs1015036358 6592 dbSNP
rs1363656253 6593 dbSNP
rs966010572 6597 dbSNP
rs1246288695 6607 dbSNP
rs766432036 6608 dbSNP
rs890724590 6609 dbSNP
rs1261814930 6617 dbSNP
rs1487167408 6618 dbSNP
rs1203439789 6626 dbSNP
rs753865497 6641 dbSNP
rs1445409016 6645 dbSNP
rs1050594782 6646 dbSNP
rs1386787604 6646 dbSNP
rs1428460930 6656 dbSNP
rs932166588 6658 dbSNP
rs1345690824 6660 dbSNP
rs904584110 6661 dbSNP
rs529245076 6662 dbSNP
rs7542803 6663 dbSNP
rs1027504862 6670 dbSNP
rs1338292032 6671 dbSNP
rs546660010 6682 dbSNP
rs1228088644 6691 dbSNP
rs1187395579 6692 dbSNP
rs1237547245 6693 dbSNP
rs80171725 6697 dbSNP
rs760622167 6701 dbSNP
rs7542789 6703 dbSNP
rs1483075231 6704 dbSNP
rs544127701 6712 dbSNP
rs1263004456 6715 dbSNP
rs1420745068 6726 dbSNP
rs1230444887 6731 dbSNP
rs1013966456 6732 dbSNP
rs149534362 6732 dbSNP
rs980565335 6734 dbSNP
rs1469858866 6735 dbSNP
rs1056761901 6744 dbSNP
rs1357044976 6744 dbSNP
rs1446881989 6744 dbSNP
rs1381355308 6754 dbSNP
rs1299048186 6763 dbSNP
rs969211621 6768 dbSNP
rs1408461856 6770 dbSNP
rs1338497369 6772 dbSNP
rs1288261570 6779 dbSNP
rs1453032990 6785 dbSNP
rs1225402510 6789 dbSNP
rs1405275690 6791 dbSNP
rs765180586 6802 dbSNP
rs1205506201 6806 dbSNP
rs7545036 6811 dbSNP
rs1481489341 6822 dbSNP
rs1179817390 6826 dbSNP
rs1250955508 6829 dbSNP
rs1374919113 6830 dbSNP
rs541471118 6832 dbSNP
rs946839747 6833 dbSNP
rs1422467984 6836 dbSNP
rs922075481 6856 dbSNP
rs962128071 6857 dbSNP
rs1355988078 6861 dbSNP
rs1014570960 6864 dbSNP
rs1307862595 6879 dbSNP
rs974798204 6884 dbSNP
rs375635708 6886 dbSNP
rs1009000205 6887 dbSNP
rs184682151 6888 dbSNP
rs983390126 6892 dbSNP
rs1185828365 6894 dbSNP
rs1215307567 6898 dbSNP
rs1275362002 6898 dbSNP
rs950664511 6906 dbSNP
rs1027949466 6909 dbSNP
rs767474528 6913 dbSNP
rs1490477910 6934 dbSNP
rs1201524718 6938 dbSNP
rs996262804 6941 dbSNP
rs1244410191 6943 dbSNP
rs558175449 6946 dbSNP
rs904697204 6963 dbSNP
rs1199304456 6964 dbSNP
rs970291567 6964 dbSNP
rs1481896181 6966 dbSNP
rs572753650 6971 dbSNP
rs1325323805 6987 dbSNP
rs1022744116 7002 dbSNP
rs1427030925 7010 dbSNP
rs1251427693 7011 dbSNP
rs1322139996 7011 dbSNP
rs1226011764 7014 dbSNP
rs1349866790 7014 dbSNP
rs1043240916 7018 dbSNP
rs895539388 7025 dbSNP
rs1316639270 7027 dbSNP
rs1010308826 7028 dbSNP
rs1381848112 7031 dbSNP
rs1331933902 7034 dbSNP
rs1359898890 7034 dbSNP
rs1184173717 7035 dbSNP
rs34566870 7036 dbSNP
rs370566109 7036 dbSNP
rs1287628933 7038 dbSNP
rs1052788231 7039 dbSNP
rs891900089 7039 dbSNP
rs1447233474 7040 dbSNP
rs1057103122 7041 dbSNP
rs1397086350 7042 dbSNP
rs998888772 7044 dbSNP
rs938689110 7045 dbSNP
rs1429123467 7050 dbSNP
rs927863029 7053 dbSNP
rs1165781046 7054 dbSNP
rs1045000415 7056 dbSNP
rs1434566941 7057 dbSNP
rs1177309971 7060 dbSNP
rs1207619132 7060 dbSNP
rs1224294822 7060 dbSNP
rs1246689993 7060 dbSNP
rs1269417012 7060 dbSNP
rs1282253855 7060 dbSNP
rs1318448901 7060 dbSNP
rs1337636044 7060 dbSNP
rs1355505377 7060 dbSNP
rs1385337926 7060 dbSNP
rs1443825864 7060 dbSNP
rs1463157750 7060 dbSNP
rs775056839 7060 dbSNP
rs1368306630 7061 dbSNP
rs1394542725 7061 dbSNP
rs1491414223 7061 dbSNP
rs1331897926 7063 dbSNP
rs1339671174 7067 dbSNP
rs1442741249 7068 dbSNP
rs1044362622 7070 dbSNP
rs1185831976 7072 dbSNP
rs1421434161 7073 dbSNP
rs946945602 7076 dbSNP
rs1438753740 7077 dbSNP
rs922077479 7078 dbSNP
rs12063292 7080 dbSNP
rs947984028 7089 dbSNP
rs920411661 7090 dbSNP
rs1200187026 7091 dbSNP
rs1293311938 7091 dbSNP
rs1222840423 7095 dbSNP
rs1379470574 7098 dbSNP
rs1358254721 7102 dbSNP
rs973254981 7103 dbSNP
rs961796162 7104 dbSNP
rs539508614 7105 dbSNP
rs578234200 7110 dbSNP
rs1409155327 7111 dbSNP
rs1407916272 7113 dbSNP
rs911956235 7114 dbSNP
rs983422823 7120 dbSNP
rs950767399 7123 dbSNP
rs1305010636 7127 dbSNP
rs954530930 7128 dbSNP
rs558378135 7131 dbSNP
rs569458156 7137 dbSNP
rs549605328 7140 dbSNP
rs1482988136 7141 dbSNP
rs1223901430 7142 dbSNP
rs201763276 7149 dbSNP
rs1269468152 7151 dbSNP
rs969945503 7152 dbSNP
rs1198309998 7153 dbSNP
rs761679604 7156 dbSNP
rs189568600 7157 dbSNP
rs1451594803 7165 dbSNP
rs1368484227 7166 dbSNP
rs1294034930 7167 dbSNP
rs1428952552 7167 dbSNP
rs1021731771 7169 dbSNP
rs761643563 7175 dbSNP
rs1392871133 7177 dbSNP
rs1010833379 7179 dbSNP
rs1300045010 7180 dbSNP
rs891843668 7186 dbSNP
rs184841914 7187 dbSNP
rs1295787676 7190 dbSNP
rs1450714888 7192 dbSNP
rs1287243360 7193 dbSNP
rs1247258016 7196 dbSNP
rs1206679287 7198 dbSNP
rs1487814711 7201 dbSNP
rs1002997456 7202 dbSNP
rs71652597 7203 dbSNP
rs1259918510 7204 dbSNP
rs76166928 7205 dbSNP
rs77667806 7215 dbSNP
rs1396101294 7216 dbSNP
rs566607266 7216 dbSNP
rs1347293080 7217