Warning: Declaration of ConnDB::Query($sql, $link) should be compatible with mysqli::query($query) in /home/miRTarBase/public_html/miRTarBase_2022/php/database_ini.php on line 83

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32

Warning: array_multisort(): Argument #2 is expected to be an array or a sort flag in /home/miRTarBase/public_html/miRTarBase_2022/php/SpearmanCorrelation.php on line 32
MIRT668088 [miRNA, hsa-miR-122-5p :: GMEB1, target gene]
miRTarBase - #MIRT668088 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GMEB1   
Synonyms P96PIF, PIF96
Description glucocorticoid modulatory element binding protein 1
Transcript NM_006582   
Other Transcripts NM_024482   
Putative miRNA Targets on GMEB1
3'UTR of GMEB1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :||||| |   :|||||| 
Target 5' atcGCACCACT---GCACTCCa 3'
782 - 800 140.00 -17.90
              :|:||||||| |||||  
Target 5' ttttTATCATTGTCCCACTCat 3'
58 - 79 130.00 -19.20
            ||||| : | | |||||   
367 - 388 124.00 -8.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26977568 21 COSMIC
COSN30494952 24 COSMIC
COSN31487522 66 COSMIC
COSN19652673 75 COSMIC
COSN31588347 90 COSMIC
COSN30119706 96 COSMIC
COSN15659541 101 COSMIC
COSN31518380 101 COSMIC
COSN18725958 102 COSMIC
COSN31530964 103 COSMIC
COSN15657506 112 COSMIC
COSN15657405 114 COSMIC
COSN27197780 114 COSMIC
COSN23014309 228 COSMIC
COSN1442623 428 COSMIC
COSN32061775 851 COSMIC
COSN25798104 968 COSMIC
COSN6033161 1047 COSMIC
COSN6452187 1321 COSMIC
COSN27377484 1980 COSMIC
COSN16337470 2069 COSMIC
COSN27380929 2265 COSMIC
COSN31650652 2672 COSMIC
COSN4902158 2684 COSMIC
COSN22040989 3686 COSMIC
COSN10046845 3724 COSMIC
COSN7470131 3871 COSMIC
COSN8455893 3932 COSMIC
COSN29146567 4374 COSMIC
COSN21485473 4485 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1484906836 2 dbSNP
rs781360608 3 dbSNP
rs1312662404 6 dbSNP
rs748224487 7 dbSNP
rs1479016791 10 dbSNP
rs16837669 19 dbSNP
rs1429019686 22 dbSNP
rs774124236 23 dbSNP
rs746275735 26 dbSNP
rs745721067 27 dbSNP
rs1460081336 28 dbSNP
rs771711337 38 dbSNP
rs1342946875 42 dbSNP
rs570437550 48 dbSNP
rs775152143 49 dbSNP
rs758917680 50 dbSNP
rs760251096 50 dbSNP
rs1258101527 62 dbSNP
rs539315668 64 dbSNP
rs574201988 71 dbSNP
rs979846386 72 dbSNP
rs1242925509 79 dbSNP
rs1207544796 86 dbSNP
rs1236149208 90 dbSNP
rs181521135 95 dbSNP
rs35942724 95 dbSNP
rs955963601 95 dbSNP
rs1182747141 100 dbSNP
rs372271712 101 dbSNP
rs559808019 101 dbSNP
rs912038667 101 dbSNP
rs528044464 102 dbSNP
rs1471872848 109 dbSNP
rs550986155 111 dbSNP
rs186305930 112 dbSNP
rs530505140 113 dbSNP
rs1258162969 114 dbSNP
rs550286736 114 dbSNP
rs897073583 115 dbSNP
rs1201227379 116 dbSNP
rs1174209036 121 dbSNP
rs1443477792 124 dbSNP
rs929923694 125 dbSNP
rs1048299945 126 dbSNP
rs920820125 130 dbSNP
rs1475215879 135 dbSNP
rs1466367712 156 dbSNP
rs1426044493 157 dbSNP
rs1479528353 170 dbSNP
rs1304332593 178 dbSNP
rs1175769572 181 dbSNP
rs1401455826 195 dbSNP
rs879032511 201 dbSNP
rs1409108526 207 dbSNP
rs12117693 208 dbSNP
rs1343160401 210 dbSNP
rs751126100 211 dbSNP
rs536098145 212 dbSNP
rs886467034 213 dbSNP
rs1277491120 219 dbSNP
rs900551794 220 dbSNP
rs1273701801 229 dbSNP
rs1312343303 232 dbSNP
rs754603263 234 dbSNP
rs1221377817 237 dbSNP
rs1030786240 239 dbSNP
rs1282602828 253 dbSNP
rs1488206489 260 dbSNP
rs956056577 261 dbSNP
rs1265673632 274 dbSNP
rs1056588063 277 dbSNP
rs1198825845 278 dbSNP
rs1010936232 289 dbSNP
rs777619908 296 dbSNP
rs1378227371 305 dbSNP
rs1021815350 311 dbSNP
rs1282887997 312 dbSNP
rs1298563095 314 dbSNP
rs895229973 314 dbSNP
rs768811793 316 dbSNP
rs1182084706 324 dbSNP
rs968879537 325 dbSNP
rs780861441 328 dbSNP
rs980212821 338 dbSNP
rs1331108299 345 dbSNP
rs904427123 354 dbSNP
rs1471210136 358 dbSNP
rs1353589008 364 dbSNP
rs1000137848 366 dbSNP
rs1481649772 369 dbSNP
rs752445547 374 dbSNP
rs1031749349 379 dbSNP
rs1424768102 381 dbSNP
rs546832307 385 dbSNP
rs927053520 390 dbSNP
rs955765576 391 dbSNP
rs755880312 392 dbSNP
rs777706121 394 dbSNP
rs1018655214 396 dbSNP
rs1438977567 397 dbSNP
rs140565035 401 dbSNP
rs992589404 402 dbSNP
rs1308543586 405 dbSNP
rs1372268830 407 dbSNP
rs1433679635 408 dbSNP
rs1162349606 415 dbSNP
rs1390981922 419 dbSNP
rs1273688046 422 dbSNP
rs1326242987 433 dbSNP
rs1376850320 435 dbSNP
rs1448101641 436 dbSNP
rs1311939163 437 dbSNP
rs1380954701 438 dbSNP
rs35225835 444 dbSNP
rs1367892440 458 dbSNP
rs918282660 462 dbSNP
rs1244513687 468 dbSNP
rs1266320021 468 dbSNP
rs566655741 473 dbSNP
rs974850411 481 dbSNP
rs1300110773 485 dbSNP
rs373591683 493 dbSNP
rs1048359706 504 dbSNP
rs1257464566 505 dbSNP
rs1220567822 514 dbSNP
rs920793869 515 dbSNP
rs1306179664 523 dbSNP
rs1340465372 535 dbSNP
rs558170124 536 dbSNP
rs1239928353 537 dbSNP
rs1421892651 538 dbSNP
rs952282771 547 dbSNP
rs909772160 548 dbSNP
rs578092272 549 dbSNP
rs1056871648 551 dbSNP
rs779154268 552 dbSNP
rs901001558 560 dbSNP
rs998041421 564 dbSNP
rs1219498108 565 dbSNP
rs1051842200 570 dbSNP
rs1395864867 572 dbSNP
rs537539726 576 dbSNP
rs748545984 577 dbSNP
rs1342522271 579 dbSNP
rs1225458090 581 dbSNP
rs1010215905 582 dbSNP
rs1488951384 583 dbSNP
rs1318775752 584 dbSNP
rs557214863 586 dbSNP
rs1200585942 587 dbSNP
rs1195723347 590 dbSNP
rs948132311 592 dbSNP
rs1448658562 597 dbSNP
rs1256532821 598 dbSNP
rs1044232887 603 dbSNP
rs1172165872 608 dbSNP
rs1421604029 608 dbSNP
rs536552253 609 dbSNP
rs542859104 613 dbSNP
rs1322352234 618 dbSNP
rs1303818166 626 dbSNP
rs1404732884 627 dbSNP
rs1349956323 628 dbSNP
rs1380879786 632 dbSNP
rs1297879587 636 dbSNP
rs1000511847 644 dbSNP
rs1220582824 653 dbSNP
rs559971430 654 dbSNP
rs1053006253 656 dbSNP
rs1318142918 658 dbSNP
rs968910746 667 dbSNP
rs573475879 670 dbSNP
rs1363930906 671 dbSNP
rs35312015 671 dbSNP
rs1488397798 673 dbSNP
rs1008538075 676 dbSNP
rs545326798 677 dbSNP
rs1433131267 678 dbSNP
rs575037579 678 dbSNP
rs1342149452 679 dbSNP
rs1379862388 681 dbSNP
rs564515026 686 dbSNP
rs530467573 687 dbSNP
rs1361446195 691 dbSNP
rs1289325759 694 dbSNP
rs1366914331 698 dbSNP
rs964414413 699 dbSNP
rs995908804 706 dbSNP
rs1237742418 716 dbSNP
rs952250102 722 dbSNP
rs984033722 728 dbSNP
rs908081072 735 dbSNP
rs1244484530 736 dbSNP
rs1246427107 744 dbSNP
rs960228056 745 dbSNP
rs1464581493 748 dbSNP
rs961267296 763 dbSNP
rs1188996884 785 dbSNP
rs1163028123 786 dbSNP
rs1243609526 786 dbSNP
rs373041701 795 dbSNP
rs1349504760 803 dbSNP
rs1162575174 809 dbSNP
rs1295331944 812 dbSNP
rs1414365222 817 dbSNP
rs1462567451 818 dbSNP
rs1156270829 819 dbSNP
rs1444423215 830 dbSNP
rs1191912990 831 dbSNP
rs1266644925 831 dbSNP
rs1320704625 831 dbSNP
rs1377282454 831 dbSNP
rs536160225 831 dbSNP
rs992143437 831 dbSNP
rs1387486423 832 dbSNP
rs1435338886 833 dbSNP
rs1321689828 841 dbSNP
rs1178493519 845 dbSNP
rs1239313872 848 dbSNP
rs1328558159 848 dbSNP
rs993016228 851 dbSNP
rs958177913 853 dbSNP
rs916608107 855 dbSNP
rs1180459057 858 dbSNP
rs1413394431 862 dbSNP
rs918317957 863 dbSNP
rs948114527 865 dbSNP
rs550249681 866 dbSNP
rs1235249101 871 dbSNP
rs951132412 872 dbSNP
rs1330675194 873 dbSNP
rs1400912696 883 dbSNP
rs983753189 884 dbSNP
rs760303203 888 dbSNP
rs1328804956 903 dbSNP
rs1378014236 907 dbSNP
rs1228479093 908 dbSNP
rs925365597 911 dbSNP
rs1315598639 915 dbSNP
rs935807667 918 dbSNP
rs560749989 920 dbSNP
rs1209593997 925 dbSNP
rs942631284 932 dbSNP
rs112393677 934 dbSNP
rs922455376 936 dbSNP
rs371375390 937 dbSNP
rs1459460437 951 dbSNP
rs1208505593 954 dbSNP
rs878908087 956 dbSNP
rs560829465 959 dbSNP
rs529849663 960 dbSNP
rs1238017717 970 dbSNP
rs1237217855 977 dbSNP
rs1473259018 978 dbSNP
rs1476121478 987 dbSNP
rs1179455351 1003 dbSNP
rs1421755821 1007 dbSNP
rs1052301719 1009 dbSNP
rs1171433840 1020 dbSNP
rs1424280629 1039 dbSNP
rs1053379362 1041 dbSNP
rs190411529 1042 dbSNP
rs566723511 1047 dbSNP
rs1448472191 1048 dbSNP
rs368259352 1055 dbSNP
rs1337933600 1059 dbSNP
rs181600347 1068 dbSNP
rs552552902 1085 dbSNP
rs367960731 1086 dbSNP
rs185923934 1089 dbSNP
rs557382301 1091 dbSNP
rs1278372993 1097 dbSNP
rs1443423447 1098 dbSNP
rs900217766 1100 dbSNP
rs995876305 1107 dbSNP
rs1488062276 1114 dbSNP
rs1194501573 1118 dbSNP
rs1476354137 1136 dbSNP
rs1027328379 1137 dbSNP
rs1286574068 1138 dbSNP
rs147569881 1141 dbSNP
rs759266185 1146 dbSNP
rs1005028434 1147 dbSNP
rs1015521994 1148 dbSNP
rs1262719381 1149 dbSNP
rs1298291220 1157 dbSNP
rs1327612955 1162 dbSNP
rs1343087596 1163 dbSNP
rs1274839472 1165 dbSNP
rs796353375 1165 dbSNP
rs960975864 1165 dbSNP
rs1217534693 1176 dbSNP
rs75760568 1177 dbSNP
rs61787562 1179 dbSNP
rs1449996818 1180 dbSNP
rs1199689551 1181 dbSNP
rs1023632070 1184 dbSNP
rs1279045015 1185 dbSNP
rs1014394610 1197 dbSNP
rs536823232 1198 dbSNP
rs951124114 1199 dbSNP
rs1158949555 1200 dbSNP
rs983866043 1204 dbSNP
rs553277110 1214 dbSNP
rs963692430 1221 dbSNP
rs573174408 1225 dbSNP
rs1332196789 1237 dbSNP
rs922522813 1240 dbSNP
rs1375602809 1241 dbSNP
rs1307535999 1245 dbSNP
rs191087928 1247 dbSNP
rs1376711988 1249 dbSNP
rs1477463335 1251 dbSNP
rs979429540 1254 dbSNP
rs933833672 1258 dbSNP
rs1209350891 1259 dbSNP
rs1290621989 1262 dbSNP
rs925332300 1286 dbSNP
rs545471536 1291 dbSNP
rs987960064 1293 dbSNP
rs913312841 1305 dbSNP
rs545291483 1306 dbSNP
rs1306734896 1318 dbSNP
rs1370415234 1320 dbSNP
rs77208577 1321 dbSNP
rs1040304725 1325 dbSNP
rs1390739213 1325 dbSNP
rs1462555751 1325 dbSNP
rs199862681 1325 dbSNP
rs900437934 1331 dbSNP
rs1448034155 1333 dbSNP
rs1329621377 1336 dbSNP
rs767696682 1337 dbSNP
rs1338948753 1340 dbSNP
rs1244265005 1346 dbSNP
rs1284860949 1351 dbSNP
rs931610810 1363 dbSNP
rs1216863912 1367 dbSNP
rs1048733843 1370 dbSNP
rs1256137964 1375 dbSNP
rs887507202 1381 dbSNP
rs574852215 1382 dbSNP
rs1005069982 1383 dbSNP
rs1196179635 1385 dbSNP
rs1015089773 1391 dbSNP
rs1440340696 1396 dbSNP
rs1186480613 1421 dbSNP
rs904562707 1425 dbSNP
rs1275295044 1427 dbSNP
rs1167880613 1428 dbSNP
rs1423581893 1434 dbSNP
rs937325411 1438 dbSNP
rs1300280150 1441 dbSNP
rs1056462809 1444 dbSNP
rs1349762973 1459 dbSNP
rs772396023 1479 dbSNP
rs1225826618 1481 dbSNP
rs1273829032 1483 dbSNP
rs1335175763 1490 dbSNP
rs750306078 1491 dbSNP
rs1014839724 1493 dbSNP
rs1025848300 1494 dbSNP
rs1317232485 1495 dbSNP
rs1227979189 1501 dbSNP
rs376133162 1503 dbSNP
rs887262756 1503 dbSNP
rs1450722340 1504 dbSNP
rs1005333097 1507 dbSNP
rs1199640792 1509 dbSNP
rs1016673465 1516 dbSNP
rs543807705 1517 dbSNP
rs1261763017 1520 dbSNP
rs963726471 1521 dbSNP
rs1429635935 1523 dbSNP
rs979396610 1528 dbSNP
rs1032370996 1529 dbSNP
rs775887892 1533 dbSNP
rs1377538800 1539 dbSNP
rs988672451 1553 dbSNP
rs1297659144 1561 dbSNP
rs1341276555 1564 dbSNP
rs1455859829 1567 dbSNP
rs1030002890 1568 dbSNP
rs1390127494 1569 dbSNP
rs1297697117 1575 dbSNP
rs1329242968 1578 dbSNP
rs955281040 1581 dbSNP
rs1449755697 1599 dbSNP
rs1232299658 1600 dbSNP
rs1280717337 1612 dbSNP
rs944506548 1617 dbSNP
rs975893483 1620 dbSNP
rs1213921729 1622 dbSNP
rs1372823356 1623 dbSNP
rs145253788 1623 dbSNP
rs988462066 1627 dbSNP
rs1300014293 1632 dbSNP
rs1284864584 1641 dbSNP
rs913769829 1643 dbSNP
rs1388667025 1653 dbSNP
rs1485943027 1657 dbSNP
rs946540493 1658 dbSNP
rs931913380 1659 dbSNP
rs1326840346 1668 dbSNP
rs1433077101 1668 dbSNP
rs1373381784 1671 dbSNP
rs1048700090 1674 dbSNP
rs561010259 1682 dbSNP
rs761072371 1693 dbSNP
rs1225938268 1696 dbSNP
rs926008908 1701 dbSNP
rs768917304 1702 dbSNP
rs1036486662 1705 dbSNP
rs1229477762 1707 dbSNP
rs529766790 1708 dbSNP
rs35419322 1711 dbSNP
rs12561973 1719 dbSNP
rs1291818370 1724 dbSNP
rs1055759112 1728 dbSNP
rs917236363 1737 dbSNP
rs1169280908 1743 dbSNP
rs1209844571 1745 dbSNP
rs1237673504 1748 dbSNP
rs1045268825 1754 dbSNP
rs905429371 1756 dbSNP
rs1317110984 1757 dbSNP
rs1001139901 1758 dbSNP
rs577900562 1761 dbSNP
rs956958489 1762 dbSNP
rs762783466 1766 dbSNP
rs1429701002 1773 dbSNP
rs887295363 1773 dbSNP
rs1255424238 1782 dbSNP
rs1438279002 1785 dbSNP
rs1178377085 1787 dbSNP
rs1005699038 1789 dbSNP
rs1038140632 1796 dbSNP
rs1421055195 1808 dbSNP
rs1162786379 1809 dbSNP
rs1020078954 1813 dbSNP
rs965452679 1815 dbSNP
rs975859411 1827 dbSNP
rs1367171506 1834 dbSNP
rs1457470957 1836 dbSNP
rs1396570376 1837 dbSNP
rs377116246 1846 dbSNP
rs560088033 1851 dbSNP
rs1444359100 1858 dbSNP
rs899551086 1867 dbSNP
rs1373640672 1869 dbSNP
rs953279242 1874 dbSNP
rs996922271 1879 dbSNP
rs1310125945 1881 dbSNP
rs1320649850 1884 dbSNP
rs1233337122 1885 dbSNP
rs1396984110 1892 dbSNP
rs141946704 1896 dbSNP
rs1275641532 1898 dbSNP
rs1456792628 1913 dbSNP
rs1433139668 1930 dbSNP
rs984705637 1940 dbSNP
rs909138213 1958 dbSNP
rs1180407444 1965 dbSNP
rs1319686734 1965 dbSNP
rs1475605993 1966 dbSNP
rs1029372095 1967 dbSNP
rs1354394022 1969 dbSNP
rs1491295101 1969 dbSNP
rs552459549 1969 dbSNP
rs56214028 1969 dbSNP
rs796265252 1969 dbSNP
rs796863149 1969 dbSNP
rs1294539439 1970 dbSNP
rs1491515386 1970 dbSNP
rs569178921 1971 dbSNP
rs1021273874 1972 dbSNP
rs1190183491 1973 dbSNP
rs967874787 1973 dbSNP
rs1261053865 1975 dbSNP
rs1310492777 1976 dbSNP
rs979199910 1977 dbSNP
rs530900574 1978 dbSNP
rs958821061 1979 dbSNP
rs1374496278 1980 dbSNP
rs1434888713 1980 dbSNP
rs763974820 1981 dbSNP
rs991975406 1982 dbSNP
rs914293839 1983 dbSNP
rs950072774 1988 dbSNP
rs1364662037 1999 dbSNP
rs1019626233 2005 dbSNP
rs1047327275 2010 dbSNP
rs1280003447 2016 dbSNP
rs751526679 2040 dbSNP
rs1213211218 2047 dbSNP
rs1284126212 2051 dbSNP
rs1488030246 2057 dbSNP
rs143101384 2064 dbSNP
rs908766293 2090 dbSNP
rs1188580934 2094 dbSNP
rs1476322508 2096 dbSNP
rs941519043 2097 dbSNP
rs1394179378 2098 dbSNP
rs148219207 2116 dbSNP
rs1028781516 2117 dbSNP
rs900001896 2125 dbSNP
rs1318364581 2128 dbSNP
rs1347489445 2129 dbSNP
rs114811458 2133 dbSNP
rs1051274839 2140 dbSNP
rs890821517 2141 dbSNP
rs1158688983 2148 dbSNP
rs1345942864 2157 dbSNP
rs1307393853 2158 dbSNP
rs1205813371 2168 dbSNP
rs1286359969 2186 dbSNP
rs909099102 2189 dbSNP
rs1211805411 2204 dbSNP
rs1252292996 2205 dbSNP
rs140146007 2213 dbSNP
rs1195240734 2215 dbSNP
rs1300815946 2218 dbSNP
rs777622271 2220 dbSNP
rs183277911 2224 dbSNP
rs1415293994 2230 dbSNP
rs1294668356 2238 dbSNP
rs1409457352 2244 dbSNP
rs1403079410 2246 dbSNP
rs1325878079 2250 dbSNP
rs1299632784 2253 dbSNP
rs1395833383 2253 dbSNP
rs917612308 2254 dbSNP
rs972125455 2254 dbSNP
rs949111946 2255 dbSNP
rs1348076836 2256 dbSNP
rs765819941 2266 dbSNP
rs563475435 2273 dbSNP
rs1272522414 2278 dbSNP
rs1318303742 2279 dbSNP
rs936784823 2280 dbSNP
rs1218407494 2283 dbSNP
rs1248069820 2284 dbSNP
rs1436873634 2287 dbSNP
rs1053979030 2288 dbSNP
rs1365174259 2304 dbSNP
rs1473969935 2311 dbSNP
rs967899179 2316 dbSNP
rs892682993 2317 dbSNP
rs1463415808 2318 dbSNP
rs759077587 2320 dbSNP
rs1041426568 2322 dbSNP
rs10157453 2331 dbSNP
rs901223166 2334 dbSNP
rs538854427 2336 dbSNP
rs1331174426 2352 dbSNP
rs186191927 2357 dbSNP
rs1028324856 2364 dbSNP
rs1293940874 2365 dbSNP
rs1234997788 2370 dbSNP
rs1212218292 2399 dbSNP
rs1033506420 2402 dbSNP
rs1338577437 2411 dbSNP
rs1323604064 2413 dbSNP
rs1491567990 2413 dbSNP
rs397979769 2413 dbSNP
rs71027293 2413 dbSNP
rs879224241 2413 dbSNP
rs1491548593 2414 dbSNP
rs1006437969 2415 dbSNP
rs1016125672 2416 dbSNP
rs959454713 2417 dbSNP
rs972043473 2417 dbSNP
rs1409015701 2418 dbSNP
rs1434264668 2418 dbSNP
rs1313570993 2419 dbSNP
rs377198041 2420 dbSNP
rs1293393669 2426 dbSNP
rs1421086280 2426 dbSNP
rs1173744352 2427 dbSNP
rs1227931014 2427 dbSNP
rs12731724 2430 dbSNP
rs970348602 2430 dbSNP
rs1209784583 2431 dbSNP
rs1435332722 2432 dbSNP
rs1314668196 2433 dbSNP
rs1423447636 2436 dbSNP
rs980437741 2449 dbSNP
rs1202832119 2455 dbSNP
rs1261667485 2456 dbSNP
rs926339529 2457 dbSNP
rs1408717992 2459 dbSNP
rs1298200138 2464 dbSNP
rs1393593702 2471 dbSNP
rs1375135451 2486 dbSNP
rs991611220 2491 dbSNP
rs1174567722 2496 dbSNP
rs1217084206 2503 dbSNP
rs190715835 2508 dbSNP
rs936450068 2509 dbSNP
rs1347593853 2510 dbSNP
rs529173958 2516 dbSNP
rs752355580 2520 dbSNP
rs945617160 2525 dbSNP
rs1297622856 2532 dbSNP
rs1368600322 2537 dbSNP
rs1233255631 2543 dbSNP
rs1303756461 2554 dbSNP
rs1349540186 2561 dbSNP
rs971434707 2566 dbSNP
rs554251003 2575 dbSNP
rs1265378057 2577 dbSNP
rs908797416 2578 dbSNP
rs1303434313 2597 dbSNP
rs1486486354 2599 dbSNP
rs941633304 2602 dbSNP
rs1041334116 2603 dbSNP
rs1251673778 2606 dbSNP
rs1468347708 2607 dbSNP
rs974313505 2615 dbSNP
rs1397156058 2618 dbSNP
rs1417490480 2619 dbSNP
rs574421907 2630 dbSNP
rs1364520620 2637 dbSNP
rs755868808 2643 dbSNP
rs183427147 2655 dbSNP
rs1322514914 2656 dbSNP
rs901434510 2657 dbSNP
rs542572933 2660 dbSNP
rs577065357 2661 dbSNP
rs1221658975 2664 dbSNP
rs1305832466 2665 dbSNP
rs150352409 2679 dbSNP
rs1240520375 2681 dbSNP
rs1271879191 2693 dbSNP
rs888518013 2698 dbSNP
rs1214716173 2707 dbSNP
rs562740665 2708 dbSNP
rs531623106 2709 dbSNP
rs1176910344 2723 dbSNP
rs1016505897 2726 dbSNP
rs1175234443 2729 dbSNP
rs1249084877 2729 dbSNP
rs945062913 2746 dbSNP
rs1415621955 2755 dbSNP
rs1042075136 2756 dbSNP
rs1165394573 2758 dbSNP
rs1351461496 2789 dbSNP
rs1439743331 2790 dbSNP
rs753728414 2793 dbSNP
rs1373574921 2797 dbSNP
rs897689383 2812 dbSNP
rs993743693 2813 dbSNP
rs1429000863 2817 dbSNP
rs548494837 2818 dbSNP
rs1234503615 2827 dbSNP
rs1275598393 2827 dbSNP
rs1306165966 2841 dbSNP
rs1024859727 2864 dbSNP
rs1252133219 2864 dbSNP
rs1000764797 2866 dbSNP
rs1481717327 2869 dbSNP
rs1185903928 2876 dbSNP
rs1256823340 2878 dbSNP
rs1475568200 2885 dbSNP
rs779182264 2887 dbSNP
rs757121885 2895 dbSNP
rs1415832826 2901 dbSNP
rs894996450 2908 dbSNP
rs1169417355 2912 dbSNP
rs1013807569 2915 dbSNP
rs1292595991 2918 dbSNP
rs1431196530 2920 dbSNP
rs958009711 2920 dbSNP
rs561120588 2926 dbSNP
rs559284921 2927 dbSNP
rs546735062 2928 dbSNP
rs982862609 2933 dbSNP
rs914049742 2934 dbSNP
rs1214383503 2944 dbSNP
rs1015637066 2945 dbSNP
rs1306055688 2946 dbSNP
rs1296653059 2963 dbSNP
rs745905952 2966 dbSNP
rs1209066931 2972 dbSNP
rs566628263 2973 dbSNP
rs1214494871 2974 dbSNP
rs974347654 2975 dbSNP
rs867348917 2980 dbSNP
rs1279873733 2986 dbSNP
rs976905678 2989 dbSNP
rs921494840 2995 dbSNP
rs1213080047 2998 dbSNP
rs1239151396 3015 dbSNP
rs932850856 3017 dbSNP
rs932933620 3025 dbSNP
rs1049696497 3053 dbSNP
rs538820113 3057 dbSNP
rs369434495 3063 dbSNP
rs941432973 3063 dbSNP
rs772301125 3064 dbSNP
rs1195316166 3065 dbSNP
rs187966851 3070 dbSNP
rs897235677 3078 dbSNP
rs1271271158 3079 dbSNP
rs1232507084 3081 dbSNP
rs993323542 3081 dbSNP
rs945151750 3082 dbSNP
rs1303009548 3085 dbSNP
rs1348804924 3088 dbSNP
rs1042106120 3089 dbSNP
rs903552338 3097 dbSNP
rs1446492871 3098 dbSNP
rs1215066898 3103 dbSNP
rs1046278881 3109 dbSNP
rs906438138 3113 dbSNP
rs780365233 3122 dbSNP
rs1394133360 3123 dbSNP
rs1033343174 3124 dbSNP
rs1163403782 3131 dbSNP
rs1399610390 3134 dbSNP
rs1405237958 3134 dbSNP
rs1319599710 3140 dbSNP
rs1391437660 3147 dbSNP
rs957762723 3148 dbSNP
rs1325597672 3149 dbSNP
rs747241368 3150 dbSNP
rs1010998384 3153 dbSNP
rs1438952150 3162 dbSNP
rs1394826710 3167 dbSNP
rs1462665512 3171 dbSNP
rs1350101098 3173 dbSNP
rs1224391108 3175 dbSNP
rs895020130 3176 dbSNP
rs966874711 3179 dbSNP
rs976874619 3184 dbSNP
rs1252084205 3190 dbSNP
rs1013423596 3194 dbSNP
rs1200638812 3195 dbSNP
rs1363455279 3200 dbSNP
rs1430389165 3203 dbSNP
rs1025268164 3204 dbSNP
rs1230785603 3206 dbSNP
rs768990379 3209 dbSNP
rs1158586234 3217 dbSNP
rs1004329055 3219 dbSNP
rs1364655349 3220 dbSNP
rs372622036 3227 dbSNP
rs575928518 3231 dbSNP
rs538155277 3238 dbSNP
rs1460273445 3256 dbSNP
rs1015671297 3264 dbSNP
rs1164820404 3265 dbSNP
rs1395765389 3266 dbSNP
rs1388860455 3268 dbSNP
rs1272598745 3272 dbSNP
rs985708731 3273 dbSNP
rs962725340 3283 dbSNP
rs1215780799 3287 dbSNP
rs1335348437 3296 dbSNP
rs1266074112 3302 dbSNP
rs974042549 3304 dbSNP
rs555285177 3305 dbSNP
rs56097836 3328 dbSNP
rs1231437571 3334 dbSNP
rs1471757114 3335 dbSNP
rs954479408 3342 dbSNP
rs1356834181 3344 dbSNP
rs1211389632 3348 dbSNP
rs1037459285 3364 dbSNP
rs1476017750 3375 dbSNP
rs1156527837 3376 dbSNP
rs918652229 3390 dbSNP
rs1383715955 3395 dbSNP
rs1473938696 3397 dbSNP
rs987060646 3405 dbSNP
rs1319340660 3407 dbSNP
rs764174870 3408 dbSNP
rs1419189735 3409 dbSNP
rs376885986 3413 dbSNP
rs762278515 3417 dbSNP
rs1166477694 3422 dbSNP
rs1347510784 3447 dbSNP
rs1396047382 3451 dbSNP
rs1410690963 3465 dbSNP
rs1446417435 3466 dbSNP
rs1292818248 3467 dbSNP
rs1046247085 3475 dbSNP
rs1414212968 3480 dbSNP
rs533786053 3482 dbSNP
rs1340936229 3486 dbSNP
rs1246753782 3496 dbSNP
rs1002114580 3498 dbSNP
rs1055016198 3506 dbSNP
rs966829437 3512 dbSNP
rs977828759 3513 dbSNP
rs1286687233 3521 dbSNP
rs553877130 3536 dbSNP
rs1276299881 3540 dbSNP
rs770159769 3543 dbSNP
rs544015913 3551 dbSNP
rs1010542374 3553 dbSNP
rs191490960 3554 dbSNP
rs925003957 3555 dbSNP
rs138015771 3557 dbSNP
rs1286050595 3558 dbSNP
rs1440696765 3565 dbSNP
rs773726761 3569 dbSNP
rs1054680840 3579 dbSNP
rs1434207032 3584 dbSNP
rs902241884 3587 dbSNP
rs1402824467 3588 dbSNP
rs1258071546 3596 dbSNP
rs916247103 3606 dbSNP
rs1316113666 3615 dbSNP
rs1325685756 3616 dbSNP
rs949364536 3617 dbSNP
rs758985554 3621 dbSNP
rs1299399033 3630 dbSNP
rs886297687 3631 dbSNP
rs1475907079 3634 dbSNP
rs1232936458 3636 dbSNP
rs1004696809 3640 dbSNP
rs1256015383 3642 dbSNP
rs1037132511 3644 dbSNP
rs1465668878 3654 dbSNP
rs1190854062 3655 dbSNP
rs1393531329 3658 dbSNP
rs936645 3662 dbSNP
rs1379501907 3663 dbSNP
rs1470293558 3670 dbSNP
rs576232495 3671 dbSNP
rs1451686946 3680 dbSNP
rs995586633 3691 dbSNP
rs954175467 3692 dbSNP
rs1028774521 3693 dbSNP
rs866448589 3697 dbSNP
rs1039617276 3698 dbSNP
rs899668940 3700 dbSNP
rs1322223814 3701 dbSNP
rs1312817257 3709 dbSNP
rs1439784228 3710 dbSNP
rs775832147 3713 dbSNP
rs1416734577 3723 dbSNP
rs1008916756 3746 dbSNP
rs1019841051 3750 dbSNP
rs966862248 3751 dbSNP
rs541746454 3756 dbSNP
rs562023576 3764 dbSNP
rs963304547 3765 dbSNP
rs1330376681 3766 dbSNP
rs182917086 3766 dbSNP
rs925035052 3767 dbSNP
rs1335440794 3768 dbSNP
rs957824046 3771 dbSNP
rs1240024051 3775 dbSNP
rs775044199 3785 dbSNP
rs1192060170 3789 dbSNP
rs1269714137 3791 dbSNP
rs1417430603 3797 dbSNP
rs918609400 3805 dbSNP
rs546993324 3806 dbSNP
rs1342631983 3808 dbSNP
rs571051910 3811 dbSNP
rs1457649810 3813 dbSNP
rs990578380 3817 dbSNP
rs1161268121 3819 dbSNP
rs1233212935 3824 dbSNP
rs760234195 3837 dbSNP
rs11578325 3839 dbSNP
rs1202480085 3845 dbSNP
rs1249169613 3855 dbSNP
rs927371060 3856 dbSNP
rs1230830961 3862 dbSNP
rs201244985 3862 dbSNP
rs546496835 3863 dbSNP
rs532453720 3864 dbSNP
rs753550100 3871 dbSNP
rs1183515368 3872 dbSNP
rs1244560434 3874 dbSNP
rs1452965955 3875 dbSNP
rs1173359117 3876 dbSNP
rs907766970 3880 dbSNP
rs567543201 3884 dbSNP
rs1437091264 3897 dbSNP
rs1267493152 3900 dbSNP
rs1166295128 3910 dbSNP
rs745358316 3911 dbSNP
rs1252705058 3918 dbSNP
rs142682192 3921 dbSNP
rs1184310626 3932 dbSNP
rs559829737 3935 dbSNP
rs1037502438 3938 dbSNP
rs1415551024 3951 dbSNP
rs1331139271 3956 dbSNP
rs750257396 3964 dbSNP
rs1052386664 3972 dbSNP
rs868614283 3972 dbSNP
rs757110740 3977 dbSNP
rs1351261769 3978 dbSNP
rs995617717 3992 dbSNP
rs765218764 3993 dbSNP
rs146023536 3997 dbSNP
rs1350007951 3999 dbSNP
rs1008200794 4001 dbSNP
rs997813435 4013 dbSNP
rs1379035666 4015 dbSNP
rs889549573 4018 dbSNP
rs1315210896 4021 dbSNP
rs1006985891 4023 dbSNP
rs536516541 4023 dbSNP
rs1250326197 4039 dbSNP
rs1484106725 4041 dbSNP
rs1339493569 4042 dbSNP
rs1020293891 4046 dbSNP
rs1255357381 4050 dbSNP
rs966893290 4051 dbSNP
rs962976283 4057 dbSNP
rs1415763323 4062 dbSNP
rs538443763 4065 dbSNP
rs999731056 4070 dbSNP
rs1264868269 4071 dbSNP
rs1167615458 4072 dbSNP
rs1032507818 4074 dbSNP
rs958187588 4081 dbSNP
rs1449478290 4084 dbSNP
rs990999839 4090 dbSNP
rs1305107849 4093 dbSNP
rs1025636918 4103 dbSNP
rs1023363315 4107 dbSNP
rs1228099342 4110 dbSNP
rs1298634966 4120 dbSNP
rs1232187112 4125 dbSNP
rs564182997 4125 dbSNP
rs1279625321 4142 dbSNP
rs1254015347 4143 dbSNP
rs1456009408 4145 dbSNP
rs970814434 4148 dbSNP
rs981767884 4152 dbSNP
rs907797875 4160 dbSNP
rs971355547 4185 dbSNP
rs750399500 4189 dbSNP
rs981445092 4194 dbSNP
rs1372940158 4195 dbSNP
rs927331986 4195 dbSNP
rs138830980 4197 dbSNP
rs1169671695 4199 dbSNP
rs553426807 4207 dbSNP
rs1461085716 4208 dbSNP
rs115276970 4209 dbSNP
rs931808113 4215 dbSNP
rs946647191 4218 dbSNP
rs1434863111 4237 dbSNP
rs1321557003 4253 dbSNP
rs1042663487 4262 dbSNP
rs902440885 4270 dbSNP
rs1380257734 4273 dbSNP
rs1345850785 4274 dbSNP
rs187260106 4279 dbSNP
rs747160762 4287 dbSNP
rs1326909540 4288 dbSNP
rs1326913885 4300 dbSNP
rs889843633 4301 dbSNP
rs1207894017 4303 dbSNP
rs1050732541 4304 dbSNP
rs889520280 4305 dbSNP
rs1007076524 4308 dbSNP
rs1038533788 4313 dbSNP
rs1270706705 4315 dbSNP
rs1478083495 4319 dbSNP
rs1333787162 4330 dbSNP
rs944038266 4334 dbSNP
rs576943197 4335 dbSNP
rs1457123137 4337 dbSNP
rs79782361 4339 dbSNP
rs556332693 4355 dbSNP
rs1470109244 4365 dbSNP
rs1460169739 4366 dbSNP
rs755122222 4370 dbSNP
rs781508105 4375 dbSNP
rs1331847698 4378 dbSNP
rs902515641 4383 dbSNP
rs1203712784 4386 dbSNP
rs999762248 4387 dbSNP
rs1349935795 4391 dbSNP
rs1227781672 4392 dbSNP
rs1032538451 4393 dbSNP
rs1429603036 4397 dbSNP
rs1331016250 4398 dbSNP
rs1195464677 4403 dbSNP
rs971659682 4404 dbSNP
rs745335761 4414 dbSNP
rs1475038869 4415 dbSNP
rs1165947439 4417 dbSNP
rs576114138 4419 dbSNP
rs777357210 4422 dbSNP
rs1223141999 4423 dbSNP
rs1249054569 4428 dbSNP
rs775173369 4433 dbSNP
rs1012390222 4434 dbSNP
rs1002860896 4438 dbSNP
rs1396882546 4440 dbSNP
rs1183585873 4442 dbSNP
rs141945773 4447 dbSNP
rs113344311 4452 dbSNP
rs1162970572 4453 dbSNP
rs1391741473 4462 dbSNP
rs572320503 4464 dbSNP
rs113278909 4466 dbSNP
rs1383819144 4473 dbSNP
rs192598057 4473 dbSNP
rs1290968630 4488 dbSNP
rs1288937836 4498 dbSNP
rs1354283166 4508 dbSNP
rs982268974 4509 dbSNP
rs1294777985 4513 dbSNP
rs1352216444 4515 dbSNP
rs1014625579 4516 dbSNP
rs1283320027 4517 dbSNP
rs773638582 4519 dbSNP
rs1260469153 4529 dbSNP
rs968246059 4530 dbSNP
rs868663095 4539 dbSNP
rs1219421763 4542 dbSNP
rs977968621 4543 dbSNP
rs1205188734 4546 dbSNP
rs1254632605 4568 dbSNP
rs538695116 4571 dbSNP
rs1187447403 4576 dbSNP
rs973333062 4578 dbSNP
rs1473961171 4581 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :||||| |   :|||||| 
Target 5' aucGCACCACU---GCACUCCa 3'
4 - 22
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000373816.1 | 3UTR | AAGAUCGCACCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.786 7.2e-4 0.665 6.6e-3 13 Click to see details
GSE28544 Breast cancer 0.547 2.8e-3 0.510 5.4e-3 24 Click to see details
GSE32688 Pancreatic cancer 0.401 1.1e-2 0.330 3.3e-2 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.451 1.2e-2 -0.476 8.1e-3 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.384 3.5e-2 -0.546 3.5e-3 23 Click to see details
GSE21849 B cell lymphoma 0.336 3.7e-2 0.339 3.6e-2 29 Click to see details
GSE19350 CNS germ cell tumors -0.531 3.8e-2 -0.171 3.0e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.161 6.5e-2 -0.087 2.1e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.249 1.2e-1 -0.096 3.3e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.147 1.2e-1 -0.056 3.3e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.201 1.7e-1 0.175 2.0e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.292 2.9e-1 -0.314 2.7e-1 6 Click to see details
GSE17306 Multiple myeloma 0.061 3.4e-1 0.199 8.5e-2 49 Click to see details
GSE17498 Multiple myeloma 0.047 3.9e-1 0.149 1.8e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.034 4.4e-1 0.156 2.6e-1 20 Click to see details
GSE27834 Pluripotent stem cells 0.021 4.7e-1 -0.035 4.5e-1 16 Click to see details
GSE38226 Liver fibrosis -0.017 4.7e-1 0.123 3.0e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.514 0.1 0.333 0.21 8 Click to see details
LIHC -0.186 0.1 -0.226 0.06 49 Click to see details
KIRC -0.237 0.11 -0.282 0.07 29 Click to see details
KIRP 0.307 0.21 0.517 0.08 9 Click to see details
KICH -0.274 0.26 -0.143 0.37 8 Click to see details
CHOL 0.243 0.26 0.083 0.42 9 Click to see details
HNSC -0.67 0.27 -0.500 0.33 3 Click to see details
ESCA 0.188 0.38 -0.100 0.44 5 Click to see details
THCA 0.008 0.49 0.200 0.37 5 Click to see details
THCA 0.008 0.49 0.200 0.37 5 Click to see details
THCA 0.008 0.49 0.200 0.37 5 Click to see details
THCA 0.008 0.49 0.200 0.37 5 Click to see details
THCA 0.008 0.49 0.200 0.37 5 Click to see details
THCA 0.008 0.49 0.200 0.37 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*