miRTarBase - #MIRT667359 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MPLKIP   
Synonyms ABHS, C7orf11, ORF20, TTD4
Description M-phase specific PLK1 interacting protein
Transcript NM_138701   
Expression
Putative miRNA Targets on MPLKIP
3'UTR of MPLKIP
(miRNA target sites are highlighted)
>MPLKIP|NM_138701|3'UTR
   1 CATTTCTGAAATTCAACTGGAAGCTTCATGTGTCAGGAACATCTTGGACAAAACTTTAAGTTGTGTTGATATAAATTTAC
  81 CCAAAGATGATGACTTTGATTGGATAATTAGTAAGGTCTTTTTGTTATTTTTCATCGTATCAGGTATTGTTGATATTAGA
 161 GAAAAAAGTAGGATAACTTGCAACATTTAGCTCTGGAAGTACCTACCACATTTTAGAGATTTACCGTTTCCATATATTTA
 241 ACATTCCTGGTTACATAATGGACATTTGTCTTTTAATGTTTTTTCAATGTTTTAAAATAAAACATTTTGTCTTCTAAAAA
 321 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUG-GUAACAGUGUGAGGu 5'
              ||: :||| | |||:||| 
Target 5' tttcCATATATT-TAACATTCCt 3'
227 - 248 137.00 -10.70
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |::|||  |  ||||:|:: 
Target 5' gaAGTACC--TACCACATTTTa 3'
196 - 215 108.00 -12.80
3
miRNA  3' guUUGUGGUAACAG-UGUGAGGu 5'
            ||||:| | | | | |||:: 
Target 5' ggAACATCTTGGACAAAACTTTa 3'
36 - 58 100.00 -10.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1187139 226 ClinVar
COSN30468013 14 COSMIC
COSN19707943 51 COSMIC
COSN31560229 65 COSMIC
COSN30512981 95 COSMIC
COSN14288802 118 COSMIC
COSN31609206 161 COSMIC
COSN15783697 207 COSMIC
COSN30166585 216 COSMIC
COSN20365202 317 COSMIC
COSN7980976 317 COSMIC
COSN4965106 511 COSMIC
COSN5657350 610 COSMIC
COSN9988337 778 COSMIC
COSN19401783 1286 COSMIC
COSN17214250 1575 COSMIC
COSN5657349 1662 COSMIC
COSN20686709 1776 COSMIC
COSN6881246 2541 COSMIC
COSN6881245 2542 COSMIC
COSN23450307 2857 COSMIC
COSN29358344 2936 COSMIC
COSN9988336 3041 COSMIC
COSN9942536 3422 COSMIC
COSN17969406 3462 COSMIC
COSN9988335 3699 COSMIC
COSN16601507 3704 COSMIC
COSN20400350 3784 COSMIC
COSN25597773 4369 COSMIC
COSN30331424 4500 COSMIC
COSN2222625 4566 COSMIC
COSN4933612 4642 COSMIC
COSN7980975 5007 COSMIC
COSN20738548 5121 COSMIC
COSN2222624 5124 COSMIC
COSN28121050 5142 COSMIC
COSN24530887 5497 COSMIC
COSN23642570 5511 COSMIC
COSN9988334 5589 COSMIC
COSN9942535 5604 COSMIC
COSN6881244 6141 COSMIC
COSN8301375 6218 COSMIC
COSN25014418 6260 COSMIC
COSN21335916 6535 COSMIC
COSN22808844 6596 COSMIC
COSN9988333 6739 COSMIC
rs77009694 4874 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757716466 1 dbSNP
rs1481651232 2 dbSNP
rs1173773768 7 dbSNP
rs1280966455 11 dbSNP
rs1198987181 13 dbSNP
rs1344394148 14 dbSNP
rs951908439 14 dbSNP
rs182870368 16 dbSNP
rs374086455 17 dbSNP
rs759181597 24 dbSNP
rs1347139995 30 dbSNP
rs540107598 35 dbSNP
rs371552273 36 dbSNP
rs367841228 37 dbSNP
rs555446446 39 dbSNP
rs1215383668 43 dbSNP
rs1335750594 44 dbSNP
rs760264642 46 dbSNP
rs773016202 48 dbSNP
rs1275152157 49 dbSNP
rs1018974337 54 dbSNP
rs1244761251 58 dbSNP
rs1203990812 59 dbSNP
rs1047375618 69 dbSNP
rs1490941137 74 dbSNP
rs1482803825 81 dbSNP
rs1254548157 87 dbSNP
rs1197788475 99 dbSNP
rs1268645413 100 dbSNP
rs1475499972 104 dbSNP
rs1008866658 115 dbSNP
rs1416713881 116 dbSNP
rs1408917314 117 dbSNP
rs1165360340 136 dbSNP
rs1317635191 144 dbSNP
rs12146 153 dbSNP
rs1238639036 171 dbSNP
rs1302228182 181 dbSNP
rs143634004 181 dbSNP
rs1045073583 184 dbSNP
rs1272195396 193 dbSNP
rs1359916461 196 dbSNP
rs1214127416 199 dbSNP
rs948099614 207 dbSNP
rs1362147068 210 dbSNP
rs896585724 211 dbSNP
rs148932784 215 dbSNP
rs938541040 219 dbSNP
rs11974850 226 dbSNP
rs1400497670 234 dbSNP
rs763151959 248 dbSNP
rs748030450 264 dbSNP
rs1183602679 269 dbSNP
rs1386561417 270 dbSNP
rs1442653104 271 dbSNP
rs1162871616 285 dbSNP
rs1380405127 285 dbSNP
rs1157472989 287 dbSNP
rs1437754739 294 dbSNP
rs1387085322 305 dbSNP
rs1320526458 306 dbSNP
rs571195639 320 dbSNP
rs1430297345 326 dbSNP
rs1184117788 344 dbSNP
rs1044653795 359 dbSNP
rs1244356733 363 dbSNP
rs948994041 367 dbSNP
rs917472911 376 dbSNP
rs1351818322 382 dbSNP
rs572818160 383 dbSNP
rs975120893 385 dbSNP
rs1207150372 388 dbSNP
rs1486288789 394 dbSNP
rs769605185 403 dbSNP
rs1244388598 407 dbSNP
rs907655264 408 dbSNP
rs1459625287 410 dbSNP
rs983211297 411 dbSNP
rs952000244 428 dbSNP
rs1027470176 433 dbSNP
rs974550445 438 dbSNP
rs745845495 457 dbSNP
rs776653744 465 dbSNP
rs1156530134 466 dbSNP
rs1361671307 469 dbSNP
rs1456876074 470 dbSNP
rs1019399357 472 dbSNP
rs1337664363 476 dbSNP
rs986955525 477 dbSNP
rs1450599215 478 dbSNP
rs1336649810 481 dbSNP
rs190660175 482 dbSNP
rs146807582 489 dbSNP
rs1444991913 494 dbSNP
rs1297089864 495 dbSNP
rs778862646 495 dbSNP
rs1223719300 497 dbSNP
rs1018835641 500 dbSNP
rs1009353365 506 dbSNP
rs1320790905 509 dbSNP
rs770734257 517 dbSNP
rs1250628747 519 dbSNP
rs891788198 523 dbSNP
rs1439424159 525 dbSNP
rs1025901538 529 dbSNP
rs528114061 537 dbSNP
rs1232044062 540 dbSNP
rs1339113649 542 dbSNP
rs1480669210 547 dbSNP
rs1177384374 557 dbSNP
rs1431811348 559 dbSNP
rs557665686 563 dbSNP
rs565632519 564 dbSNP
rs1172014512 574 dbSNP
rs1397339352 575 dbSNP
rs1000269079 579 dbSNP
rs898753859 585 dbSNP
rs904595481 591 dbSNP
rs1350217888 593 dbSNP
rs1406006363 597 dbSNP
rs1383578714 606 dbSNP
rs548954905 607 dbSNP
rs529027369 614 dbSNP
rs1024025734 615 dbSNP
rs1297198857 620 dbSNP
rs1417388252 632 dbSNP
rs1044557916 639 dbSNP
rs1013001943 647 dbSNP
rs1366873199 653 dbSNP
rs1012265955 658 dbSNP
rs143723112 667 dbSNP
rs549745947 669 dbSNP
rs939047533 678 dbSNP
rs1272258260 679 dbSNP
rs777361967 686 dbSNP
rs1201393458 705 dbSNP
rs1047958467 706 dbSNP
rs1479554415 708 dbSNP
rs140331901 724 dbSNP
rs1373690646 735 dbSNP
rs1366520932 740 dbSNP
rs1166657996 742 dbSNP
rs1194990861 746 dbSNP
rs938509735 748 dbSNP
rs1425857560 751 dbSNP
rs1305267386 753 dbSNP
rs564063768 755 dbSNP
rs1364134554 757 dbSNP
rs1385830976 769 dbSNP
rs1295911207 770 dbSNP
rs920313003 775 dbSNP
rs1429338753 782 dbSNP
rs747796816 784 dbSNP
rs964538187 794 dbSNP
rs370570362 797 dbSNP
rs1359996216 801 dbSNP
rs1224639086 804 dbSNP
rs1289260584 811 dbSNP
rs987394267 812 dbSNP
rs185937225 816 dbSNP
rs1209429705 822 dbSNP
rs1262771697 826 dbSNP
rs1292544079 827 dbSNP
rs1209797261 829 dbSNP
rs1191043356 838 dbSNP
rs780606042 841 dbSNP
rs1389635033 848 dbSNP
rs1031692540 856 dbSNP
rs1354795346 860 dbSNP
rs1000577435 866 dbSNP
rs561977022 867 dbSNP
rs1364082633 869 dbSNP
rs968784708 878 dbSNP
rs1228698035 880 dbSNP
rs1289085924 881 dbSNP
rs749553013 887 dbSNP
rs1041560992 893 dbSNP
rs947264867 897 dbSNP
rs914514103 910 dbSNP
rs1382910344 919 dbSNP
rs1312882684 921 dbSNP
rs975466337 928 dbSNP
rs1239572632 938 dbSNP
rs146737426 957 dbSNP
rs1486933524 958 dbSNP
rs1013075482 964 dbSNP
rs895979393 972 dbSNP
rs1057511539 982 dbSNP
rs1247441853 985 dbSNP
rs1461868307 989 dbSNP
rs569080847 993 dbSNP
rs1160219643 996 dbSNP
rs1365922181 997 dbSNP
rs1451130377 998 dbSNP
rs556603165 1008 dbSNP
rs1158022444 1011 dbSNP
rs887333689 1013 dbSNP
rs1454177321 1014 dbSNP
rs1047403440 1015 dbSNP
rs1388403293 1021 dbSNP
rs930261461 1022 dbSNP
rs1465998171 1026 dbSNP
rs1422626844 1027 dbSNP
rs1168841097 1030 dbSNP
rs1308825369 1031 dbSNP
rs183004508 1031 dbSNP
rs373257868 1034 dbSNP
rs577484918 1047 dbSNP
rs771789877 1049 dbSNP
rs896525499 1057 dbSNP
rs1253071615 1068 dbSNP
rs1417741754 1069 dbSNP
rs1035063406 1092 dbSNP
rs554508055 1108 dbSNP
rs534453769 1109 dbSNP
rs750563828 1111 dbSNP
rs1470759154 1113 dbSNP
rs1253360970 1114 dbSNP
rs1173544888 1115 dbSNP
rs999526352 1117 dbSNP
rs1038794939 1121 dbSNP
rs1299867279 1128 dbSNP
rs943213294 1136 dbSNP
rs1409061137 1138 dbSNP
rs911709903 1140 dbSNP
rs6963804 1141 dbSNP
rs1311706178 1143 dbSNP
rs1205795009 1149 dbSNP
rs955997944 1149 dbSNP
rs1482269665 1164 dbSNP
rs139598915 1167 dbSNP
rs978785721 1171 dbSNP
rs968686585 1179 dbSNP
rs942343709 1182 dbSNP
rs1023038197 1190 dbSNP
rs1435214522 1193 dbSNP
rs1428637164 1194 dbSNP
rs1172441480 1197 dbSNP
rs912194740 1198 dbSNP
rs535416879 1201 dbSNP
rs1367251998 1202 dbSNP
rs929680897 1202 dbSNP
rs1406945759 1205 dbSNP
rs1273333641 1206 dbSNP
rs1366986538 1211 dbSNP
rs1215297659 1212 dbSNP
rs1297830447 1216 dbSNP
rs960220606 1217 dbSNP
rs1330869476 1220 dbSNP
rs1292899498 1221 dbSNP
rs146860848 1221 dbSNP
rs1490956804 1221 dbSNP
rs376962194 1221 dbSNP
rs751698921 1221 dbSNP
rs569667584 1248 dbSNP
rs1245837538 1249 dbSNP
rs1475449876 1257 dbSNP
rs1447383629 1259 dbSNP
rs1004760056 1264 dbSNP
rs1387791952 1265 dbSNP
rs887375130 1274 dbSNP
rs1027647998 1277 dbSNP
rs994539624 1284 dbSNP
rs764157543 1285 dbSNP
rs1038827662 1286 dbSNP
rs1349455438 1288 dbSNP
rs1172204492 1289 dbSNP
rs1477111831 1290 dbSNP
rs752007569 1307 dbSNP
rs1362405755 1309 dbSNP
rs1316401523 1315 dbSNP
rs1362036551 1316 dbSNP
rs763206981 1334 dbSNP
rs567618957 1341 dbSNP
rs374130197 1350 dbSNP
rs890174405 1351 dbSNP
rs775670181 1352 dbSNP
rs532965402 1353 dbSNP
rs1184120840 1356 dbSNP
rs999501990 1362 dbSNP
rs1162359908 1380 dbSNP
rs924588517 1383 dbSNP
rs1401453812 1386 dbSNP
rs1161709768 1387 dbSNP
rs1386504264 1388 dbSNP
rs1434551126 1395 dbSNP
rs978639247 1396 dbSNP
rs1446470039 1399 dbSNP
rs1278964215 1405 dbSNP
rs1283935102 1407 dbSNP
rs1351882652 1410 dbSNP
rs1225095087 1415 dbSNP
rs1265902064 1422 dbSNP
rs1218254820 1423 dbSNP
rs1342310000 1428 dbSNP
rs549422589 1431 dbSNP
rs1280741459 1433 dbSNP
rs1240806604 1446 dbSNP
rs765328459 1448 dbSNP
rs1375973952 1471 dbSNP
rs1264460796 1476 dbSNP
rs868019832 1480 dbSNP
rs947418200 1488 dbSNP
rs915892885 1489 dbSNP
rs991423977 1492 dbSNP
rs1022407970 1501 dbSNP
rs1011819642 1504 dbSNP
rs1456928324 1505 dbSNP
rs764542895 1506 dbSNP
rs1036149901 1510 dbSNP
rs1413217360 1519 dbSNP
rs982972848 1524 dbSNP
rs150591975 1527 dbSNP
rs1039946504 1536 dbSNP
rs769806711 1536 dbSNP
rs1349418213 1538 dbSNP
rs201400173 1538 dbSNP
rs374653795 1538 dbSNP
rs1387259269 1540 dbSNP
rs1223779326 1542 dbSNP
rs1264406579 1543 dbSNP
rs1027268397 1557 dbSNP
rs1159264988 1561 dbSNP
rs1006780768 1564 dbSNP
rs563901143 1568 dbSNP
rs1439328201 1573 dbSNP
rs1439623585 1574 dbSNP
rs1202691105 1575 dbSNP
rs1250807445 1576 dbSNP
rs1379069010 1587 dbSNP
rs1185951248 1588 dbSNP
rs995741279 1589 dbSNP
rs1477106745 1590 dbSNP
rs1473358158 1592 dbSNP
rs1172504741 1598 dbSNP
rs369455475 1600 dbSNP
rs547177619 1606 dbSNP
rs1306513996 1608 dbSNP
rs1370357481 1621 dbSNP
rs929649531 1622 dbSNP
rs1303006877 1623 dbSNP
rs1328842470 1625 dbSNP
rs1017296582 1633 dbSNP
rs1270285613 1635 dbSNP
rs1440285129 1637 dbSNP
rs1007199961 1638 dbSNP
rs776223533 1649 dbSNP
rs1226131337 1650 dbSNP
rs1038156257 1659 dbSNP
rs1352314778 1660 dbSNP
rs941522909 1666 dbSNP
rs890217412 1674 dbSNP
rs1449929916 1675 dbSNP
rs527624259 1677 dbSNP
rs1198164341 1691 dbSNP
rs990955727 1692 dbSNP
rs1451825014 1694 dbSNP
rs561993007 1705 dbSNP
rs1283336021 1709 dbSNP
rs960922301 1712 dbSNP
rs1294909688 1724 dbSNP
rs1425762054 1724 dbSNP
rs1388057792 1729 dbSNP
rs1385881874 1731 dbSNP
rs1051946079 1732 dbSNP
rs191221788 1733 dbSNP
rs1419234069 1736 dbSNP
rs1296840241 1740 dbSNP
rs1246798976 1747 dbSNP
rs978050865 1747 dbSNP
rs1263458122 1760 dbSNP
rs903000859 1766 dbSNP
rs1358677096 1771 dbSNP
rs541891274 1775 dbSNP
rs1354456873 1776 dbSNP
rs1209490573 1778 dbSNP
rs576349375 1785 dbSNP
rs1262488248 1806 dbSNP
rs966770779 1808 dbSNP
rs1303408108 1819 dbSNP
rs562863164 1820 dbSNP
rs1042976519 1829 dbSNP
rs947323113 1831 dbSNP
rs915799627 1832 dbSNP
rs1187220330 1833 dbSNP
rs1166059273 1835 dbSNP
rs1248012297 1835 dbSNP
rs1167267287 1851 dbSNP
rs1367120828 1856 dbSNP
rs991456560 1874 dbSNP
rs1457055127 1890 dbSNP
rs1158838095 1891 dbSNP
rs11972941 1893 dbSNP
rs1432329580 1896 dbSNP
rs928769990 1899 dbSNP
rs1383347324 1902 dbSNP
rs1397741915 1903 dbSNP
rs372825316 1905 dbSNP
rs1180416668 1917 dbSNP
rs983259384 1934 dbSNP
rs951602454 1935 dbSNP
rs920108403 1939 dbSNP
rs1264957170 1945 dbSNP
rs974211697 1947 dbSNP
rs1193910414 1949 dbSNP
rs1487700986 1950 dbSNP
rs1018076649 1953 dbSNP
rs1223711068 1961 dbSNP
rs964298626 1968 dbSNP
rs1267599904 1970 dbSNP
rs376740420 1975 dbSNP
rs1322191108 1977 dbSNP
rs1288880133 1980 dbSNP
rs1006744785 1981 dbSNP
rs891028938 1983 dbSNP
rs1029612221 1987 dbSNP
rs1413801966 1998 dbSNP
rs1455317846 2000 dbSNP
rs1018500585 2001 dbSNP
rs2533864 2034 dbSNP
rs1279134814 2046 dbSNP
rs896856906 2048 dbSNP
rs1301069590 2049 dbSNP
rs1378156344 2055 dbSNP
rs1399596786 2056 dbSNP
rs1038447305 2062 dbSNP
rs1007274828 2063 dbSNP
rs941085110 2068 dbSNP
rs954516206 2069 dbSNP
rs1030109370 2071 dbSNP
rs760675147 2075 dbSNP
rs1212828203 2090 dbSNP
rs902907004 2092 dbSNP
rs1055202575 2094 dbSNP
rs1437816043 2106 dbSNP
rs142493330 2117 dbSNP
rs1163278513 2119 dbSNP
rs1471385293 2123 dbSNP
rs1181067261 2124 dbSNP
rs1429357978 2128 dbSNP
rs1011330262 2138 dbSNP
rs1358440886 2152 dbSNP
rs1462446036 2167 dbSNP
rs554452988 2170 dbSNP
rs1055635958 2175 dbSNP
rs945623585 2177 dbSNP
rs1307711757 2180 dbSNP
rs369870439 2182 dbSNP
rs1477265169 2188 dbSNP
rs1299283788 2190 dbSNP
rs1260431046 2194 dbSNP
rs1229832931 2201 dbSNP
rs553782233 2207 dbSNP
rs753074583 2213 dbSNP
rs879493490 2234 dbSNP
rs1246994841 2240 dbSNP
rs989902476 2241 dbSNP
rs1433286620 2243 dbSNP
rs1188890240 2250 dbSNP
rs1423885176 2255 dbSNP
rs1246108512 2259 dbSNP
rs1429010369 2267 dbSNP
rs964799902 2269 dbSNP
rs1017723983 2274 dbSNP
rs1428935408 2275 dbSNP
rs1219250556 2278 dbSNP
rs1319781091 2285 dbSNP
rs1438890165 2298 dbSNP
rs534368694 2302 dbSNP
rs1291807037 2316 dbSNP
rs985275908 2322 dbSNP
rs1436439472 2332 dbSNP
rs575245022 2334 dbSNP
rs1300525393 2335 dbSNP
rs955223352 2336 dbSNP
rs1228042206 2338 dbSNP
rs1218274851 2340 dbSNP
rs1316225877 2343 dbSNP
rs930066007 2344 dbSNP
rs1323097594 2357 dbSNP
rs1029581232 2368 dbSNP
rs1190416230 2373 dbSNP
rs745890452 2373 dbSNP
rs1303673238 2374 dbSNP
rs747852075 2382 dbSNP
rs919976292 2386 dbSNP
rs186371376 2403 dbSNP
rs1292336832 2411 dbSNP
rs1407268070 2412 dbSNP
rs181026666 2423 dbSNP
rs1349360402 2433 dbSNP
rs1322651986 2434 dbSNP
rs746244664 2434 dbSNP
rs987444471 2452 dbSNP
rs189030136 2453 dbSNP
rs1421105234 2454 dbSNP
rs1285113030 2455 dbSNP
rs139479777 2456 dbSNP
rs1030428063 2462 dbSNP
rs939520423 2468 dbSNP
rs1329228787 2472 dbSNP
rs1189432673 2479 dbSNP
rs998501998 2485 dbSNP
rs1209981062 2489 dbSNP
rs373352741 2501 dbSNP
rs1042543088 2506 dbSNP
rs1188197676 2512 dbSNP
rs1238967773 2517 dbSNP
rs1471723594 2518 dbSNP
rs375541992 2519 dbSNP
rs1417340853 2520 dbSNP
rs1473050189 2521 dbSNP
rs1238574591 2523 dbSNP
rs147373082 2524 dbSNP
rs1456269300 2525 dbSNP
rs1386585511 2530 dbSNP
rs1400604653 2531 dbSNP
rs1011403456 2538 dbSNP
rs1258038415 2548 dbSNP
rs989476054 2550 dbSNP
rs1335506032 2563 dbSNP
rs1361245111 2564 dbSNP
rs1283975040 2571 dbSNP
rs186651162 2581 dbSNP
rs1055661719 2582 dbSNP
rs1285859556 2586 dbSNP
rs1299226917 2587 dbSNP
rs1327928294 2594 dbSNP
rs987593037 2596 dbSNP
rs954777600 2600 dbSNP
rs181099330 2601 dbSNP
rs922395642 2602 dbSNP
rs1378215912 2603 dbSNP
rs567146238 2605 dbSNP
rs1003220328 2611 dbSNP
rs907089106 2623 dbSNP
rs527465923 2624 dbSNP
rs1409821502 2627 dbSNP
rs568277629 2631 dbSNP
rs1173663884 2643 dbSNP
rs920045132 2645 dbSNP
rs1304265359 2653 dbSNP
rs1038453070 2654 dbSNP
rs957074337 2657 dbSNP
rs1358094234 2663 dbSNP
rs1017294254 2665 dbSNP
rs942876933 2676 dbSNP
rs911377470 2677 dbSNP
rs959071831 2684 dbSNP
rs1411237271 2694 dbSNP
rs1033311803 2698 dbSNP
rs1349336730 2701 dbSNP
rs1233259884 2712 dbSNP
rs1276122829 2713 dbSNP
rs1003213435 2718 dbSNP
rs1173269405 2719 dbSNP
rs1275049827 2719 dbSNP
rs1483941535 2727 dbSNP
rs1207545245 2738 dbSNP
rs752032833 2743 dbSNP
rs1437466901 2752 dbSNP
rs1199595918 2754 dbSNP
rs934252056 2755 dbSNP
rs1477300802 2762 dbSNP
rs1173601381 2763 dbSNP
rs1391159718 2782 dbSNP
rs1432092328 2791 dbSNP
rs906307348 2795 dbSNP
rs1395252482 2796 dbSNP
rs17171660 2799 dbSNP
rs1324909713 2800 dbSNP
rs1328891196 2809 dbSNP
rs531610753 2814 dbSNP
rs1298311723 2824 dbSNP
rs142770480 2830 dbSNP
rs1225816912 2839 dbSNP
rs1273665188 2845 dbSNP
rs1338924435 2846 dbSNP
rs139233905 2850 dbSNP
rs1257966996 2854 dbSNP
rs1021364511 2859 dbSNP
rs989839482 2861 dbSNP
rs1054477854 2869 dbSNP
rs958424363 2875 dbSNP
rs1483017140 2879 dbSNP
rs1451897614 2894 dbSNP
rs1034158846 2895 dbSNP
rs1254343319 2902 dbSNP
rs144313345 2903 dbSNP
rs1354485074 2904 dbSNP
rs560553325 2909 dbSNP
rs910515198 2912 dbSNP
rs1285984574 2925 dbSNP
rs369254594 2926 dbSNP
rs760370124 2930 dbSNP
rs772851349 2932 dbSNP
rs1460525289 2937 dbSNP
rs933363677 2941 dbSNP
rs1238567503 2947 dbSNP
rs28548682 2952 dbSNP
rs1432834482 2956 dbSNP
rs994607843 2966 dbSNP
rs1313819204 2978 dbSNP
rs535374316 2980 dbSNP
rs544852078 2985 dbSNP
rs1245762212 2993 dbSNP
rs752733817 2998 dbSNP
rs1267531240 3000 dbSNP
rs1396261172 3005 dbSNP
rs1267267 3006 dbSNP
rs1268876945 3010 dbSNP
rs1466608408 3015 dbSNP
rs909799609 3020 dbSNP
rs757357635 3028 dbSNP
rs1310686191 3029 dbSNP
rs984406578 3033 dbSNP
rs1421046103 3035 dbSNP
rs959291980 3044 dbSNP
rs1159194690 3052 dbSNP
rs942781994 3055 dbSNP
rs1455543926 3056 dbSNP
rs555784794 3063 dbSNP
rs539021818 3068 dbSNP
rs1402623723 3071 dbSNP
rs1397494570 3075 dbSNP
rs1051711083 3077 dbSNP
rs188964327 3080 dbSNP
rs1232935470 3086 dbSNP
rs1289033422 3087 dbSNP
rs1331373488 3111 dbSNP
rs970434411 3116 dbSNP
rs1260721589 3118 dbSNP
rs753726507 3130 dbSNP
rs978360004 3136 dbSNP
rs945739706 3137 dbSNP
rs1254535475 3144 dbSNP
rs1485115714 3146 dbSNP
rs1182495546 3159 dbSNP
rs184466865 3163 dbSNP
rs1413500692 3164 dbSNP
rs1471355767 3171 dbSNP
rs56342000 3172 dbSNP
rs1465362588 3173 dbSNP
rs192074492 3180 dbSNP
rs533759138 3185 dbSNP
rs1215113657 3188 dbSNP
rs568200097 3195 dbSNP
rs1374669038 3196 dbSNP
rs1034062722 3200 dbSNP
rs1308928796 3205 dbSNP
rs981719215 3209 dbSNP
rs1222077265 3214 dbSNP
rs971245043 3223 dbSNP
rs1313248452 3228 dbSNP
rs1236109108 3232 dbSNP
rs149616931 3232 dbSNP
rs889384376 3232 dbSNP
rs1320270618 3233 dbSNP
rs1253608420 3255 dbSNP
rs1479463758 3256 dbSNP
rs78951289 3258 dbSNP
rs75614511 3259 dbSNP
rs77872099 3260 dbSNP
rs1267483557 3262 dbSNP
rs898393608 3264 dbSNP
rs571152181 3270 dbSNP
rs76663288 3271 dbSNP
rs1006862734 3272 dbSNP
rs112619195 3273 dbSNP
rs11441182 3273 dbSNP
rs201264250 3273 dbSNP
rs398004505 3273 dbSNP
rs1368443688 3274 dbSNP
rs1392880836 3274 dbSNP
rs1036894698 3275 dbSNP
rs1389005672 3277 dbSNP
rs1163755496 3283 dbSNP
rs942131035 3288 dbSNP
rs768603843 3294 dbSNP
rs1173128836 3303 dbSNP
rs1305364977 3307 dbSNP
rs1203431954 3321 dbSNP
rs1265494454 3324 dbSNP
rs889878736 3328 dbSNP
rs1489209060 3330 dbSNP
rs1051187198 3340 dbSNP
rs569036062 3345 dbSNP
rs1478242618 3347 dbSNP
rs1450018495 3348 dbSNP
rs934188201 3352 dbSNP
rs909674610 3354 dbSNP
rs902667823 3355 dbSNP
rs113317703 3361 dbSNP
rs1408395565 3365 dbSNP
rs1350524514 3369 dbSNP
rs1459568872 3372 dbSNP
rs946982760 3379 dbSNP
rs1323974777 3380 dbSNP
rs532515686 3397 dbSNP
rs915459338 3400 dbSNP
rs1453397162 3401 dbSNP
rs1054050726 3404 dbSNP
rs560592308 3405 dbSNP
rs926567205 3411 dbSNP
rs1323152003 3415 dbSNP
rs1211215450 3421 dbSNP
rs138308004 3424 dbSNP
rs77195547 3426 dbSNP
rs1020698417 3428 dbSNP
rs971659123 3429 dbSNP
rs1240118548 3431 dbSNP
rs61059584 3438 dbSNP
rs918447283 3448 dbSNP
rs1260342945 3452 dbSNP
rs1220107682 3454 dbSNP
rs1414715324 3456 dbSNP
rs988254677 3457 dbSNP
rs1162833974 3458 dbSNP
rs957819776 3460 dbSNP
rs1224687032 3461 dbSNP
rs12534074 3462 dbSNP
rs1324165741 3464 dbSNP
rs1007749663 3465 dbSNP
rs1430376039 3474 dbSNP
rs58689624 3475 dbSNP
rs539827668 3480 dbSNP
rs1030622467 3481 dbSNP
rs1329302101 3483 dbSNP
rs1333048982 3485 dbSNP
rs1016823155 3488 dbSNP
rs1282146084 3490 dbSNP
rs1006936340 3493 dbSNP
rs1446359566 3494 dbSNP
rs954064255 3504 dbSNP
rs60667077 3511 dbSNP
rs781652373 3515 dbSNP
rs902567169 3525 dbSNP
rs111580242 3529 dbSNP
rs1417239239 3534 dbSNP
rs867858155 3535 dbSNP
rs758759052 3536 dbSNP
rs894099361 3536 dbSNP
rs1378235959 3543 dbSNP
rs375759134 3544 dbSNP
rs561601498 3544 dbSNP
rs1048687870 3550 dbSNP
rs1055294371 3553 dbSNP
rs1377691776 3554 dbSNP
rs1412513839 3560 dbSNP
rs937034338 3563 dbSNP
rs1453059115 3565 dbSNP
rs1240420118 3569 dbSNP
rs1277277782 3571 dbSNP
rs1349822364 3572 dbSNP
rs926958731 3576 dbSNP
rs1280451270 3584 dbSNP
rs1345545928 3590 dbSNP
rs937876912 3591 dbSNP
rs1476986371 3592 dbSNP
rs1457592129 3595 dbSNP
rs1257083493 3597 dbSNP
rs1193682545 3609 dbSNP
rs1256997881 3613 dbSNP
rs1346540560 3614 dbSNP
rs926531218 3623 dbSNP
rs1274870558 3632 dbSNP
rs1232456848 3639 dbSNP
rs1470045117 3640 dbSNP
rs1173724606 3645 dbSNP
rs1397255508 3648 dbSNP
rs747329811 3653 dbSNP
rs572533641 3654 dbSNP
rs192765248 3655 dbSNP
rs557764694 3656 dbSNP
rs187449210 3657 dbSNP
rs913523947 3658 dbSNP
rs1416334706 3667 dbSNP
rs1275118955 3671 dbSNP
rs1403020293 3672 dbSNP
rs1172006215 3674 dbSNP
rs753101401 3676 dbSNP
rs1270942080 3678 dbSNP
rs1437375503 3679 dbSNP
rs375986354 3680 dbSNP
rs987836947 3683 dbSNP
rs1453127152 3684 dbSNP
rs1193338968 3689 dbSNP
rs985362408 3692 dbSNP
rs1439511415 3693 dbSNP
rs954209461 3697 dbSNP
rs758836678 3702 dbSNP
rs1395141971 3707 dbSNP
rs13224850 3708 dbSNP
rs986291010 3719 dbSNP
rs1392140559 3720 dbSNP
rs953566998 3721 dbSNP
rs1298021068 3726 dbSNP
rs576248275 3731 dbSNP
rs1328029497 3733 dbSNP
rs1278717614 3734 dbSNP
rs966821576 3746 dbSNP
rs1338982796 3748 dbSNP
rs1210446654 3762 dbSNP
rs533845375 3767 dbSNP
rs1467494124 3776 dbSNP
rs1345101821 3778 dbSNP
rs1288135603 3784 dbSNP
rs1240737173 3785 dbSNP
rs1020991567 3792 dbSNP
rs1372085649 3793 dbSNP
rs557123492 3796 dbSNP
rs867816250 3796 dbSNP
rs893961329 3797 dbSNP
rs796820088 3798 dbSNP
rs1055325568 3799 dbSNP
rs1002475169 3800 dbSNP
rs1317388802 3800 dbSNP
rs1326022280 3800 dbSNP
rs1343065934 3800 dbSNP
rs1380245311 3800 dbSNP
rs1487144715 3800 dbSNP
rs72174660 3800 dbSNP
rs1341370023 3801 dbSNP
rs1261513643 3803 dbSNP
rs1333744118 3803 dbSNP
rs906751935 3803 dbSNP
rs568054512 3804 dbSNP
rs949714340 3807 dbSNP
rs1414999918 3808 dbSNP
rs554795791 3810 dbSNP
rs140486099 3812 dbSNP
rs1365409449 3814 dbSNP
rs1036775396 3815 dbSNP
rs569148158 3816 dbSNP
rs887848288 3821 dbSNP
rs377363319 3826 dbSNP
rs1055837816 3832 dbSNP
rs941203544 3834 dbSNP
rs1419575465 3839 dbSNP
rs1315089250 3841 dbSNP
rs909698651 3852 dbSNP
rs1406252875 3861 dbSNP
rs1414184997 3862 dbSNP
rs1046221905 3864 dbSNP
rs1165296023 3886 dbSNP
rs537926651 3894 dbSNP
rs949297231 3894 dbSNP
rs1349119729 3901 dbSNP
rs1052512571 3902 dbSNP
rs183307851 3904 dbSNP
rs1254869315 3905 dbSNP
rs1473326750 3914 dbSNP
rs1252086647 3915 dbSNP
rs936379585 3915 dbSNP
rs932593568 3921 dbSNP
rs922471617 3926 dbSNP
rs1377986335 3932 dbSNP
rs1186752341 3933 dbSNP
rs953116601 3934 dbSNP
rs138830314 3935 dbSNP
rs547005807 3960 dbSNP
rs1373820283 3966 dbSNP
rs1434375562 3975 dbSNP
rs967103900 3979 dbSNP
rs1298791749 3995 dbSNP
rs145048382 3997 dbSNP
rs989503048 4006 dbSNP
rs1306991836 4011 dbSNP
rs1217266502 4013 dbSNP
rs1372363400 4024 dbSNP
rs1236872107 4036 dbSNP
rs1278663285 4037 dbSNP
rs962591771 4040 dbSNP
rs1204825017 4066 dbSNP
rs958089555 4068 dbSNP
rs1252529333 4071 dbSNP
rs1033825126 4074 dbSNP
rs1006629854 4086 dbSNP
rs1253486613 4088 dbSNP
rs1354442729 4093 dbSNP
rs1455550656 4096 dbSNP
rs1002752255 4102 dbSNP
rs1316203595 4109 dbSNP
rs894290005 4115 dbSNP
rs1229882106 4118 dbSNP
rs201390913 4121 dbSNP
rs1171467393 4122 dbSNP
rs1283868818 4122 dbSNP
rs1356349105 4122 dbSNP
rs1460468018 4122 dbSNP
rs1413116647 4142 dbSNP
rs906788320 4143 dbSNP
rs1203149525 4144 dbSNP
rs1211797026 4144 dbSNP
rs1214795022 4144 dbSNP
rs1254686715 4144 dbSNP
rs1273308704 4144 dbSNP
rs1297196359 4144 dbSNP
rs1301662493 4144 dbSNP
rs1305419368 4144 dbSNP
rs1370783055 4144 dbSNP
rs1443795068 4144 dbSNP
rs1469742755 4144 dbSNP
rs764163833 4144 dbSNP
rs1200321973 4145 dbSNP
rs1346309090 4146 dbSNP
rs1431862637 4147 dbSNP
rs1298822985 4148 dbSNP
rs1213674136 4149 dbSNP
rs1399934368 4150 dbSNP
rs1344015053 4152 dbSNP
rs1025647279 4157 dbSNP
rs1013955755 4166 dbSNP
rs896812483 4167 dbSNP
rs1172645265 4168 dbSNP
rs1326091966 4170 dbSNP
rs1406367284 4176 dbSNP
rs1413486190 4177 dbSNP
rs1036806457 4188 dbSNP
rs113590565 4189 dbSNP
rs755292825 4195 dbSNP
rs1425156515 4199 dbSNP
rs1193276702 4202 dbSNP
rs1193839515 4213 dbSNP
rs1258297162 4218 dbSNP
rs1034314270 4220 dbSNP
rs551192734 4227 dbSNP
rs753975722 4233 dbSNP
rs1413645070 4240 dbSNP
rs1401828395 4242 dbSNP
rs1049584096 4244 dbSNP
rs1343857156 4245 dbSNP
rs932473685 4250 dbSNP
rs146578801 4251 dbSNP
rs1240339263 4256 dbSNP
rs1356976411 4259 dbSNP
rs1412314963 4265 dbSNP
rs1292154434 4270 dbSNP
rs1046190569 4271 dbSNP
rs1451994033 4280 dbSNP
rs1272254529 4295 dbSNP
rs977059951 4298 dbSNP
rs1225432913 4303 dbSNP
rs565260230 4308 dbSNP
rs10224369 4311 dbSNP
rs1013443164 4314 dbSNP
rs1216157340 4315 dbSNP
rs892364384 4319 dbSNP
rs760568885 4320 dbSNP
rs1185847235 4326 dbSNP
rs1237018830 4332 dbSNP
rs1470788180 4333 dbSNP
rs913919742 4334 dbSNP
rs1406238807 4335 dbSNP
rs1279072493 4338 dbSNP
rs1419413231 4341 dbSNP
rs1174667293 4346 dbSNP
rs1214117590 4348 dbSNP
rs757279799 4350 dbSNP
rs1359928498 4354 dbSNP
rs545250909 4356 dbSNP
rs1295842618 4360 dbSNP
rs1052402822 4364 dbSNP
rs936587750 4369 dbSNP
rs1335883201 4379 dbSNP
rs1444277909 4381 dbSNP
rs1277770051 4384 dbSNP
rs1437750428 4387 dbSNP
rs958125507 4390 dbSNP
rs1050102613 4396 dbSNP
rs1467508300 4403 dbSNP
rs1209062667 4405 dbSNP
rs1033687966 4406 dbSNP
rs1438535560 4410 dbSNP
rs923041144 4413 dbSNP
rs981004496 4415 dbSNP
rs971297578 4416 dbSNP
rs191916744 4417 dbSNP
rs908114960 4418 dbSNP
rs1452161030 4420 dbSNP
rs750199187 4421 dbSNP
rs143111707 4422 dbSNP
rs1411088931 4423 dbSNP
rs1399409162 4424 dbSNP
rs1441599954 4438 dbSNP
rs898056554 4442 dbSNP
rs1458914832 4451 dbSNP
rs1259001148 4453 dbSNP
rs539844917 4465 dbSNP
rs187170959 4472 dbSNP
rs1216350505 4473 dbSNP
rs1271006621 4478 dbSNP
rs1457683394 4479 dbSNP
rs1001507027 4480 dbSNP
rs1005182658 4482 dbSNP
rs1255269518 4501 dbSNP
rs1467468173 4502 dbSNP
rs888234945 4509 dbSNP
rs1373228152 4514 dbSNP
rs1303428031 4515 dbSNP
rs183137731 4518 dbSNP
rs996719464 4521 dbSNP
rs900982380 4530 dbSNP
rs114297000 4533 dbSNP
rs1461884441 4541 dbSNP
rs1327925978 4544 dbSNP
rs1013828981 4565 dbSNP
rs892260457 4574 dbSNP
rs1052707231 4585 dbSNP
rs558891364 4590 dbSNP
rs1327202422 4591 dbSNP
rs1449532169 4601 dbSNP
rs903791590 4602 dbSNP
rs376319108 4613 dbSNP
rs945307234 4614 dbSNP
rs1331661350 4619 dbSNP
rs913788862 4622 dbSNP
rs1275522336 4627 dbSNP
rs567744571 4630 dbSNP
rs1352269804 4632 dbSNP
rs1209576216 4636 dbSNP
rs538973943 4637 dbSNP
rs1262920517 4642 dbSNP
rs936674571 4647 dbSNP
rs1190652933 4649 dbSNP
rs940435826 4665 dbSNP
rs907999805 4671 dbSNP
rs1166488276 4678 dbSNP
rs985374910 4683 dbSNP
rs555924267 4686 dbSNP
rs1191644765 4687 dbSNP
rs1441355842 4688 dbSNP
rs981251332 4693 dbSNP
rs980058856 4695 dbSNP
rs1296655542 4696 dbSNP
rs1340126119 4703 dbSNP
rs971404900 4706 dbSNP
rs1295223508 4718 dbSNP
rs775030818 4723 dbSNP
rs769400541 4734 dbSNP
rs546997363 4736 dbSNP
rs1257981131 4738 dbSNP
rs962291812 4745 dbSNP
rs1203761893 4751 dbSNP
rs1016522897 4753 dbSNP
rs534178413 4754 dbSNP
rs952344109 4762 dbSNP
rs1278867670 4763 dbSNP
rs1028094808 4765 dbSNP
rs1242904025 4766 dbSNP
rs1001132178 4773 dbSNP
rs536239608 4774 dbSNP
rs1365319489 4776 dbSNP
rs1451271190 4783 dbSNP
rs1157840014 4787 dbSNP
rs900889230 4789 dbSNP
rs1435616902 4792 dbSNP
rs1041282411 4793 dbSNP
rs1306660627 4796 dbSNP
rs567765574 4811 dbSNP
rs1400233834 4817 dbSNP
rs1009318337 4818 dbSNP
rs1390462970 4825 dbSNP
rs892424915 4826 dbSNP
rs796130144 4827 dbSNP
rs1309033385 4839 dbSNP
rs550771153 4840 dbSNP
rs1304207917 4843 dbSNP
rs1414918279 4855 dbSNP
rs1374286711 4858 dbSNP
rs761312840 4859 dbSNP
rs1253725891 4870 dbSNP
rs77009694 4874 dbSNP
rs1195876912 4876 dbSNP
rs1252506394 4877 dbSNP
rs551746551 4881 dbSNP
rs1380690319 4882 dbSNP
rs1158190687 4890 dbSNP
rs1175838353 4896 dbSNP
rs7784684 4896 dbSNP
rs528807142 4897 dbSNP
rs1258592875 4899 dbSNP
rs1298845841 4903 dbSNP
rs1399214980 4905 dbSNP
rs949513632 4907 dbSNP
rs917968981 4908 dbSNP
rs1372251433 4909 dbSNP
rs1236032058 4913 dbSNP
rs1298653052 4915 dbSNP
rs190571748 4916 dbSNP
rs1227459030 4918 dbSNP
rs540238416 4918 dbSNP
rs574322682 4919 dbSNP
rs980361018 4924 dbSNP
rs113622098 4928 dbSNP
rs1456369839 4934 dbSNP
rs1253392874 4936 dbSNP
rs1354962522 4937 dbSNP
rs1189267058 4948 dbSNP
rs1432857594 4948 dbSNP
rs569322607 4948 dbSNP
rs917227969 4948 dbSNP
rs561040961 4950 dbSNP
rs1464505078 4951 dbSNP
rs989236126 4951 dbSNP
rs1237407174 4956 dbSNP
rs1323853970 4957 dbSNP
rs1443489264 4967 dbSNP
rs543929541 4968 dbSNP
rs1292167726 4971 dbSNP
rs1366419409 4973 dbSNP
rs909492464 4974 dbSNP
rs956130212 4976 dbSNP
rs985021347 4981 dbSNP
rs953585126 4994 dbSNP
rs575400125 5001 dbSNP
rs187460410 5007 dbSNP
rs1217490010 5008 dbSNP
rs1273674759 5009 dbSNP
rs996489980 5009 dbSNP
rs1219066319 5013 dbSNP
rs979279609 5015 dbSNP
rs1488264047 5017 dbSNP
rs1310470930 5019 dbSNP
rs756833450 5020 dbSNP
rs774131180 5020 dbSNP
rs967910568 5020 dbSNP
rs2109340 5030 dbSNP
rs1419148577 5033 dbSNP
rs573206069 5047 dbSNP
rs1019360855 5055 dbSNP
rs1231811253 5057 dbSNP
rs1163081502 5058 dbSNP
rs183738199 5060 dbSNP
rs901776654 5061 dbSNP
rs1018591075 5067 dbSNP
rs1009390502 5068 dbSNP
rs1165958797 5074 dbSNP
rs1474972702 5077 dbSNP
rs111874274 5079 dbSNP
rs1032245553 5084 dbSNP
rs780454822 5085 dbSNP
rs1488649086 5089 dbSNP
rs905081336 5098 dbSNP
rs1045480654 5101 dbSNP
rs1261698218 5104 dbSNP
rs994963093 5118 dbSNP
rs949410764 5119 dbSNP
rs567503831 5122 dbSNP
rs1474046513 5123 dbSNP
rs1489689248 5123 dbSNP
rs1266351955 5124 dbSNP
rs1233539634 5125 dbSNP
rs1413710076 5126 dbSNP
rs1419991250 5127 dbSNP
rs1160847979 5128 dbSNP
rs1358192869 5138 dbSNP
rs1333787329 5139 dbSNP
rs1291044233 5143 dbSNP
rs1219991362 5147 dbSNP
rs1418758738 5147 dbSNP
rs557438290 5148 dbSNP
rs537190181 5157 dbSNP
rs1036433510 5158 dbSNP
rs1294812210 5162 dbSNP
rs1376803981 5171 dbSNP
rs756334097 5177 dbSNP
rs1283455845 5184 dbSNP
rs1373982372 5187 dbSNP
rs1225208943 5190 dbSNP
rs750254080 5195 dbSNP
rs1351744281 5196 dbSNP
rs1216224429 5197 dbSNP
rs867213691 5200 dbSNP
rs1380411334 5204 dbSNP
rs879520609 5209 dbSNP
rs1208129629 5217 dbSNP
rs1237364768 5221 dbSNP
rs1044556068 5237 dbSNP
rs571404403 5241 dbSNP
rs4723932 5242 dbSNP
rs932231641 5245 dbSNP
rs917511559 5246 dbSNP
rs528628220 5262 dbSNP
rs1460722253 5264 dbSNP
rs757262024 5265 dbSNP
rs1332953836 5267 dbSNP
rs934690821 5269 dbSNP
rs926054224 5270 dbSNP
rs975526266 5271 dbSNP
rs1314053864 5272 dbSNP
rs1329018006 5283 dbSNP
rs1173063161 5286 dbSNP
rs1304369243 5297 dbSNP
rs965068057 5299 dbSNP
rs1347428121 5305 dbSNP
rs751433528 5310 dbSNP
rs1217510915 5312 dbSNP
rs764047263 5332 dbSNP
rs185783207 5336 dbSNP
rs1278057601 5339 dbSNP
rs180799936 5340 dbSNP
rs529700556 5341 dbSNP
rs1438880911 5344 dbSNP
rs1201142122 5347 dbSNP
rs987834303 5349 dbSNP
rs1236722207 5355 dbSNP
rs1194664819 5361 dbSNP
rs1248043346 5367 dbSNP
rs1391266965 5373 dbSNP
rs190285596 5378 dbSNP
rs1171450157 5379 dbSNP
rs1419671996 5392 dbSNP
rs1435365573 5411 dbSNP
rs1032150771 5416 dbSNP
rs1268664121 5419 dbSNP
rs1168367926 5426 dbSNP
rs1399474753 5437 dbSNP
rs1213524053 5439 dbSNP
rs1467399758 5442 dbSNP
rs1325316945 5470 dbSNP
rs1333022305 5480 dbSNP
rs762404631 5483 dbSNP
rs1274324525 5487 dbSNP
rs185372343 5489 dbSNP
rs1023543460 5490 dbSNP
rs1200098879 5492 dbSNP
rs1256650014 5493 dbSNP
rs1317860502 5494 dbSNP
rs1014032905 5500 dbSNP
rs1339505778 5501 dbSNP
rs896467468 5506 dbSNP
rs1292515554 5511 dbSNP
rs1036338533 5516 dbSNP
rs181596325 5517 dbSNP
rs188837047 5520 dbSNP
rs1049259650 5521 dbSNP
rs545242916 5523 dbSNP
rs932168800 5525 dbSNP
rs922213246 5526 dbSNP
rs764883373 5530 dbSNP
rs943728201 5534 dbSNP
rs573049517 5540 dbSNP
rs994517417 5546 dbSNP
rs1323060580 5549 dbSNP
rs1341373288 5557 dbSNP
rs1401866279 5559 dbSNP
rs1276417558 5567 dbSNP
rs905638285 5573 dbSNP
rs1246229528 5577 dbSNP
rs553237305 5582 dbSNP
rs1014403373 5584 dbSNP
rs896059525 5585 dbSNP
rs1284460480 5586 dbSNP
rs1489085895 5587 dbSNP
rs1213788507 5594 dbSNP
rs1395881226 5601 dbSNP
rs1053817173 5603 dbSNP
rs934929147 5612 dbSNP
rs1189622534 5627 dbSNP
rs1472307665 5635 dbSNP
rs542519216 5635 dbSNP
rs1043095212 5643 dbSNP
rs1158951105 5643 dbSNP
rs1421792608 5643 dbSNP
rs956465205 5644 dbSNP
rs1360043452 5649 dbSNP
rs932701010 5654 dbSNP
rs767164078 5657 dbSNP
rs1315362897 5666 dbSNP
rs185709776 5667 dbSNP
rs974562080 5683 dbSNP
rs1310497220 5688 dbSNP
rs979708288 5689 dbSNP
rs557124712 5691 dbSNP
rs867999492 5694 dbSNP
rs1237579920 5696 dbSNP
rs1183549892 5697 dbSNP
rs969235373 5701 dbSNP
rs1485672471 5703 dbSNP
rs181955902 5707 dbSNP
rs528067895 5720 dbSNP
rs960876890 5721 dbSNP
rs1381997078 5723 dbSNP
rs1346483814 5731 dbSNP
rs557802324 5732 dbSNP
rs750004806 5733 dbSNP
rs149965112 5738 dbSNP
rs1311108047 5739 dbSNP
rs1443212387 5740 dbSNP
rs994484480 5742 dbSNP
rs772392888 5748 dbSNP
rs190601458 5755 dbSNP
rs887899340 5756 dbSNP
rs549544200 5763 dbSNP
rs1234735622 5768 dbSNP
rs996778957 5772 dbSNP
rs529604466 5774 dbSNP
rs1376102713 5775 dbSNP
rs367790028 5781 dbSNP
rs1014420550 5793 dbSNP
rs570305174 5808 dbSNP
rs1433337179 5810 dbSNP
rs1177787100 5814 dbSNP
rs1031844778 5818 dbSNP
rs1237755879 5835 dbSNP
rs1382555373 5837 dbSNP
rs373684174 5839 dbSNP
rs944991889 5846 dbSNP
rs1465973071 5847 dbSNP
rs1171923330 5851 dbSNP
rs913453379 5852 dbSNP
rs1444959378 5857 dbSNP
rs1331140240 5860 dbSNP
rs530481220 5861 dbSNP
rs763999380 5873 dbSNP
rs1232005207 5876 dbSNP
rs774742238 5877 dbSNP
rs1330072841 5878 dbSNP
rs934989252 5884 dbSNP
rs925061274 5886 dbSNP
rs1163098252 5898 dbSNP
rs769165974 5900 dbSNP
rs749328059 5909 dbSNP
rs1043061793 5914 dbSNP
rs564998192 5915 dbSNP
rs184537033 5917 dbSNP
rs916428334 5922 dbSNP
rs1193208511 5930 dbSNP
rs1368896148 5932 dbSNP
rs899911958 5935 dbSNP
rs1041190830 5952 dbSNP
rs1224177980 5957 dbSNP
rs191345573 5963 dbSNP
rs1464561061 5967 dbSNP
rs1170386482 5984 dbSNP
rs1278032969 5986 dbSNP
rs1350893139 5991 dbSNP
rs756459060 5999 dbSNP
rs1014845234 6007 dbSNP
rs1247198441 6008 dbSNP
rs929196328 6012 dbSNP
rs1004922599 6021 dbSNP
rs952014871 6026 dbSNP
rs1400028580 6029 dbSNP
rs370788713 6033 dbSNP
rs559325909 6055 dbSNP
rs542805488 6058 dbSNP
rs573880747 6059 dbSNP
rs775155392 6063 dbSNP
rs1363075810 6066 dbSNP
rs1319534860 6067 dbSNP
rs1323218065 6072 dbSNP
rs1400536599 6073 dbSNP
rs1406192120 6074 dbSNP
rs1490255625 6075 dbSNP
rs1217398470 6077 dbSNP
rs900556028 6078 dbSNP
rs187305515 6079 dbSNP
rs377576011 6080 dbSNP
rs959827791 6086 dbSNP
rs1163148736 6087 dbSNP
rs1348906584 6087 dbSNP
rs1467672812 6087 dbSNP
rs1186685844 6088 dbSNP
rs1299482622 6095 dbSNP
rs545734967 6103 dbSNP
rs6945205 6104 dbSNP
rs1303297502 6106 dbSNP
rs999058393 6107 dbSNP
rs1446235582 6108 dbSNP
rs184027002 6127 dbSNP
rs192241470 6128 dbSNP
rs1288250429 6134 dbSNP
rs1487312497 6136 dbSNP
rs996849461 6141 dbSNP
rs1238507617 6145 dbSNP
rs1335809287 6152 dbSNP
rs552852421 6159 dbSNP
rs1231587926 6160 dbSNP
rs1439914347 6165 dbSNP
rs1342422053 6172 dbSNP
rs1378109735 6176 dbSNP
rs1399560431 6187 dbSNP
rs899796229 6191 dbSNP
rs373501459 6192 dbSNP
rs1271320283 6197 dbSNP
rs1041075166 6201 dbSNP
rs1343819160 6203 dbSNP
rs1311667772 6213 dbSNP
rs1448727600 6213 dbSNP
rs1351812382 6214 dbSNP
rs1325867334 6221 dbSNP
rs1208723201 6222 dbSNP
rs572497675 6223 dbSNP
rs887222758 6224 dbSNP
rs1180921516 6226 dbSNP
rs1235931899 6227 dbSNP
rs1469342161 6229 dbSNP
rs1172636104 6230 dbSNP
rs1394837352 6232 dbSNP
rs1426735062 6232 dbSNP
rs1163722220 6234 dbSNP
rs370882472 6239 dbSNP
rs1048007562 6240 dbSNP
rs1187050361 6242 dbSNP
rs1329086224 6243 dbSNP
rs200030190 6244 dbSNP
rs1240277790 6245 dbSNP
rs1441827210 6245 dbSNP
rs1195328387 6246 dbSNP
rs1275508092 6246 dbSNP
rs1369731609 6247 dbSNP
rs1040555271 6248 dbSNP
rs929187646 6248 dbSNP
rs557934534 6249 dbSNP
rs920508105 6249 dbSNP
rs1200872690 6253 dbSNP
rs1256609819 6254 dbSNP
rs1266339652 6254 dbSNP
rs948645114 6254 dbSNP
rs973252830 6254 dbSNP
rs1198096140 6256 dbSNP
rs1424202095 6257 dbSNP
rs1467159092 6258 dbSNP
rs188185854 6260 dbSNP
rs892087069 6261 dbSNP
rs1405742586 6266 dbSNP
rs1324380022 6270 dbSNP
rs1053286254 6271 dbSNP
rs1351855058 6272 dbSNP
rs960042565 6281 dbSNP
rs935020425 6283 dbSNP
rs1341652834 6296 dbSNP
rs1221067451 6299 dbSNP
rs1031450600 6300 dbSNP
rs1339070162 6301 dbSNP
rs1273734473 6305 dbSNP
rs1291522158 6310 dbSNP
rs1449548276 6323 dbSNP
rs924967960 6331 dbSNP
rs1214504241 6333 dbSNP
rs968915401 6334 dbSNP
rs536029023 6338 dbSNP
rs1360572374 6339 dbSNP
rs1267266 6340 dbSNP
rs570267016 6341 dbSNP
rs916274587 6342 dbSNP
rs1164810300 6343 dbSNP
rs1442150955 6346 dbSNP
rs866124616 6352 dbSNP
rs1361330098 6353 dbSNP
rs1401932789 6364 dbSNP
rs1267265 6369 dbSNP
rs1326384613 6370 dbSNP
rs1370665440 6373 dbSNP
rs112816186 6380 dbSNP
rs1267264 6381 dbSNP
rs879071694 6381 dbSNP
rs964303320 6383 dbSNP
rs184088355 6386 dbSNP
rs1488950429 6388 dbSNP
rs537049436 6400 dbSNP
rs1213852748 6404 dbSNP
rs1008256769 6406 dbSNP
rs1260905955 6406 dbSNP
rs192088864 6410 dbSNP
rs551389715 6411 dbSNP
rs1443010313 6413 dbSNP
rs975115848 6417 dbSNP
rs746112386 6419 dbSNP
rs1381168512 6422 dbSNP
rs964827436 6432 dbSNP
rs1417351784 6442 dbSNP
rs1384832248 6444 dbSNP
rs528222580 6445 dbSNP
rs1397175921 6451 dbSNP
rs1175408333 6459 dbSNP
rs559379213 6463 dbSNP
rs1454575985 6467 dbSNP
rs1252096578 6468 dbSNP
rs1019445508 6479 dbSNP
rs1009048742 6480 dbSNP
rs1236209076 6481 dbSNP
rs891945493 6486 dbSNP
rs1345608821 6489 dbSNP
rs542021611 6494 dbSNP
rs1031776635 6502 dbSNP
rs1000417273 6505 dbSNP
rs189031541 6513 dbSNP
rs182284644 6518 dbSNP
rs563244873 6523 dbSNP
rs1283124702 6524 dbSNP
rs543273052 6532 dbSNP
rs1235595491 6535 dbSNP
rs1363357998 6537 dbSNP
rs947706808 6538 dbSNP
rs894927548 6552 dbSNP
rs1174766244 6554 dbSNP
rs1056606064 6555 dbSNP
rs1469574987 6559 dbSNP
rs939192425 6566 dbSNP
rs781185068 6568 dbSNP
rs1389374037 6570 dbSNP
rs924355399 6572 dbSNP
rs1331115996 6576 dbSNP
rs1375144964 6577 dbSNP
rs907730821 6591 dbSNP
rs757027788 6594 dbSNP
rs1440884465 6601 dbSNP
rs977160286 6621 dbSNP
rs983257113 6622 dbSNP
rs930555857 6623 dbSNP
rs975597928 6626 dbSNP
rs920468474 6639 dbSNP
rs4723931 6642 dbSNP
rs965065777 6645 dbSNP
rs147782393 6651 dbSNP
rs189645970 6660 dbSNP
rs1201134047 6680 dbSNP
rs987534052 6686 dbSNP
rs956094898 6695 dbSNP
rs1031807768 6698 dbSNP
rs1460788618 6712 dbSNP
rs1171601184 6714 dbSNP
rs1297192007 6718 dbSNP
rs1000278845 6719 dbSNP
rs1387971119 6722 dbSNP
rs572479589 6727 dbSNP
rs904810024 6728 dbSNP
rs758298855 6737 dbSNP
rs547513119 6738 dbSNP
rs1176793070 6748 dbSNP
rs1023629648 6749 dbSNP
rs762801075 6749 dbSNP
rs1219236485 6750 dbSNP
rs1279856074 6757 dbSNP
rs1479711152 6765 dbSNP
rs1203584519 6771 dbSNP
rs555794081 6783 dbSNP
rs898602304 6787 dbSNP
rs1259634067 6788 dbSNP
rs1266932436 6788 dbSNP
rs1011942089 6801 dbSNP
rs1426431377 6802 dbSNP
rs894787583 6806 dbSNP
rs1037481984 6811 dbSNP
rs1170232937 6813 dbSNP
rs1012735015 6814 dbSNP
rs1056120707 6819 dbSNP
rs939099173 6821 dbSNP
rs879744444 6829 dbSNP
rs886158239 6838 dbSNP
rs1047598599 6842 dbSNP
rs1364488694 6843 dbSNP
rs1241681895 6845 dbSNP
rs1299905667 6850 dbSNP
rs1359817001 6855 dbSNP
rs1213739843 6858 dbSNP
rs930461027 6861 dbSNP
rs535690250 6862 dbSNP
rs1322536888 6864 dbSNP
rs185567821 6865 dbSNP
rs1289866845 6867 dbSNP
rs866798872 6882 dbSNP
rs1222805646 6885 dbSNP
rs1358743597 6888 dbSNP
rs1348103324 6890 dbSNP
rs764723460 6893 dbSNP
rs1314111266 6894 dbSNP
rs1244298561 6898 dbSNP
rs1485203926 6907 dbSNP
rs1186275646 6920 dbSNP
rs1257373290 6923 dbSNP
rs943276236 6932 dbSNP
rs1446077649 6934 dbSNP
rs1161214522 6935 dbSNP
rs556908212 6938 dbSNP
rs1041417855 6940 dbSNP
rs911893487 6943 dbSNP
rs947096899 6945 dbSNP
rs1370433383 6954 dbSNP
rs374000141 6958 dbSNP
rs1430000178 6960 dbSNP
rs181043493 6972 dbSNP
rs1303203020 6982 dbSNP
rs1300988283 6999 dbSNP
rs1380981126 7008 dbSNP
rs987398556 7019 dbSNP
rs1455191530 7023 dbSNP
rs571159832 7024 dbSNP
rs555885902 7033 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::|:||| |   :|||||| 
Target 5' auGGCGCCACU---GCACUCCa 3'
6 - 24
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000306984.6 | 3UTR | UUAAGAUGGCGCCACUGCACUCCAGCCUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence