miRTarBase - #MIRT666696 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RBM23   
Synonyms CAPERbeta, PP239, RNPC4
Description RNA binding motif protein 23
Transcript NM_001077351   
Other Transcripts NM_001077352 , NM_018107   
Expression
Putative miRNA Targets on RBM23
3'UTR of RBM23
(miRNA target sites are highlighted)
>RBM23|NM_001077351|3'UTR
   1 ATCAGTGGCACAGTATACTGCCTCCTTGTGCCTCTGGATCCTGCCACTTCACATCTACTCTTCCATGGCCCCATTTCTCC
  81 ATTTTGTGGACCAAGCCATCCTGAGGGCATGGACATTGTCTCTGAGGAAATTGGGGCCACCCTTAAGATACCAAGAAAAG
 161 CTCCTGCCCATGGTCCCACTGGAAATGGACTCTGCTGAGCAAAGCCACCAGTTGAAGAGAACAGAATCCACACCTGCATT
 241 GAATACCTGTTTCTCCATGTGTATCGTCTCTGAGATTACCTTCTTGCCCTTTCCAACACCTTAGTGATTCCTCAATTTCT
 321 CCCCCATTGGGAAGGCCATAGGGCATACTGAAGGAACTGACCTCTCTCCTTTTCCTGTACCTTTAACCTTTAGTCTGTCA
 401 AGGAAAACCCTTAGGACCTCTGAATCAAGAGGACTGAGTTTGTGGGTGAACCTTGAAGGTGCTCTTTCTGCTACAAGGGC
 481 CCTGGGAGATAGCATGGACGTGCATTGAGAAGCCAGCCTCAGACCTTAGCTTGAAGCAGCTTGAGGCCAGACCTACTGTA
 561 GCCTCAGCATCTTGCTAGGAGGCATGGAAGTGATCTATCCTGCCAGGAGGCCTCAGAGTGATCTGTCCTGCCAGGAGGTG
 641 TGAGAGTGATCTGTCCTGTGAGGCATTTAGGGGCTTTCAGGAATTTAGTAAAAGGTGGAGTATGCCTTTCCAGTATCTTC
 721 CATCTTCCTTTGTATACTTGTCCTTCCTCCCATTTCCTCCCTTTGGCCCGAGGTAGGAGGATGGAGGGAGGCTGCTACTC
 801 TACCACTTCCTGTGTGCCTCTACTGTGGCCTCAACCCTGGCAATTATAGCTACTCCCATCCCTTACCTGGGCATGTGTGA
 881 GCCCTTCTCACTGGATTTTATACCCTTGTGTCTGTGTACATAAATATATATACATATATATATACATAAAAACTTTGTAC
 961 AAAAGGCAAGCCTCCTCCTTGTGGCAGCTGTTGCCCATTTGTGTGTGGTCTTTGTTGTGTGTCTGACAACTTCTCATTAG
1041 CCCAACTTATGATGTTTCTAGGGATATAAAACATTAGTAACATCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUG----UGGUAACAGUG-UGAGGu 5'
            |||    :| ||| | :| ||||| 
Target 5' tcAACCCTGGCAATTATAGCTACTCCc 3'
831 - 857 110.00 -6.90
2
miRNA  3' guUUGUGGUA-ACAGUGUGAggu 5'
            || :||||  | ||:|||   
Target 5' ggAAGGCCATAGGGCATACTgaa 3'
330 - 352 108.00 -12.20
3
miRNA  3' guuuguGGUAACAGUGUGAGgu 5'
                || |||| |:|||:  
Target 5' catcttCCTTTGT-ATACTTgt 3'
721 - 741 107.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31613029 1 COSMIC
COSN30490621 7 COSMIC
COSN31545146 13 COSMIC
COSN31610811 29 COSMIC
COSN30506762 32 COSMIC
COSN30463538 72 COSMIC
COSN28842169 94 COSMIC
COSN30482702 97 COSMIC
COSN31587239 134 COSMIC
COSN16229765 147 COSMIC
COSN30145350 155 COSMIC
COSN30101443 156 COSMIC
COSN27323272 289 COSMIC
COSN20111095 346 COSMIC
COSN6243009 846 COSMIC
COSN24733923 875 COSMIC
COSN29200867 1273 COSMIC
COSN1640327 1274 COSMIC
COSN32144793 1302 COSMIC
COSN6411395 1390 COSMIC
COSN25930668 2103 COSMIC
COSN6243008 2174 COSMIC
COSN22332561 2536 COSMIC
COSN9611063 2545 COSMIC
COSN26840066 2646 COSMIC
COSN30070285 3604 COSMIC
COSN21663222 4164 COSMIC
COSN23835352 4293 COSMIC
COSN5381489 4897 COSMIC
COSN20660437 5934 COSMIC
COSN21302136 5956 COSMIC
COSN22049303 6016 COSMIC
COSN1165861 6410 COSMIC
COSN17480374 6818 COSMIC
COSN8824612 6861 COSMIC
COSN8824611 7078 COSMIC
COSN8140567 7210 COSMIC
COSN17051139 7320 COSMIC
COSN8824610 7452 COSMIC
COSN7431741 7604 COSMIC
COSN5170784 7643 COSMIC
COSN15762234 7870 COSMIC
COSN29421895 8156 COSMIC
COSN26094446 8231 COSMIC
COSN8824609 8262 COSMIC
COSN16257908 8269 COSMIC
COSN22770224 8308 COSMIC
rs1570342 2754 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1233971243 7 dbSNP
rs372411542 8 dbSNP
rs769102052 9 dbSNP
rs747563537 12 dbSNP
rs74039804 14 dbSNP
rs746246907 15 dbSNP
rs1281953602 22 dbSNP
rs1225266530 23 dbSNP
rs1373920916 26 dbSNP
rs778365040 28 dbSNP
rs558471123 29 dbSNP
rs1449811125 30 dbSNP
rs537255537 31 dbSNP
rs756965431 33 dbSNP
rs1336978394 35 dbSNP
rs375587131 40 dbSNP
rs777395506 42 dbSNP
rs371000570 46 dbSNP
rs1402838356 47 dbSNP
rs1196309674 57 dbSNP
rs1273744951 60 dbSNP
rs1218749741 64 dbSNP
rs1457854370 69 dbSNP
rs912074547 70 dbSNP
rs897929873 71 dbSNP
rs546277993 72 dbSNP
rs988020343 83 dbSNP
rs2295679 89 dbSNP
rs1405918339 94 dbSNP
rs1026946858 103 dbSNP
rs562680462 106 dbSNP
rs963344735 108 dbSNP
rs1033748402 111 dbSNP
rs889355922 116 dbSNP
rs1050672948 134 dbSNP
rs34839939 140 dbSNP
rs932315622 141 dbSNP
rs1445050031 151 dbSNP
rs1397059967 160 dbSNP
rs1002231525 163 dbSNP
rs544169125 168 dbSNP
rs1355661297 171 dbSNP
rs1170455096 182 dbSNP
rs906586764 192 dbSNP
rs976458055 199 dbSNP
rs945096068 202 dbSNP
rs766310740 220 dbSNP
rs113340033 224 dbSNP
rs867170251 227 dbSNP
rs113859084 229 dbSNP
rs1277232806 239 dbSNP
rs1178235984 245 dbSNP
rs575150364 248 dbSNP
rs891746138 249 dbSNP
rs1253676543 252 dbSNP
rs1053023516 257 dbSNP
rs1200915135 258 dbSNP
rs544373986 265 dbSNP
rs541685775 266 dbSNP
rs904178789 268 dbSNP
rs1430452760 272 dbSNP
rs1174056765 275 dbSNP
rs1175291670 276 dbSNP
rs957895364 284 dbSNP
rs1358595339 287 dbSNP
rs1467028091 296 dbSNP
rs926507377 299 dbSNP
rs147674989 300 dbSNP
rs980710987 303 dbSNP
rs1359161616 305 dbSNP
rs943148797 311 dbSNP
rs529521671 320 dbSNP
rs970681392 326 dbSNP
rs911590581 328 dbSNP
rs987663453 329 dbSNP
rs1233388313 334 dbSNP
rs545327413 339 dbSNP
rs1025370673 345 dbSNP
rs993512363 346 dbSNP
rs1311062161 347 dbSNP
rs5807193 347 dbSNP
rs201467469 348 dbSNP
rs33941566 348 dbSNP
rs869078891 348 dbSNP
rs1233306903 351 dbSNP
rs962407204 354 dbSNP
rs1282452444 355 dbSNP
rs1016338529 361 dbSNP
rs1487262116 363 dbSNP
rs1006344752 373 dbSNP
rs919547771 378 dbSNP
rs1321571151 380 dbSNP
rs973606574 382 dbSNP
rs573072293 386 dbSNP
rs1486983359 387 dbSNP
rs773637254 389 dbSNP
rs553246663 393 dbSNP
rs796429061 408 dbSNP
rs1473087135 410 dbSNP
rs1328881473 415 dbSNP
rs1379072533 417 dbSNP
rs577104837 421 dbSNP
rs1432499303 436 dbSNP
rs534020379 436 dbSNP
rs902111039 441 dbSNP
rs1025473804 443 dbSNP
rs1041076247 445 dbSNP
rs1014129160 449 dbSNP
rs79342486 451 dbSNP
rs945095651 455 dbSNP
rs762317232 462 dbSNP
rs1304987529 466 dbSNP
rs1302835007 467 dbSNP
rs1451274948 473 dbSNP
rs1351434754 475 dbSNP
rs1239272533 478 dbSNP
rs1284726820 485 dbSNP
rs1053556609 495 dbSNP
rs891606612 497 dbSNP
rs936475732 499 dbSNP
rs1195584161 500 dbSNP
rs574905542 500 dbSNP
rs904415444 505 dbSNP
rs1362897429 511 dbSNP
rs1038719552 513 dbSNP
rs181624731 516 dbSNP
rs1404004470 517 dbSNP
rs1408605530 518 dbSNP
rs942993700 523 dbSNP
rs1349015246 527 dbSNP
rs1461580538 529 dbSNP
rs1327355219 531 dbSNP
rs1373958303 535 dbSNP
rs1184761719 536 dbSNP
rs538198460 555 dbSNP
rs1280112163 558 dbSNP
rs1375422069 563 dbSNP
rs1226462575 565 dbSNP
rs1288798407 566 dbSNP
rs568913175 574 dbSNP
rs764347537 574 dbSNP
rs769241435 578 dbSNP
rs552448043 579 dbSNP
rs1457402842 582 dbSNP
rs1464560893 584 dbSNP
rs1179315929 588 dbSNP
rs919412498 593 dbSNP
rs1259200123 596 dbSNP
rs116149462 597 dbSNP
rs1475347421 607 dbSNP
rs1317968401 608 dbSNP
rs972468385 610 dbSNP
rs1397643065 611 dbSNP
rs926843552 612 dbSNP
rs1356210924 614 dbSNP
rs1445654443 616 dbSNP
rs1283406921 617 dbSNP
rs200402717 624 dbSNP
rs190763587 625 dbSNP
rs918033362 629 dbSNP
rs1317509924 631 dbSNP
rs1006291152 637 dbSNP
rs1275128910 638 dbSNP
rs1197658366 639 dbSNP
rs988620240 657 dbSNP
rs1258787834 658 dbSNP
rs1452730013 659 dbSNP
rs1486883738 661 dbSNP
rs763129449 662 dbSNP
rs1477252889 664 dbSNP
rs1286813085 668 dbSNP
rs953477342 675 dbSNP
rs1345609193 681 dbSNP
rs1412721611 686 dbSNP
rs1333474472 690 dbSNP
rs1162827298 694 dbSNP
rs1375970232 694 dbSNP
rs1029094029 715 dbSNP
rs1340129298 721 dbSNP
rs115183943 724 dbSNP
rs1272029214 726 dbSNP
rs1218693670 728 dbSNP
rs968628387 729 dbSNP
rs11557896 730 dbSNP
rs1457561467 734 dbSNP
rs7469 742 dbSNP
rs145645490 747 dbSNP
rs1193405758 749 dbSNP
rs1009628054 752 dbSNP
rs890098835 752 dbSNP
rs1259910097 756 dbSNP
rs1395690779 764 dbSNP
rs1207159850 769 dbSNP
rs11882 770 dbSNP
rs1156631095 772 dbSNP
rs375780447 776 dbSNP
rs1220765067 782 dbSNP
rs1382540535 786 dbSNP
rs1320586081 790 dbSNP
rs748006449 798 dbSNP
rs115012406 799 dbSNP
rs926918674 800 dbSNP
rs1293152639 804 dbSNP
rs1045264913 805 dbSNP
rs1351902843 809 dbSNP
rs1246051869 822 dbSNP
rs185415130 830 dbSNP
rs1285982647 832 dbSNP
rs1449513515 835 dbSNP
rs559566857 835 dbSNP
rs542772750 836 dbSNP
rs1455552656 839 dbSNP
rs917925866 841 dbSNP
rs972031826 843 dbSNP
rs1454169552 847 dbSNP
rs1160078240 852 dbSNP
rs1388851970 853 dbSNP
rs1362250864 863 dbSNP
rs545825478 864 dbSNP
rs1801542 865 dbSNP
rs1404924652 866 dbSNP
rs1326689840 868 dbSNP
rs940684397 869 dbSNP
rs45612736 871 dbSNP
rs1444618078 873 dbSNP
rs1309237533 885 dbSNP
rs984774486 891 dbSNP
rs953424365 892 dbSNP
rs1367357319 910 dbSNP
rs1164208745 914 dbSNP
rs1353839391 915 dbSNP
rs1212631034 919 dbSNP
rs1461519510 922 dbSNP
rs1273305667 927 dbSNP
rs1469454633 928 dbSNP
rs1371461696 930 dbSNP
rs1028623089 931 dbSNP
rs995517349 933 dbSNP
rs1183738015 935 dbSNP
rs1475020976 937 dbSNP
rs976653578 937 dbSNP
rs1165973100 940 dbSNP
rs78122789 943 dbSNP
rs1043207 945 dbSNP
rs143639826 945 dbSNP
rs1464189396 945 dbSNP
rs58000925 945 dbSNP
rs1197636732 946 dbSNP
rs112725825 949 dbSNP
rs1311062561 949 dbSNP
rs1480930355 949 dbSNP
rs1491475535 949 dbSNP
rs199976888 949 dbSNP
rs763793744 949 dbSNP
rs1490958971 950 dbSNP
rs978624066 950 dbSNP
rs1485251240 951 dbSNP
rs1188375794 953 dbSNP
rs968535519 956 dbSNP
rs1476926577 957 dbSNP
rs1017544191 959 dbSNP
rs1270223102 969 dbSNP
rs76257182 973 dbSNP
rs558560922 974 dbSNP
rs954620955 975 dbSNP
rs538921197 976 dbSNP
rs1030429633 979 dbSNP
rs191847164 980 dbSNP
rs993144554 981 dbSNP
rs1397764134 983 dbSNP
rs1031969698 994 dbSNP
rs897614627 997 dbSNP
rs1307612022 1008 dbSNP
rs766338376 1008 dbSNP
rs904938253 1009 dbSNP
rs1307648869 1013 dbSNP
rs187007866 1019 dbSNP
rs1402870091 1022 dbSNP
rs543510601 1024 dbSNP
rs1487445109 1026 dbSNP
rs896350043 1033 dbSNP
rs1045208324 1034 dbSNP
rs949688803 1038 dbSNP
rs1390705225 1048 dbSNP
rs1394292617 1049 dbSNP
rs567768120 1050 dbSNP
rs1395011569 1051 dbSNP
rs1462577220 1055 dbSNP
rs940588574 1066 dbSNP
rs141523057 1071 dbSNP
rs984722111 1075 dbSNP
rs769574732 1077 dbSNP
rs932023164 1084 dbSNP
rs1383481406 1085 dbSNP
rs925396029 1090 dbSNP
rs921992377 1094 dbSNP
rs979491799 1095 dbSNP
rs976220894 1096 dbSNP
rs1282242864 1097 dbSNP
rs113185573 1103 dbSNP
rs966538367 1108 dbSNP
rs1261599028 1109 dbSNP
rs530561669 1111 dbSNP
rs1436538557 1112 dbSNP
rs1253291206 1115 dbSNP
rs1197022711 1121 dbSNP
rs116036424 1128 dbSNP
rs988979993 1129 dbSNP
rs78380799 1130 dbSNP
rs1030240295 1131 dbSNP
rs1160285728 1132 dbSNP
rs1161432722 1133 dbSNP
rs183803380 1140 dbSNP
rs1323338672 1145 dbSNP
rs1283645448 1146 dbSNP
rs1000533860 1148 dbSNP
rs1333853680 1149 dbSNP
rs1330881284 1154 dbSNP
rs559645896 1158 dbSNP
rs1392031282 1161 dbSNP
rs1440970283 1164 dbSNP
rs1405484764 1168 dbSNP
rs542560746 1169 dbSNP
rs1023794802 1170 dbSNP
rs1318976370 1174 dbSNP
rs529080761 1178 dbSNP
rs750509754 1180 dbSNP
rs1469002361 1182 dbSNP
rs1215620398 1191 dbSNP
rs1430282343 1192 dbSNP
rs563376880 1197 dbSNP
rs896244258 1199 dbSNP
rs746832348 1200 dbSNP
rs1420539017 1203 dbSNP
rs1162403528 1204 dbSNP
rs1393254899 1209 dbSNP
rs1461565612 1211 dbSNP
rs1036159156 1214 dbSNP
rs1352697764 1215 dbSNP
rs1468935746 1216 dbSNP
rs1366056650 1217 dbSNP
rs1004680754 1220 dbSNP
rs1183218134 1223 dbSNP
rs544675045 1225 dbSNP
rs1375306850 1232 dbSNP
rs1440958256 1236 dbSNP
rs896767665 1240 dbSNP
rs1052701127 1244 dbSNP
rs1292968911 1249 dbSNP
rs1201268044 1251 dbSNP
rs935344303 1256 dbSNP
rs1335720650 1257 dbSNP
rs903843831 1258 dbSNP
rs1462328685 1264 dbSNP
rs1437784799 1271 dbSNP
rs1205791941 1283 dbSNP
rs1235074152 1294 dbSNP
rs575359981 1296 dbSNP
rs1043718944 1298 dbSNP
rs866007208 1303 dbSNP
rs921925033 1304 dbSNP
rs1204322136 1307 dbSNP
rs1348357829 1308 dbSNP
rs1166492505 1310 dbSNP
rs911270945 1314 dbSNP
rs1408828929 1316 dbSNP
rs1171113983 1320 dbSNP
rs1356194221 1323 dbSNP
rs1281178103 1329 dbSNP
rs1412776656 1334 dbSNP
rs1240844177 1337 dbSNP
rs1356354687 1346 dbSNP
rs1381969423 1351 dbSNP
rs1312962250 1358 dbSNP
rs1338872107 1360 dbSNP
rs1454653395 1363 dbSNP
rs1407033758 1371 dbSNP
rs1248164805 1372 dbSNP
rs1275795254 1373 dbSNP
rs1346342894 1375 dbSNP
rs1224224075 1376 dbSNP
rs1317985124 1377 dbSNP
rs1399291857 1378 dbSNP
rs1452600973 1380 dbSNP
rs1189235282 1381 dbSNP
rs1387657328 1385 dbSNP
rs1159534046 1386 dbSNP
rs1421575610 1386 dbSNP
rs200927613 1390 dbSNP
rs1220927111 1391 dbSNP
rs933165107 1391 dbSNP
rs1326064251 1392 dbSNP
rs200174811 1392 dbSNP
rs1234147804 1393 dbSNP
rs1383934055 1393 dbSNP
rs1242629 1394 dbSNP
rs971941481 1395 dbSNP
rs371488733 1396 dbSNP
rs961906101 1396 dbSNP
rs1040794914 1397 dbSNP
rs1192977584 1397 dbSNP
rs944766517 1398 dbSNP
rs1310083025 1401 dbSNP
rs1491483050 1401 dbSNP
rs34197647 1401 dbSNP
rs66860637 1401 dbSNP
rs775107782 1401 dbSNP
rs796471092 1401 dbSNP
rs1491312761 1402 dbSNP
rs1373821746 1403 dbSNP
rs969549279 1422 dbSNP
rs1023378152 1424 dbSNP
rs1349534448 1430 dbSNP
rs1014212739 1434 dbSNP
rs1205314602 1442 dbSNP
rs913313009 1443 dbSNP
rs1237688188 1446 dbSNP
rs1031288294 1449 dbSNP
rs1212509550 1452 dbSNP
rs988968515 1453 dbSNP
rs1434827568 1462 dbSNP
rs777682324 1470 dbSNP
rs1179463288 1474 dbSNP
rs1362982240 1475 dbSNP
rs1470368950 1476 dbSNP
rs904082304 1479 dbSNP
rs1415883912 1480 dbSNP
rs1043749619 1485 dbSNP
rs957567821 1485 dbSNP
rs767895952 1487 dbSNP
rs1328650016 1489 dbSNP
rs926177095 1490 dbSNP
rs1336754367 1491 dbSNP
rs28634738 1492 dbSNP
rs758230527 1501 dbSNP
rs1289848050 1504 dbSNP
rs1332123252 1505 dbSNP
rs547388957 1516 dbSNP
rs1023278217 1520 dbSNP
rs1013673015 1521 dbSNP
rs1249677255 1523 dbSNP
rs1438198675 1526 dbSNP
rs544965523 1527 dbSNP
rs1183998128 1528 dbSNP
rs889907801 1529 dbSNP
rs78880282 1530 dbSNP
rs960454650 1531 dbSNP
rs1165811733 1534 dbSNP
rs192836548 1540 dbSNP
rs1004654489 1541 dbSNP
rs374160858 1552 dbSNP
rs1412066726 1557 dbSNP
rs923141656 1557 dbSNP
rs887641109 1558 dbSNP
rs3811185 1561 dbSNP
rs996084582 1565 dbSNP
rs940612894 1567 dbSNP
rs1293489914 1570 dbSNP
rs1323025986 1570 dbSNP
rs1224542417 1575 dbSNP
rs1328455704 1575 dbSNP
rs1319318265 1577 dbSNP
rs1250697743 1580 dbSNP
rs1339989752 1581 dbSNP
rs567840640 1583 dbSNP
rs557307353 1588 dbSNP
rs148418257 1591 dbSNP
rs1188958517 1592 dbSNP
rs1166095019 1594 dbSNP
rs984458502 1600 dbSNP
rs3811186 1604 dbSNP
rs1374213980 1605 dbSNP
rs551509993 1606 dbSNP
rs913311653 1609 dbSNP
rs75049382 1611 dbSNP
rs936144058 1613 dbSNP
rs926083181 1615 dbSNP
rs1172214206 1619 dbSNP
rs1474197739 1621 dbSNP
rs991911243 1626 dbSNP
rs146217283 1627 dbSNP
rs1303083832 1628 dbSNP
rs1243491980 1629 dbSNP
rs1194040324 1633 dbSNP
rs774803385 1638 dbSNP
rs778648086 1641 dbSNP
rs3811187 1645 dbSNP
rs1278051100 1653 dbSNP
rs533470070 1671 dbSNP
rs529205515 1682 dbSNP
rs1322281846 1685 dbSNP
rs1007325441 1686 dbSNP
rs889780215 1701 dbSNP
rs1192336003 1708 dbSNP
rs1394948147 1710 dbSNP
rs1454987831 1711 dbSNP
rs1178687028 1714 dbSNP
rs1051505120 1715 dbSNP
rs1360597811 1715 dbSNP
rs1388771292 1715 dbSNP
rs1014613842 1719 dbSNP
rs998297498 1722 dbSNP
rs1004559550 1724 dbSNP
rs563474149 1728 dbSNP
rs1036158789 1730 dbSNP
rs940518093 1731 dbSNP
rs909174830 1736 dbSNP
rs1242628 1737 dbSNP
rs189148723 1739 dbSNP
rs1261487790 1740 dbSNP
rs1330333989 1747 dbSNP
rs1341669445 1747 dbSNP
rs1279150628 1748 dbSNP
rs1253000776 1752 dbSNP
rs1404719820 1756 dbSNP
rs947742901 1758 dbSNP
rs1406201969 1777 dbSNP
rs565000082 1782 dbSNP
rs1157944233 1783 dbSNP
rs1344064989 1787 dbSNP
rs1458363416 1788 dbSNP
rs996418879 1789 dbSNP
rs900406662 1790 dbSNP
rs1437078037 1793 dbSNP
rs1305462450 1803 dbSNP
rs1019316524 1804 dbSNP
rs545105405 1807 dbSNP
rs1354497045 1811 dbSNP
rs1008883331 1813 dbSNP
rs1407726501 1814 dbSNP
rs1289227244 1815 dbSNP
rs374298685 1829 dbSNP
rs1331481872 1832 dbSNP
rs1421188811 1834 dbSNP
rs775916327 1839 dbSNP
rs1171031084 1844 dbSNP
rs1479975986 1849 dbSNP
rs770259461 1850 dbSNP
rs866121349 1853 dbSNP
rs1224471021 1854 dbSNP
rs1053124581 1857 dbSNP
rs746557990 1859 dbSNP
rs73590513 1861 dbSNP
rs1252173937 1862 dbSNP
rs1232251810 1879 dbSNP
rs968190809 1883 dbSNP
rs1022582646 1899 dbSNP
rs1439704440 1903 dbSNP
rs1405399387 1909 dbSNP
rs189891557 1909 dbSNP
rs1166851549 1914 dbSNP
rs1258922840 1917 dbSNP
rs1007154841 1919 dbSNP
rs1223179849 1932 dbSNP
rs1441299925 1933 dbSNP
rs1308399378 1936 dbSNP
rs531525731 1938 dbSNP
rs563785138 1940 dbSNP
rs1380010631 1943 dbSNP
rs998558237 1945 dbSNP
rs1271508874 1952 dbSNP
rs1307419924 1956 dbSNP
rs897277028 1966 dbSNP
rs553135825 1974 dbSNP
rs948935894 1976 dbSNP
rs747696152 1977 dbSNP
rs73590509 1979 dbSNP
rs1439388603 1986 dbSNP
rs993515083 1989 dbSNP
rs1256301823 1994 dbSNP
rs1472845722 1996 dbSNP
rs1401894375 2003 dbSNP
rs574281182 2004 dbSNP
rs557656445 2011 dbSNP
rs1331469748 2015 dbSNP
rs1417369302 2016 dbSNP
rs778772166 2018 dbSNP
rs113178752 2021 dbSNP
rs182296093 2026 dbSNP
rs895016900 2027 dbSNP
rs116286337 2030 dbSNP
rs190344603 2032 dbSNP
rs1312511090 2035 dbSNP
rs1341222699 2035 dbSNP
rs548619313 2037 dbSNP
rs1268478578 2046 dbSNP
rs1361924693 2049 dbSNP
rs2145541 2052 dbSNP
rs1175454506 2053 dbSNP
rs1471185586 2054 dbSNP
rs548728268 2056 dbSNP
rs1238812227 2057 dbSNP
rs946420164 2058 dbSNP
rs1460094626 2064 dbSNP
rs756088827 2065 dbSNP
rs1211684395 2066 dbSNP
rs1239831148 2069 dbSNP
rs1211244383 2073 dbSNP
rs954325913 2074 dbSNP
rs985991208 2074 dbSNP
rs186278951 2075 dbSNP
rs964924233 2084 dbSNP
rs1403250471 2085 dbSNP
rs1416359395 2086 dbSNP
rs1018851940 2090 dbSNP
rs1225927836 2091 dbSNP
rs1378331774 2094 dbSNP
rs1323149815 2095 dbSNP
rs1435837356 2095 dbSNP
rs1009203188 2101 dbSNP
rs1309275961 2102 dbSNP
rs1345331279 2103 dbSNP
rs76077818 2110 dbSNP
rs549671419 2116 dbSNP
rs1451298748 2117 dbSNP
rs1464060643 2118 dbSNP
rs532917478 2119 dbSNP
rs78673418 2121 dbSNP
rs1015661999 2126 dbSNP
rs563989993 2129 dbSNP
rs1344443123 2132 dbSNP
rs1005607150 2143 dbSNP
rs904601546 2146 dbSNP
rs551454573 2148 dbSNP
rs1044914535 2157 dbSNP
rs1442916793 2161 dbSNP
rs1392982077 2163 dbSNP
rs1440782254 2164 dbSNP
rs895097804 2177 dbSNP
rs948897350 2177 dbSNP
rs1440400363 2178 dbSNP
rs559667447 2179 dbSNP
rs767660409 2182 dbSNP
rs1245194466 2184 dbSNP
rs1328043573 2184 dbSNP
rs1057317444 2190 dbSNP
rs1228532875 2194 dbSNP
rs940236595 2196 dbSNP
rs1056782934 2197 dbSNP
rs1209195957 2201 dbSNP
rs908804343 2202 dbSNP
rs983069665 2205 dbSNP
rs930348651 2218 dbSNP
rs757517535 2222 dbSNP
rs1179312750 2224 dbSNP
rs1259291653 2225 dbSNP
rs1218388946 2229 dbSNP
rs1354979491 2231 dbSNP
rs974929243 2236 dbSNP
rs1473030282 2237 dbSNP
rs1161518757 2238 dbSNP
rs1415813281 2239 dbSNP
rs902193938 2240 dbSNP
rs564928692 2246 dbSNP
rs559678067 2247 dbSNP
rs1408636836 2253 dbSNP
rs1328585488 2255 dbSNP
rs1349547444 2260 dbSNP
rs751792129 2262 dbSNP
rs955908341 2263 dbSNP
rs1031628559 2264 dbSNP
rs1243357060 2276 dbSNP
rs542630149 2280 dbSNP
rs968729798 2281 dbSNP
rs1022978833 2283 dbSNP
rs1013394843 2286 dbSNP
rs1193910831 2292 dbSNP
rs1273618414 2309 dbSNP
rs1483240059 2310 dbSNP
rs1184641540 2313 dbSNP
rs57047537 2315 dbSNP
rs1423325087 2318 dbSNP
rs563782118 2318 dbSNP
rs1004369651 2319 dbSNP
rs544174125 2321 dbSNP
rs985678704 2322 dbSNP
rs1168394267 2323 dbSNP
rs887356334 2330 dbSNP
rs578211313 2331 dbSNP
rs746538387 2332 dbSNP
rs1431958953 2334 dbSNP
rs1309485305 2339 dbSNP
rs1399526974 2341 dbSNP
rs1395009047 2343 dbSNP
rs1360868904 2346 dbSNP
rs1342238099 2348 dbSNP
rs1225197802 2352 dbSNP
rs763247028 2358 dbSNP
rs1048647163 2360 dbSNP
rs930296433 2363 dbSNP
rs116458451 2373 dbSNP
rs1278541031 2374 dbSNP
rs867527139 2376 dbSNP
rs1201155684 2378 dbSNP
rs775696434 2384 dbSNP
rs1361073045 2392 dbSNP
rs943075472 2393 dbSNP
rs765442088 2396 dbSNP
rs534683168 2407 dbSNP
rs376112760 2416 dbSNP
rs572015289 2430 dbSNP
rs1188507241 2434 dbSNP
rs1391259628 2436 dbSNP
rs1015568674 2443 dbSNP
rs987703324 2461 dbSNP
rs145949229 2476 dbSNP
rs955898496 2483 dbSNP
rs759594149 2485 dbSNP
rs535064919 2486 dbSNP
rs924504813 2490 dbSNP
rs978704289 2491 dbSNP
rs952808314 2492 dbSNP
rs1023462943 2496 dbSNP
rs1300953663 2499 dbSNP
rs1422786992 2499 dbSNP
rs1234280830 2501 dbSNP
rs968641224 2514 dbSNP
rs1257930721 2524 dbSNP
rs1012121927 2529 dbSNP
rs1370321276 2538 dbSNP
rs764361170 2542 dbSNP
rs569639161 2544 dbSNP
rs113468340 2546 dbSNP
rs1192201364 2557 dbSNP
rs1428073370 2560 dbSNP
rs763272870 2560 dbSNP
rs1176355296 2562 dbSNP
rs539391304 2562 dbSNP
rs775889186 2564 dbSNP
rs1455249721 2566 dbSNP
rs765763723 2569 dbSNP
rs887303800 2570 dbSNP
rs182028271 2579 dbSNP
rs1042081477 2583 dbSNP
rs1366672761 2587 dbSNP
rs995694823 2592 dbSNP
rs1303677209 2594 dbSNP
rs1327331930 2596 dbSNP
rs1220971074 2598 dbSNP
rs1268822835 2604 dbSNP
rs1362253392 2606 dbSNP
rs1266648883 2610 dbSNP
rs1246582626 2612 dbSNP
rs893593793 2617 dbSNP
rs1193282398 2618 dbSNP
rs1049922769 2619 dbSNP
rs900086061 2620 dbSNP
rs1039077683 2626 dbSNP
rs529387660 2628 dbSNP
rs1293065037 2630 dbSNP
rs759987302 2632 dbSNP
rs1340938099 2636 dbSNP
rs1162614930 2637 dbSNP
rs922777479 2642 dbSNP
rs772721237 2648 dbSNP
rs1051534337 2653 dbSNP
rs1302445708 2656 dbSNP
rs1458276201 2665 dbSNP
rs1295053955 2667 dbSNP
rs1041173848 2668 dbSNP
rs541043992 2668 dbSNP
rs771502257 2672 dbSNP
rs1352426543 2679 dbSNP
rs908765097 2697 dbSNP
rs934468621 2700 dbSNP
rs1392800587 2702 dbSNP
rs1294129607 2703 dbSNP
rs1322838629 2709 dbSNP
rs984121514 2728 dbSNP
rs952819732 2730 dbSNP
rs1482909873 2733 dbSNP
rs1204030750 2748 dbSNP
rs924415033 2753 dbSNP
rs1570342 2754 dbSNP
rs1424301915 2755 dbSNP
rs969005877 2758 dbSNP
rs1368501068 2771 dbSNP
rs1428806839 2778 dbSNP
rs1308874511 2780 dbSNP
rs1372640097 2783 dbSNP
rs991995350 2789 dbSNP
rs527503201 2795 dbSNP
rs773935925 2798 dbSNP
rs149533251 2804 dbSNP
rs1230557951 2806 dbSNP
rs1295981277 2811 dbSNP
rs1206230500 2815 dbSNP
rs1197749246 2817 dbSNP
rs1207469639 2823 dbSNP
rs960127288 2823 dbSNP
rs56877865 2827 dbSNP
rs1003343599 2831 dbSNP
rs866979546 2834 dbSNP
rs749078087 2840 dbSNP
rs529267367 2841 dbSNP
rs779959564 2843 dbSNP
rs1168976049 2848 dbSNP
rs1020879136 2860 dbSNP
rs1209896572 2869 dbSNP
rs1480063008 2870 dbSNP
rs1255725495 2879 dbSNP
rs1359838079 2883 dbSNP
rs1450226838 2895 dbSNP
rs1319136011 2896 dbSNP
rs1365089859 2897 dbSNP
rs1010598351 2912 dbSNP
rs1300237630 2918 dbSNP
rs995642586 2923 dbSNP
rs1217141451 2931 dbSNP
rs1277409415 2932 dbSNP
rs187390235 2936 dbSNP
rs544112633 2938 dbSNP
rs779667587 2938 dbSNP
rs1246177264 2939 dbSNP
rs578256893 2940 dbSNP
rs997020455 2945 dbSNP
rs1243666940 2946 dbSNP
rs1007619683 2950 dbSNP
rs1476889475 2954 dbSNP
rs564789354 2955 dbSNP
rs1172225639 2966 dbSNP
rs1426052858 2970 dbSNP
rs541600397 2972 dbSNP
rs1157012030 2978 dbSNP
rs572608568 2980 dbSNP
rs1388608681 2990 dbSNP
rs1436419977 2998 dbSNP
rs181942906 2999 dbSNP
rs1332747998 3001 dbSNP
rs1041205356 3009 dbSNP
rs1436128438 3013 dbSNP
rs1301980138 3023 dbSNP
rs1051442411 3024 dbSNP
rs370886464 3024 dbSNP
rs1345272760 3026 dbSNP
rs138090895 3027 dbSNP
rs1333475570 3029 dbSNP
rs902941612 3032 dbSNP
rs575940035 3033 dbSNP
rs1401686595 3038 dbSNP
rs1042902368 3046 dbSNP
rs947277782 3047 dbSNP
rs1197899572 3049 dbSNP
rs991465134 3050 dbSNP
rs745744480 3057 dbSNP
rs928694027 3060 dbSNP
rs1411362534 3061 dbSNP
rs1457786466 3064 dbSNP
rs1162010606 3068 dbSNP
rs915793908 3069 dbSNP
rs991448896 3070 dbSNP
rs938608888 3073 dbSNP
rs1405623268 3076 dbSNP
rs1324593412 3077 dbSNP
rs981979864 3085 dbSNP
rs1174653948 3086 dbSNP
rs555777010 3090 dbSNP
rs1406425663 3092 dbSNP
rs1479240284 3095 dbSNP
rs1378712347 3102 dbSNP
rs966513485 3103 dbSNP
rs1281274775 3110 dbSNP
rs1354147720 3111 dbSNP
rs1020910204 3114 dbSNP
rs928617523 3115 dbSNP
rs1290288219 3117 dbSNP
rs1011255746 3118 dbSNP
rs1181765712 3121 dbSNP
rs1203305949 3124 dbSNP
rs1251273641 3128 dbSNP
rs539329599 3140 dbSNP
rs1184064931 3142 dbSNP
rs189285189 3146 dbSNP
rs1028410946 3149 dbSNP
rs1472741838 3157 dbSNP
rs1235774442 3168 dbSNP
rs150339975 3179 dbSNP
rs757335384 3180 dbSNP
rs1305798901 3186 dbSNP
rs183792993 3188 dbSNP
rs1409961935 3199 dbSNP
rs1027063480 3202 dbSNP
rs974645699 3206 dbSNP
rs1338669302 3207 dbSNP
rs1198511547 3208 dbSNP
rs1019321015 3220 dbSNP
rs1256497621 3221 dbSNP
rs1361337814 3227 dbSNP
rs1225897350 3234 dbSNP
rs1274264214 3240 dbSNP
rs576182542 3244 dbSNP
rs964268593 3245 dbSNP
rs1018930048 3255 dbSNP
rs1197674983 3259 dbSNP
rs887264622 3263 dbSNP
rs777892472 3267 dbSNP
rs1333944489 3286 dbSNP
rs533709410 3292 dbSNP
rs528656520 3298 dbSNP
rs753081434 3304 dbSNP
rs549198389 3307 dbSNP
rs1029968031 3309 dbSNP
rs1168335533 3310 dbSNP
rs931559723 3314 dbSNP
rs1382289326 3324 dbSNP
rs113771607 3325 dbSNP
rs570043893 3328 dbSNP
rs1299485240 3331 dbSNP
rs1399461668 3343 dbSNP
rs1394885462 3344 dbSNP
rs1334831869 3352 dbSNP
rs1056232640 3355 dbSNP
rs1416487541 3358 dbSNP
rs1403414614 3361 dbSNP
rs902931717 3364 dbSNP
rs1042850054 3365 dbSNP
rs1296558888 3375 dbSNP
rs947192993 3380 dbSNP
rs1342564098 3381 dbSNP
rs1452213173 3381 dbSNP
rs1254429539 3389 dbSNP
rs1382715422 3400 dbSNP
rs1179958478 3411 dbSNP
rs1201102489 3414 dbSNP
rs1245569041 3438 dbSNP
rs1463914708 3441 dbSNP
rs1188373476 3444 dbSNP
rs894279590 3468 dbSNP
rs1430613227 3475 dbSNP
rs1439846047 3476 dbSNP
rs1056051420 3487 dbSNP
rs1185029057 3488 dbSNP
rs938691956 3496 dbSNP
rs765528454 3498 dbSNP
rs938574202 3499 dbSNP
rs564811629 3504 dbSNP
rs982740841 3507 dbSNP
rs1432856784 3511 dbSNP
rs946083610 3522 dbSNP
rs74747376 3532 dbSNP
rs989290841 3534 dbSNP
rs554389750 3536 dbSNP
rs541712462 3542 dbSNP
rs1234112259 3545 dbSNP
rs1327115282 3552 dbSNP
rs1358863135 3552 dbSNP
rs377656093 3553 dbSNP
rs964490977 3563 dbSNP
rs911372103 3564 dbSNP
rs987382369 3580 dbSNP
rs1189830121 3594 dbSNP
rs1317993106 3605 dbSNP
rs1380943629 3608 dbSNP
rs766858995 3611 dbSNP
rs544841533 3612 dbSNP
rs1159828927 3622 dbSNP
rs761280326 3629 dbSNP
rs1345712389 3630 dbSNP
rs562350178 3635 dbSNP
rs1384028101 3636 dbSNP
rs1003936967 3638 dbSNP
rs1176257105 3645 dbSNP
rs967062170 3647 dbSNP
rs541548406 3649 dbSNP
rs1405811140 3653 dbSNP
rs886819921 3655 dbSNP
rs1160987148 3656 dbSNP
rs1027117461 3658 dbSNP
rs1021313046 3686 dbSNP
rs1011299606 3694 dbSNP
rs1319228680 3700 dbSNP
rs1219877624 3701 dbSNP
rs1265258733 3704 dbSNP
rs1488985740 3714 dbSNP
rs140317083 3717 dbSNP
rs1270509446 3723 dbSNP
rs1487222663 3744 dbSNP
rs1180804978 3749 dbSNP
rs1055599660 3759 dbSNP
rs1408687976 3767 dbSNP
rs1265204842 3771 dbSNP
rs76359552 3772 dbSNP
rs1162547043 3774 dbSNP
rs1490172079 3786 dbSNP
rs1349112589 3790 dbSNP
rs1056030767 3798 dbSNP
rs545359620 3799 dbSNP
rs1368942116 3804 dbSNP
rs1409342780 3805 dbSNP
rs1287763127 3808 dbSNP
rs1227128481 3817 dbSNP
rs1046991620 3828 dbSNP
rs929965828 3831 dbSNP
rs1360629432 3839 dbSNP
rs745463066 3841 dbSNP
rs919899505 3844 dbSNP
rs946118259 3846 dbSNP
rs1481854128 3849 dbSNP
rs775442730 3850 dbSNP
rs1203860013 3859 dbSNP
rs914627788 3864 dbSNP
rs1481297913 3870 dbSNP
rs180783435 3873 dbSNP
rs942765728 3876 dbSNP
rs911328884 3881 dbSNP
rs1445085227 3885 dbSNP
rs1165216662 3894 dbSNP
rs1342828640 3894 dbSNP
rs986984199 3904 dbSNP
rs1299213352 3916 dbSNP
rs921203848 3921 dbSNP
rs1171338607 3927 dbSNP
rs975344478 3943 dbSNP
rs965238379 3944 dbSNP
rs1356371501 3946 dbSNP
rs1445834428 3947 dbSNP
rs1302844580 3948 dbSNP
rs1320943665 3966 dbSNP
rs1454959666 3970 dbSNP
rs1406662040 3976 dbSNP
rs139113771 3977 dbSNP
rs115818993 3990 dbSNP
rs1213648779 3995 dbSNP
rs1273197828 3999 dbSNP
rs568145921 4000 dbSNP
rs1207406060 4002 dbSNP
rs968306998 4010 dbSNP
rs369359296 4011 dbSNP
rs184631785 4012 dbSNP
rs958476002 4014 dbSNP
rs1448588670 4016 dbSNP
rs958886902 4018 dbSNP
rs570128169 4030 dbSNP
rs1223858487 4032 dbSNP
rs1175426422 4037 dbSNP
rs571610547 4042 dbSNP
rs1003142673 4050 dbSNP
rs907416691 4053 dbSNP
rs1041750160 4055 dbSNP
rs373995597 4061 dbSNP
rs550305319 4062 dbSNP
rs1270478804 4066 dbSNP
rs907075192 4067 dbSNP
rs893265114 4069 dbSNP
rs146506845 4073 dbSNP
rs1262001000 4075 dbSNP
rs1323560104 4079 dbSNP
rs1205498069 4087 dbSNP
rs1279161229 4091 dbSNP
rs1223292153 4093 dbSNP
rs570903807 4094 dbSNP
rs777859573 4098 dbSNP
rs547765899 4101 dbSNP
rs1244107635 4105 dbSNP
rs758562595 4106 dbSNP
rs1198916004 4110 dbSNP
rs748798302 4120 dbSNP
rs911292095 4129 dbSNP
rs528024809 4135 dbSNP
rs1157593084 4136 dbSNP
rs1388541866 4138 dbSNP
rs1330122019 4146 dbSNP
rs1039902367 4152 dbSNP
rs1463699176 4174 dbSNP
rs1402029621 4178 dbSNP
rs1051645055 4182 dbSNP
rs1484906162 4186 dbSNP
rs193156281 4187 dbSNP
rs924081444 4192 dbSNP
rs1282181595 4207 dbSNP
rs982451661 4228 dbSNP
rs951030735 4231 dbSNP
rs1286446829 4235 dbSNP
rs919696399 4236 dbSNP
rs542383979 4238 dbSNP
rs1205546957 4240 dbSNP
rs1286119671 4264 dbSNP
rs1422937396 4266 dbSNP
rs1222036379 4268 dbSNP
rs1192900280 4277 dbSNP
rs1478327335 4279 dbSNP
rs550059434 4285 dbSNP
rs1167801978 4287 dbSNP
rs1180089344 4288 dbSNP
rs1363773927 4288 dbSNP
rs1470817532 4300 dbSNP
rs538045027 4304 dbSNP
rs531803816 4307 dbSNP
rs372382010 4310 dbSNP
rs567429983 4311 dbSNP
rs971676084 4317 dbSNP
rs1310857030 4318 dbSNP
rs1281326434 4320 dbSNP
rs1305612309 4321 dbSNP
rs562203403 4326 dbSNP
rs1211007867 4332 dbSNP
rs545498585 4336 dbSNP
rs1281152187 4340 dbSNP
rs1353995862 4344 dbSNP
rs766835751 4348 dbSNP
rs4982705 4361 dbSNP
rs1490895614 4368 dbSNP
rs1203158798 4370 dbSNP
rs1249939742 4370 dbSNP
rs971139849 4373 dbSNP
rs142472348 4380 dbSNP
rs1184610060 4381 dbSNP
rs1443954035 4384 dbSNP
rs1444473956 4385 dbSNP
rs1378638384 4390 dbSNP
rs530238614 4396 dbSNP
rs1465339931 4404 dbSNP
rs1385526621 4405 dbSNP
rs574647000 4407 dbSNP
rs1165740265 4433 dbSNP
rs1395155278 4436 dbSNP
rs554580220 4444 dbSNP
rs1391395653 4453 dbSNP
rs893123224 4468 dbSNP
rs1220217906 4474 dbSNP
rs1451708111 4478 dbSNP
rs898408998 4490 dbSNP
rs188206384 4497 dbSNP
rs1178002019 4511 dbSNP
rs1017287815 4513 dbSNP
rs1318392441 4517 dbSNP
rs1361280808 4518 dbSNP
rs1226480556 4520 dbSNP
rs1054836642 4525 dbSNP
rs1006879756 4534 dbSNP
rs572783384 4542 dbSNP
rs889753779 4547 dbSNP
rs185237621 4560 dbSNP
rs1197618832 4565 dbSNP
rs552875763 4572 dbSNP
rs1277185346 4573 dbSNP
rs934022400 4582 dbSNP
rs1379626337 4583 dbSNP
rs1461241982 4586 dbSNP
rs902606559 4593 dbSNP
rs1184713383 4611 dbSNP
rs1245374394 4630 dbSNP
rs900549508 4632 dbSNP
rs539981379 4643 dbSNP
rs1039571886 4647 dbSNP
rs1176838757 4649 dbSNP
rs1441700692 4653 dbSNP
rs1042572674 4654 dbSNP
rs1372138286 4662 dbSNP
rs1462101709 4672 dbSNP
rs1183276927 4678 dbSNP
rs1482413893 4679 dbSNP
rs943871732 4683 dbSNP
rs1337248647 4692 dbSNP
rs762702570 4701 dbSNP
rs1432632152 4707 dbSNP
rs1295198676 4708 dbSNP
rs1211271827 4711 dbSNP
rs1327228677 4716 dbSNP
rs1254373476 4725 dbSNP
rs1322856727 4727 dbSNP
rs1316786708 4748 dbSNP
rs1265467087 4752 dbSNP
rs1463873145 4753 dbSNP
rs752075502 4766 dbSNP
rs570845335 4778 dbSNP
rs915479559 4780 dbSNP
rs1194827051 4792 dbSNP
rs775352580 4792 dbSNP
rs938290153 4793 dbSNP
rs547801641 4797 dbSNP
rs1408195383 4798 dbSNP
rs1309380605 4811 dbSNP
rs769546408 4817 dbSNP
rs759442081 4818 dbSNP
rs1385356608 4823 dbSNP
rs926928370 4856 dbSNP
rs919619057 4864 dbSNP
rs1344967705 4867 dbSNP
rs1224195684 4875 dbSNP
rs192676356 4885 dbSNP
rs776523290 4886 dbSNP
rs958492172 4895 dbSNP
rs971088343 4902 dbSNP
rs1261712956 4904 dbSNP
rs187797007 4910 dbSNP
rs1266324495 4915 dbSNP
rs1490060836 4918 dbSNP
rs1199483994 4920 dbSNP
rs1025385916 4921 dbSNP
rs981648020 4922 dbSNP
rs548610704 4926 dbSNP
rs972521028 4934 dbSNP
rs962890405 4935 dbSNP
rs1156823859 4936 dbSNP
rs1016780976 4938 dbSNP
rs1020578067 4947 dbSNP
rs1365172480 4948 dbSNP
rs531745189 4952 dbSNP
rs1007194292 4958 dbSNP
rs1405675933 4965 dbSNP
rs1304998801 4971 dbSNP
rs1380946810 4972 dbSNP
rs889711859 4977 dbSNP
rs770793248 4980 dbSNP
rs1244221181 4983 dbSNP
rs1422218278 4985 dbSNP
rs1289210097 4990 dbSNP
rs1358249713 4992 dbSNP
rs1222724705 5000 dbSNP
rs1270445279 5008 dbSNP
rs1479341291 5009 dbSNP
rs1176551000 5015 dbSNP
rs1251144445 5019 dbSNP
rs1420712515 5023 dbSNP
rs989076655 5025 dbSNP
rs1384889089 5029 dbSNP
rs1165653149 5050 dbSNP
rs1425568053 5050 dbSNP
rs1029633495 5059 dbSNP
rs1182793046 5066 dbSNP
rs1485784357 5068 dbSNP
rs1299303498 5070 dbSNP
rs746906604 5074 dbSNP
rs1376141260 5076 dbSNP
rs758830715 5081 dbSNP
rs1261625859 5083 dbSNP
rs902599868 5085 dbSNP
rs1042522104 5091 dbSNP
rs1246280466 5095 dbSNP
rs957833207 5096 dbSNP
rs1033021828 5097 dbSNP
rs946894761 5104 dbSNP
rs1203187373 5106 dbSNP
rs996571188 5112 dbSNP
rs893937172 5116 dbSNP
rs1481556297 5120 dbSNP
rs1181635094 5130 dbSNP
rs1488920883 5133 dbSNP
rs1055316980 5135 dbSNP
rs1380619507 5149 dbSNP
rs938224303 5151 dbSNP
rs900624217 5157 dbSNP
rs1018965641 5160 dbSNP
rs1185660337 5182 dbSNP
rs8008658 5183 dbSNP
rs1319536893 5186 dbSNP
rs1356317174 5191 dbSNP
rs1468725644 5201 dbSNP
rs1045369065 5206 dbSNP
rs1228639166 5214 dbSNP
rs1454909652 5218 dbSNP
rs551839496 5219 dbSNP
rs147665240 5227 dbSNP
rs1213518875 5231 dbSNP
rs1046855829 5240 dbSNP
rs1319323634 5242 dbSNP
rs918322443 5246 dbSNP
rs560012898 5255 dbSNP
rs1201703432 5262 dbSNP
rs972427830 5265 dbSNP
rs1461648483 5277 dbSNP
rs1401726075 5283 dbSNP
rs1240622490 5285 dbSNP
rs1475227556 5288 dbSNP
rs1361095405 5301 dbSNP
rs1187285814 5310 dbSNP
rs540191331 5322 dbSNP
rs542532837 5323 dbSNP
rs985317059 5330 dbSNP
rs561186830 5340 dbSNP
rs1471187047 5342 dbSNP
rs1370413114 5346 dbSNP
rs1344933718 5356 dbSNP
rs1429615374 5357 dbSNP
rs1165811469 5360 dbSNP
rs1477630884 5364 dbSNP
rs1421882884 5365 dbSNP
rs145393954 5369 dbSNP
rs779156186 5374 dbSNP
rs1324146531 5392 dbSNP
rs937002426 5394 dbSNP
rs755164377 5398 dbSNP
rs749685510 5402 dbSNP
rs780418956 5421 dbSNP
rs1216782269 5424 dbSNP
rs1208717734 5440 dbSNP
rs949755131 5440 dbSNP
rs756596764 5452 dbSNP
rs893893786 5453 dbSNP
rs1481721812 5460 dbSNP
rs988939342 5465 dbSNP
rs957677946 5466 dbSNP
rs1033675962 5474 dbSNP
rs575498570 5488 dbSNP
rs1159468126 5492 dbSNP
rs1266826249 5497 dbSNP
rs1221789872 5499 dbSNP
rs1002411239 5501 dbSNP
rs1316957493 5508 dbSNP
rs906774455 5509 dbSNP
rs974794020 5511 dbSNP
rs558824354 5519 dbSNP
rs1302023368 5521 dbSNP
rs1046658454 5523 dbSNP
rs965059293 5526 dbSNP
rs1438543580 5539 dbSNP
rs1220252289 5540 dbSNP
rs1277635021 5549 dbSNP
rs929573185 5552 dbSNP
rs918229089 5554 dbSNP
rs1288481416 5555 dbSNP
rs1357508122 5559 dbSNP
rs148994941 5566 dbSNP
rs941071354 5580 dbSNP
rs1453340184 5582 dbSNP
rs759775354 5589 dbSNP
rs1180292310 5593 dbSNP
rs909664068 5595 dbSNP
rs1025438289 5596 dbSNP
rs985696879 5607 dbSNP
rs1300587798 5617 dbSNP
rs1385124453 5622 dbSNP
rs1392908361 5623 dbSNP
rs1294227697 5624 dbSNP
rs1422383881 5626 dbSNP
rs953928419 5628 dbSNP
rs577242624 5633 dbSNP
rs898453204 5640 dbSNP
rs1406593398 5643 dbSNP
rs1398392830 5648 dbSNP
rs922502038 5650 dbSNP
rs1173249958 5652 dbSNP
rs8012963 5665 dbSNP
rs1442714745 5668 dbSNP
rs1377525866 5688 dbSNP
rs1197428197 5689 dbSNP
rs1435449698 5695 dbSNP
rs767907589 5703 dbSNP
rs1292691742 5705 dbSNP
rs1358646674 5706 dbSNP
rs905540698 5719 dbSNP
rs1272973193 5731 dbSNP
rs1438930654 5738 dbSNP
rs865849207 5740 dbSNP
rs1456998645 5741 dbSNP
rs1444317617 5742 dbSNP
rs758042712 5751 dbSNP
rs1200302007 5752 dbSNP
rs949785142 5755 dbSNP
rs1466101008 5760 dbSNP
rs912977222 5762 dbSNP
rs1053329042 5765 dbSNP
rs1318389281 5770 dbSNP
rs1451642233 5774 dbSNP
rs936148475 5783 dbSNP
rs1342463574 5794 dbSNP
rs1255215668 5804 dbSNP
rs766506259 5806 dbSNP
rs534156168 5818 dbSNP
rs1269694852 5826 dbSNP
rs1010915628 5839 dbSNP
rs958356855 5840 dbSNP
rs975410831 5844 dbSNP
rs1201075981 5845 dbSNP
rs145870638 5849 dbSNP
rs548861197 5850 dbSNP
rs1170521327 5868 dbSNP
rs1204682989 5871 dbSNP
rs1256475338 5872 dbSNP
rs1002770138 5883 dbSNP
rs1190519731 5885 dbSNP
rs1425223708 5885 dbSNP
rs375541612 5888 dbSNP
rs1372017674 5893 dbSNP
rs1477825195 5901 dbSNP
rs1172818007 5914 dbSNP
rs147424456 5915 dbSNP
rs987396868 5917 dbSNP
rs1303243339 5921 dbSNP
rs1404025719 5922 dbSNP
rs950839434 5927 dbSNP
rs1333659020 5929 dbSNP
rs1327167324 5934 dbSNP
rs538189559 5935 dbSNP
rs1026355752 5937 dbSNP
rs114189626 5939 dbSNP
rs1323409164 5941 dbSNP
rs1224624058 5954 dbSNP
rs1485066291 5955 dbSNP
rs1401888631 5957 dbSNP
rs552323162 5960 dbSNP
rs1046567168 5966 dbSNP
rs1467971806 5967 dbSNP
rs993668853 5968 dbSNP
rs1173701568 5979 dbSNP
rs1438613879 5987 dbSNP
rs1260609384 5988 dbSNP
rs1235945013 6008 dbSNP
rs532583509 6017 dbSNP
rs1488365934 6020 dbSNP
rs898088629 6025 dbSNP
rs1195187261 6033 dbSNP
rs1016738640 6035 dbSNP
rs1001877002 6036 dbSNP
rs1176629475 6040 dbSNP
rs1037094570 6042 dbSNP
rs560149974 6045 dbSNP
rs941073578 6048 dbSNP
rs1379157256 6050 dbSNP
rs888176550 6056 dbSNP
rs1158268273 6057 dbSNP
rs1361382643 6062 dbSNP
rs1427262741 6067 dbSNP
rs1180177347 6068 dbSNP
rs905740252 6071 dbSNP
rs1045435390 6074 dbSNP
rs149815691 6082 dbSNP
rs546378937 6101 dbSNP
rs1416676038 6102 dbSNP
rs932404850 6113 dbSNP
rs1387876932 6114 dbSNP
rs922408678 6117 dbSNP
rs891574232 6120 dbSNP
rs1198527251 6125 dbSNP
rs1238764105 6127 dbSNP
rs1053266927 6141 dbSNP
rs1353934437 6148 dbSNP
rs1347018465 6152 dbSNP
rs935734857 6158 dbSNP
rs976584527 6165 dbSNP
rs1281031274 6169 dbSNP
rs1490024087 6187 dbSNP
rs765010597 6189 dbSNP
rs1239474863 6199 dbSNP
rs1191764474 6202 dbSNP
rs1269355147 6208 dbSNP
rs1417130196 6210 dbSNP
rs1180781633 6218 dbSNP
rs1380634835 6218 dbSNP
rs926130533 6224 dbSNP
rs139904123 6226 dbSNP
rs1311580752 6236 dbSNP
rs913855272 6247 dbSNP
rs146131186 6256 dbSNP
rs79288471 6257 dbSNP
rs1295864094 6270 dbSNP
rs1034109423 6271 dbSNP
rs561561948 6273 dbSNP
rs542832699 6274 dbSNP
rs572153992 6275 dbSNP
rs1310488247 6280 dbSNP
rs1298162643 6286 dbSNP
rs1379502864 6290 dbSNP
rs1418538228 6293 dbSNP
rs919373238 6295 dbSNP
rs1320652681 6300 dbSNP
rs1221628840 6309 dbSNP
rs1267186958 6317 dbSNP
rs1479633082 6319 dbSNP
rs1195103189 6324 dbSNP
rs1377903970 6327 dbSNP
rs973912010 6328 dbSNP
rs71413964 6336 dbSNP
rs1384832476 6337 dbSNP
rs116145741 6342 dbSNP
rs1001343926 6345 dbSNP
rs1461932054 6346 dbSNP
rs970001543 6346 dbSNP
rs1332552544 6350 dbSNP
rs1185132337 6358 dbSNP
rs1443965079 6360 dbSNP
rs1312523028 6365 dbSNP
rs993658629 6371 dbSNP
rs1258105693 6383 dbSNP
rs572962728 6384 dbSNP
rs1487287988 6387 dbSNP
rs1305203357 6395 dbSNP
rs1197944770 6401 dbSNP
rs1013957679 6405 dbSNP
rs554192656 6416 dbSNP
rs1052761132 6417 dbSNP
rs35376336 6419 dbSNP
rs60595323 6422 dbSNP
rs554570420 6423 dbSNP
rs1049880114 6427 dbSNP
rs1427990257 6428 dbSNP
rs1172086051 6429 dbSNP
rs932352529 6430 dbSNP
rs570307859 6431 dbSNP
rs1336518194 6436 dbSNP
rs1323415220 6438 dbSNP
rs139885831 6442 dbSNP
rs1448313965 6453 dbSNP
rs1398620227 6454 dbSNP
rs1304157300 6461 dbSNP
rs890733355 6468 dbSNP
rs1363020404 6473 dbSNP
rs1051956140 6478 dbSNP
rs1221569858 6497 dbSNP
rs577668397 6498 dbSNP
rs1389524882 6499 dbSNP
rs189723529 6502 dbSNP
rs1473585633 6503 dbSNP
rs1418250888 6513 dbSNP
rs1488031327 6521 dbSNP
rs1194434949 6528 dbSNP
rs1192677101 6532 dbSNP
rs1479753098 6533 dbSNP
rs1176260134 6544 dbSNP
rs1426323060 6549 dbSNP
rs1416518004 6553 dbSNP
rs1476769567 6557 dbSNP
rs539173795 6572 dbSNP
rs1216586432 6581 dbSNP
rs188357743 6599 dbSNP
rs1341784104 6600 dbSNP
rs1274177322 6604 dbSNP
rs1227214429 6606 dbSNP
rs1368111253 6608 dbSNP
rs942117428 6618 dbSNP
rs1282469511 6622 dbSNP
rs1353296340 6629 dbSNP
rs1217554511 6630 dbSNP
rs936600824 6638 dbSNP
rs1211810881 6645 dbSNP
rs979954620 6646 dbSNP
rs546663659 6649 dbSNP
rs1247792828 6651 dbSNP
rs969865358 6653 dbSNP
rs1479238691 6663 dbSNP
rs757640711 6667 dbSNP
rs113432305 6682 dbSNP
rs112054911 6683 dbSNP
rs1024115859 6685 dbSNP
rs1361978073 6685 dbSNP
rs199850298 6686 dbSNP
rs199635725 6690 dbSNP
rs11298840 6691 dbSNP
rs796910958 6691 dbSNP
rs1331576924 6699 dbSNP
rs1430787182 6701 dbSNP
rs1329952280 6703 dbSNP
rs1321043317 6709 dbSNP
rs1406676963 6711 dbSNP
rs12897065 6712 dbSNP
rs1241151967 6725 dbSNP
rs1169684501 6733 dbSNP
rs1357452551 6734 dbSNP
rs992761710 6735 dbSNP
rs12881874 6736 dbSNP
rs1202978962 6741 dbSNP
rs1237969339 6742 dbSNP
rs1187086995 6751 dbSNP
rs1440632088 6754 dbSNP
rs1477671143 6757 dbSNP
rs1178928196 6763 dbSNP
rs1245015269 6767 dbSNP
rs1031759125 6771 dbSNP
rs1201107711 6789 dbSNP
rs999855320 6793 dbSNP
rs904308611 6798 dbSNP
rs1017337324 6800 dbSNP
rs1029101122 6805 dbSNP
rs1257740666 6812 dbSNP
rs550568457 6817 dbSNP
rs757940834 6818 dbSNP
rs1380823085 6819 dbSNP
rs890639530 6825 dbSNP
rs1274171082 6828 dbSNP
rs182793305 6833 dbSNP
rs191919348 6834 dbSNP
rs929563348 6836 dbSNP
rs1343495661 6846 dbSNP
rs980747169 6856 dbSNP
rs1038142022 6863 dbSNP
rs1440355022 6870 dbSNP
rs942022334 6883 dbSNP
rs749456884 6884 dbSNP
rs970777651 6894 dbSNP
rs545325359 6895 dbSNP
rs1025053106 6896 dbSNP
rs780289698 6900 dbSNP
rs1333161711 6901 dbSNP
rs962215696 6908 dbSNP
rs756573642 6909 dbSNP
rs1330315118 6915 dbSNP
rs1006450115 6916 dbSNP
rs889369312 6918 dbSNP
rs1027957401 6919 dbSNP
rs1170923739 6920 dbSNP
rs956183205 6921 dbSNP
rs996550299 6924 dbSNP
rs900922955 6925 dbSNP
rs1489370285 6933 dbSNP
rs1423044850 6934 dbSNP
rs1256402408 6939 dbSNP
rs1443693492 6940 dbSNP
rs978860367 6948 dbSNP
rs1174385911 6950 dbSNP
rs1040840601 6952 dbSNP
rs1237774793 6953 dbSNP
rs1009331108 6964 dbSNP
rs746208850 6965 dbSNP
rs1007285060 6968 dbSNP
rs528286219 6969 dbSNP
rs1404576078 6970 dbSNP
rs559325851 6979 dbSNP
rs1418053920 6981 dbSNP
rs540707540 6984 dbSNP
rs1310946367 6985 dbSNP
rs890164724 6994 dbSNP
rs1030464976 6997 dbSNP
rs1054028872 6998 dbSNP
rs936564435 7002 dbSNP
rs138785677 7005 dbSNP
rs1234398958 7007 dbSNP
rs1235816202 7014 dbSNP
rs1348039371 7016 dbSNP
rs1307926997 7017 dbSNP
rs926566764 7022<