miRTarBase - #MIRT666078 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SSTR2   
Synonyms -
Description somatostatin receptor 2
Transcript NM_001050   
Expression
Putative miRNA Targets on SSTR2
3'UTR of SSTR2
(miRNA target sites are highlighted)
>SSTR2|NM_001050|3'UTR
   1 ACTGCTTGGGGGGTGGGAAAGAACCAAGCCATGCTCTGTCTACTGGCAATGGGCTCCCTACCCACACTGGCTTCCTGCCT
  81 CCCACCCCTCACACCTGGCTTCTAGAATAGAGGATTGCTCAGCATGAGTCCAATTCAGAGAACGGTGTTTGAGTCAGCTT
 161 GTCTGATTGAATGATAATGTGCTAAATTGATTACCTCCCCCTTAAAGCGAACACTGAAATGCAGGTAGACAATTCAAAGT
 241 CTGGAGAAGAGGGATCATGCCTGGATATGATCTTTAGAAACAACAAAAATAGAAAAAAATAAGTATCTGTGTGTTTGTGT
 321 ATTGAAAACTCAATATGTAATCTTGTGTTTTTATATGTATACTTGTATATTCCTATTTATTCTCTGTATAGGCATTACCT
 401 ACGTTCCTGTGTTTACATACACAAGTAGCAAATTCGAGTATGCATAGTGTAGATGGACATTTGCCACAACACACTGCCCG
 481 CAGAAATGGACTTACCGTGAAGCCAATAAAGTTCAAGCTTCAGGGATCTCTCTTGCACGGGCCTTGCCAAGGCCCAGGAG
 561 GGACTTGGGCAGTATGTTCATGTGGTCATATGTTTTTGTAAAAAATTGTGAAAGTAAGATATGTTTGTATTGTTTTTCTT
 641 AAAGAGGAACCTCGTATAAGCTTCAAGCCTCACAAACCTTCTAGCCTCTGCCCTTGGGGATTTGCTTCATTAATTTCAGG
 721 CAAGTGAGGTCAATGTAAGAAGGGAAAGGGAGAAGATATTTGAAGAACCAGAATGTAAATTCATGTGTTTCCACTTCTCA
 801 GATATAGTCAGAGAATTATTCATTTGCCCAAAAGGACTTAAGTGGTTGTGGTCATCCATCATTGTATTTATCAAGACAAA
 881 GCCAACTTTGTTATAAGATTGCATTTTTTTCTTTTCAAATTGCTTTAGTTTTTCTTAGGGAGCTATGAGGGGGAAAAATC
 961 ACTAACATGAAAGGCAAAAAATGGACTATGATTCCTGTGGGGAAACAATTTCATTCTCTCCATCGTGAAAATAAGTGAAT
1041 AAGAGTGAAGCAAAATTACACCTTTATGAGAAACCATAAAATTGTTTTTATTTTTCAGGCCAGACATAGCTTCCTAATGA
1121 AAGAAAATGGAAATGTAATTCGACGACTCCTCAAAGGGGACTTTAGAGGACTTCATACAAAGCTGGGCATTAAGAAAACC
1201 ACAATGCATGGCCGGGCGTGGTGGCTTACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGTGGATCACCCGAGGT
1281 CAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCATCACTACTAAAAATATGTAAATTAGTCGGGCGTGGTGTC
1361 ACGTGCCTGTAATCCTAGCTGCTCGGGAGGCTGAGGCAGGAGAATCACTTGAACTTGGGAGGTGGAGGTTGCAGTAAGCT
1441 GAGATTGTGCCACTGCACTCTAGCCTGAGCAACAAGAGCAAAACTCAGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
1521 AAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |:||  |||| |:|:||| 
Target 5' tgtATAC--TTGT-ATATTCCt 3'
356 - 374 126.00 -9.60
2
miRNA  3' guUUGUGGUAACAG-UG-UGAGGu 5'
            ||::: ||  || || ||||| 
Target 5' gaAATGTAAT--TCGACGACTCCt 3'
1130 - 1151 120.00 -6.50
3
miRNA  3' guuugugGUAACAG-UGUGAGGu 5'
                 ||||  | ||::||| 
Target 5' gtataggCATTACCTACGTTCCt 3'
386 - 408 119.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30473627 12 COSMIC
COSN28835996 14 COSMIC
COSN30101329 52 COSMIC
COSN31571002 132 COSMIC
COSN31591116 145 COSMIC
COSN28883471 179 COSMIC
COSN28190797 185 COSMIC
COSN5851240 198 COSMIC
COSM4447232 253 COSMIC
COSM4447233 254 COSMIC
COSM4447234 270 COSMIC
COSM7286415 300 COSMIC
COSN30533628 305 COSMIC
COSN26551264 358 COSMIC
COSN31516376 436 COSMIC
COSN30138577 480 COSMIC
COSN4770487 504 COSMIC
COSN30173560 552 COSMIC
COSN30111853 571 COSMIC
COSN26958068 617 COSMIC
COSN30173109 619 COSMIC
COSN24012030 645 COSMIC
COSN15626538 766 COSMIC
COSN20957494 800 COSMIC
COSN19662180 974 COSMIC
COSN216947 980 COSMIC
COSN29463265 1192 COSMIC
COSN26581276 1215 COSMIC
COSN8245993 1349 COSMIC
COSN9322160 1464 COSMIC
COSN26347066 1555 COSMIC
COSN32094319 1738 COSMIC
COSN27511923 2323 COSMIC
COSN31995745 2547 COSMIC
COSN15163407 2644 COSMIC
COSN9673574 3700 COSMIC
COSN7445036 4071 COSMIC
COSN28094984 4345 COSMIC
COSN23520811 4525 COSMIC
COSN24434828 4638 COSMIC
COSN27274947 4884 COSMIC
COSN8245994 4916 COSMIC
COSN16114562 5255 COSMIC
COSN7445037 5484 COSMIC
COSN16130068 5498 COSMIC
COSN21056380 5834 COSMIC
COSN9322162 5887 COSMIC
COSN5420369 5914 COSMIC
COSN21595873 6032 COSMIC
COSN20331510 6135 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs377234599 4 dbSNP
rs766552602 6 dbSNP
rs773365896 6 dbSNP
rs1303859524 7 dbSNP
rs751743828 8 dbSNP
rs781194885 8 dbSNP
rs1261665303 9 dbSNP
rs749610233 10 dbSNP
rs774798932 11 dbSNP
rs1042097142 14 dbSNP
rs760057010 15 dbSNP
rs768059347 22 dbSNP
rs775032215 25 dbSNP
rs1379239411 32 dbSNP
rs1332080247 34 dbSNP
rs749780945 35 dbSNP
rs752635722 35 dbSNP
rs760166836 36 dbSNP
rs571745752 38 dbSNP
rs1178837708 41 dbSNP
rs753442091 44 dbSNP
rs1453622294 45 dbSNP
rs1158843533 46 dbSNP
rs765149637 50 dbSNP
rs965389578 57 dbSNP
rs1156790400 61 dbSNP
rs1471090123 61 dbSNP
rs768781201 62 dbSNP
rs1459711069 63 dbSNP
rs1244654702 70 dbSNP
rs372220047 87 dbSNP
rs931145251 89 dbSNP
rs1283945075 95 dbSNP
rs1007685877 98 dbSNP
rs768184990 104 dbSNP
rs1310101338 106 dbSNP
rs780379142 110 dbSNP
rs1245416356 115 dbSNP
rs80225523 125 dbSNP
rs1380676556 127 dbSNP
rs7220818 134 dbSNP
rs35307496 138 dbSNP
rs976470555 141 dbSNP
rs919292359 144 dbSNP
rs937299845 145 dbSNP
rs1462125719 159 dbSNP
rs1421445441 168 dbSNP
rs1380773102 173 dbSNP
rs1328007865 174 dbSNP
rs950788878 175 dbSNP
rs761812686 178 dbSNP
rs1417262325 179 dbSNP
rs756074881 180 dbSNP
rs777755115 180 dbSNP
rs1317030056 181 dbSNP
rs758382128 181 dbSNP
rs780209306 183 dbSNP
rs749087818 186 dbSNP
rs984700241 188 dbSNP
rs1437793919 194 dbSNP
rs767741888 197 dbSNP
rs773436001 199 dbSNP
rs937791990 200 dbSNP
rs756163373 206 dbSNP
rs1214022975 208 dbSNP
rs1310202065 209 dbSNP
rs1356142220 210 dbSNP
rs1222077283 222 dbSNP
rs1283641600 223 dbSNP
rs777985379 225 dbSNP
rs1295099904 227 dbSNP
rs1489469654 228 dbSNP
rs1054997100 233 dbSNP
rs1223643384 236 dbSNP
rs759281746 237 dbSNP
rs1461944529 242 dbSNP
rs1314875756 243 dbSNP
rs865985418 250 dbSNP
rs1467831905 258 dbSNP
rs917668282 259 dbSNP
rs200576729 263 dbSNP
rs1268210708 266 dbSNP
rs765050850 269 dbSNP
rs1360922916 278 dbSNP
rs904649593 285 dbSNP
rs770726530 290 dbSNP
rs1413864871 291 dbSNP
rs1302515511 293 dbSNP
rs1406642985 294 dbSNP
rs1167480438 296 dbSNP
rs1392949854 297 dbSNP
rs1440556367 300 dbSNP
rs1000234307 304 dbSNP
rs1332463149 304 dbSNP
rs1029139839 306 dbSNP
rs138677848 308 dbSNP
rs375570170 308 dbSNP
rs1440274481 314 dbSNP
rs1187903324 315 dbSNP
rs889269748 318 dbSNP
rs1357102360 319 dbSNP
rs1230128282 321 dbSNP
rs556052537 322 dbSNP
rs1243005619 325 dbSNP
rs1222425850 334 dbSNP
rs1489990437 336 dbSNP
rs1009166622 337 dbSNP
rs1199272861 342 dbSNP
rs574221547 343 dbSNP
rs1435918690 344 dbSNP
rs34094201 345 dbSNP
rs544805047 345 dbSNP
rs902150090 346 dbSNP
rs1180612040 347 dbSNP
rs1237726433 348 dbSNP
rs1392110730 355 dbSNP
rs972775877 356 dbSNP
rs1403032774 357 dbSNP
rs563031254 367 dbSNP
rs1025309119 376 dbSNP
rs1461106456 387 dbSNP
rs1352231652 389 dbSNP
rs1185746682 390 dbSNP
rs1000959684 391 dbSNP
rs1257880368 393 dbSNP
rs1475664774 394 dbSNP
rs1054598679 403 dbSNP
rs578146293 404 dbSNP
rs1461021334 408 dbSNP
rs983855925 409 dbSNP
rs368301404 417 dbSNP
rs1199061457 421 dbSNP
rs1159892032 436 dbSNP
rs376960767 437 dbSNP
rs1452218836 439 dbSNP
rs1192276127 441 dbSNP
rs937146066 442 dbSNP
rs893398455 444 dbSNP
rs992760277 445 dbSNP
rs1017767942 461 dbSNP
rs966513155 463 dbSNP
rs917117756 464 dbSNP
rs1262295600 475 dbSNP
rs571158011 480 dbSNP
rs1041739337 481 dbSNP
rs35820703 497 dbSNP
rs1390730905 499 dbSNP
rs1026832733 502 dbSNP
rs1332739868 504 dbSNP
rs1447062540 506 dbSNP
rs1404823148 508 dbSNP
rs1173794407 516 dbSNP
rs1464914943 523 dbSNP
rs7210080 535 dbSNP
rs1050443170 539 dbSNP
rs999685574 540 dbSNP
rs984795988 548 dbSNP
rs889309969 551 dbSNP
rs1223874697 552 dbSNP
rs1285700406 555 dbSNP
rs1458260259 558 dbSNP
rs549087757 561 dbSNP
rs7210093 566 dbSNP
rs1214912604 570 dbSNP
rs960730379 577 dbSNP
rs990636149 582 dbSNP
rs1491212239 588 dbSNP
rs1491340857 589 dbSNP
rs917787833 600 dbSNP
rs1185486911 607 dbSNP
rs1381395233 611 dbSNP
rs1334328034 621 dbSNP
rs1019201171 630 dbSNP
rs57402398 639 dbSNP
rs949256853 641 dbSNP
rs1303751483 642 dbSNP
rs1453690372 648 dbSNP
rs763767191 655 dbSNP
rs898107775 666 dbSNP
rs1379065538 678 dbSNP
rs1042117013 679 dbSNP
rs1440440048 684 dbSNP
rs1384661482 685 dbSNP
rs373290396 689 dbSNP
rs1425737064 697 dbSNP
rs1177888337 720 dbSNP
rs139988799 728 dbSNP
rs1256607596 729 dbSNP
rs751125544 731 dbSNP
rs983888675 740 dbSNP
rs548125120 753 dbSNP
rs1053419896 760 dbSNP
rs958571050 763 dbSNP
rs993101251 766 dbSNP
rs1246574267 768 dbSNP
rs893387116 768 dbSNP
rs1340642946 774 dbSNP
rs1437014292 775 dbSNP
rs189095105 784 dbSNP
rs1039274088 802 dbSNP
rs1442397456 820 dbSNP
rs1365067163 824 dbSNP
rs558518887 834 dbSNP
rs945978110 835 dbSNP
rs538434944 837 dbSNP
rs1222700513 842 dbSNP
rs1192744900 864 dbSNP
rs998095351 865 dbSNP
rs1374062198 866 dbSNP
rs1026363097 867 dbSNP
rs1194331820 876 dbSNP
rs547122366 882 dbSNP
rs977295230 891 dbSNP
rs925967883 896 dbSNP
rs935981361 899 dbSNP
rs1356431684 900 dbSNP
rs1250451882 902 dbSNP
rs1016294958 904 dbSNP
rs1349933439 904 dbSNP
rs959264979 906 dbSNP
rs1208490595 916 dbSNP
rs1279296021 926 dbSNP
rs1050474289 929 dbSNP
rs1407221525 940 dbSNP
rs1391509032 943 dbSNP
rs1025331474 946 dbSNP
rs1425549202 949 dbSNP
rs565413734 949 dbSNP
rs1171042466 953 dbSNP
rs142827588 954 dbSNP
rs1451723238 954 dbSNP
rs534828103 954 dbSNP
rs72846738 954 dbSNP
rs1249149392 955 dbSNP
rs745498398 959 dbSNP
rs756484361 960 dbSNP
rs923706653 966 dbSNP
rs1234805659 970 dbSNP
rs7224362 974 dbSNP
rs1178069821 977 dbSNP
rs1049315298 981 dbSNP
rs55761865 987 dbSNP
rs1439198470 988 dbSNP
rs36005414 989 dbSNP
rs1330718586 997 dbSNP
rs1444847814 1007 dbSNP
rs1005186012 1013 dbSNP
rs1034009804 1014 dbSNP
rs1171646528 1015 dbSNP
rs1469137780 1017 dbSNP
rs1422772676 1019 dbSNP
rs1174266696 1025 dbSNP
rs1172167990 1026 dbSNP
rs910859206 1032 dbSNP
rs942387712 1040 dbSNP
rs186372585 1043 dbSNP
rs1039221476 1044 dbSNP
rs958739408 1048 dbSNP
rs902099891 1054 dbSNP
rs372968498 1062 dbSNP
rs1276890508 1069 dbSNP
rs1221465686 1074 dbSNP
rs578235140 1083 dbSNP
rs1048399876 1085 dbSNP
rs1238146469 1085 dbSNP
rs545603445 1088 dbSNP
rs1352368017 1096 dbSNP
rs1332354268 1103 dbSNP
rs1447508928 1113 dbSNP
rs1357241161 1115 dbSNP
rs1006340522 1124 dbSNP
rs1325930548 1135 dbSNP
rs977327788 1142 dbSNP
rs925833834 1143 dbSNP
rs190963185 1145 dbSNP
rs1441049019 1146 dbSNP
rs986571704 1157 dbSNP
rs1302434101 1159 dbSNP
rs910553004 1164 dbSNP
rs371072315 1165 dbSNP
rs944812321 1174 dbSNP
rs1012258337 1176 dbSNP
rs1216106485 1179 dbSNP
rs1443341076 1187 dbSNP
rs12936744 1188 dbSNP
rs34423896 1202 dbSNP
rs919434810 1203 dbSNP
rs929418997 1206 dbSNP
rs971087245 1211 dbSNP
rs1198115121 1213 dbSNP
rs370092401 1214 dbSNP
rs888061383 1215 dbSNP
rs1002451739 1218 dbSNP
rs1055891693 1219 dbSNP
rs894127687 1224 dbSNP
rs1014433311 1225 dbSNP
rs34758615 1226 dbSNP
rs910972369 1228 dbSNP
rs942335288 1232 dbSNP
rs1403258391 1233 dbSNP
rs1415586281 1234 dbSNP
rs1475967464 1242 dbSNP
rs976856484 1245 dbSNP
rs1473358706 1248 dbSNP
rs923543036 1249 dbSNP
rs1489517244 1256 dbSNP
rs967188774 1258 dbSNP
rs998612744 1259 dbSNP
rs531639486 1262 dbSNP
rs772100981 1265 dbSNP
rs1165020459 1268 dbSNP
rs957323509 1275 dbSNP
rs1438063439 1276 dbSNP
rs866033764 1277 dbSNP
rs1276028155 1286 dbSNP
rs34589519 1290 dbSNP
rs760933249 1298 dbSNP
rs908015718 1300 dbSNP
rs564819020 1305 dbSNP
rs532201405 1310 dbSNP
rs1337732853 1311 dbSNP
rs976593133 1313 dbSNP
rs895241709 1318 dbSNP
rs1218183638 1322 dbSNP
rs34680771 1330 dbSNP
rs1165067226 1333 dbSNP
rs919306256 1337 dbSNP
rs547159342 1345 dbSNP
rs565782258 1347 dbSNP
rs145469398 1349 dbSNP
rs1049295711 1350 dbSNP
rs1337128017 1352 dbSNP
rs180912872 1353 dbSNP
rs1267324154 1354 dbSNP
rs938272766 1363 dbSNP
rs1055353206 1364 dbSNP
rs894150888 1367 dbSNP
rs1222633198 1375 dbSNP
rs949708202 1378 dbSNP
rs1255937914 1379 dbSNP
rs1220299926 1380 dbSNP
rs1448028466 1385 dbSNP
rs1300564008 1386 dbSNP
rs1045899607 1387 dbSNP
rs902975066 1388 dbSNP
rs998560269 1389 dbSNP
rs1293534294 1399 dbSNP
rs569597229 1405 dbSNP
rs1397741415 1406 dbSNP
rs1240660729 1409 dbSNP
rs1477301323 1426 dbSNP
rs1030935748 1429 dbSNP
rs892961257 1433 dbSNP
rs1431906842 1439 dbSNP
rs537035026 1445 dbSNP
rs1427363310 1447 dbSNP
rs1194278600 1451 dbSNP
rs1457362770 1454 dbSNP
rs1010701868 1455 dbSNP
rs1162106749 1459 dbSNP
rs1458063523 1461 dbSNP
rs1255155176 1462 dbSNP
rs1007904039 1466 dbSNP
rs1230979918 1469 dbSNP
rs1385609396 1479 dbSNP
rs1313823637 1481 dbSNP
rs1402335649 1483 dbSNP
rs1238877461 1485 dbSNP
rs556930734 1486 dbSNP
rs1315975567 1488 dbSNP
rs1311058133 1489 dbSNP
rs1447005529 1490 dbSNP
rs1397701057 1492 dbSNP
rs1017970163 1493 dbSNP
rs1160470061 1493 dbSNP
rs1174810534 1493 dbSNP
rs1180778867 1493 dbSNP
rs1185647150 1493 dbSNP
rs1198573166 1493 dbSNP
rs1215774170 1493 dbSNP
rs1240430375 1493 dbSNP
rs1255230404 1493 dbSNP
rs1280998270 1493 dbSNP
rs1287494671 1493 dbSNP
rs1302566689 1493 dbSNP
rs1310120269 1493 dbSNP
rs1314077000 1493 dbSNP
rs1339456868 1493 dbSNP
rs1350897865 1493 dbSNP
rs1368177699 1493 dbSNP
rs1378501763 1493 dbSNP
rs1391454480 1493 dbSNP
rs1394724424 1493 dbSNP
rs1419583703 1493 dbSNP
rs1419823714 1493 dbSNP
rs1439206011 1493 dbSNP
rs1454362215 1493 dbSNP
rs1484108242 1493 dbSNP
rs61493168 1493 dbSNP
rs71154970 1493 dbSNP
rs769720488 1493 dbSNP
rs780097269 1493 dbSNP
rs1017499955 1495 dbSNP
rs1415162331 1513 dbSNP
rs1294177023 1514 dbSNP
rs1192898632 1516 dbSNP
rs1487230949 1521 dbSNP
rs1357579022 1523 dbSNP
rs1242727033 1526 dbSNP
rs1264893744 1527 dbSNP
rs1352032993 1528 dbSNP
rs1287564923 1529 dbSNP
rs1207354111 1530 dbSNP
rs1282758079 1535 dbSNP
rs1488208128 1536 dbSNP
rs1212008721 1537 dbSNP
rs1259243128 1539 dbSNP
rs1473994444 1541 dbSNP
rs1186266080 1542 dbSNP
rs1294216760 1544 dbSNP
rs1363803871 1545 dbSNP
rs1300578024 1546 dbSNP
rs1382883988 1556 dbSNP
rs1390076695 1561 dbSNP
rs1161699497 1564 dbSNP
rs966447294 1565 dbSNP
rs1156812911 1578 dbSNP
rs976142234 1582 dbSNP
rs984679921 1584 dbSNP
rs907709708 1590 dbSNP
rs1265333618 1593 dbSNP
rs1435152623 1598 dbSNP
rs775353750 1602 dbSNP
rs1450591602 1605 dbSNP
rs1264596977 1608 dbSNP
rs1211267979 1610 dbSNP
rs950799558 1611 dbSNP
rs984859551 1617 dbSNP
rs1257014864 1621 dbSNP
rs1218480566 1625 dbSNP
rs909392839 1636 dbSNP
rs938167716 1638 dbSNP
rs1446438497 1640 dbSNP
rs1272475661 1645 dbSNP
rs762772321 1648 dbSNP
rs1228729434 1649 dbSNP
rs764147707 1650 dbSNP
rs949662449 1653 dbSNP
rs1045413022 1654 dbSNP
rs902839193 1657 dbSNP
rs1395570997 1659 dbSNP
rs984087676 1663 dbSNP
rs571949167 1671 dbSNP
rs1425480742 1682 dbSNP
rs908129198 1690 dbSNP
rs1477617984 1693 dbSNP
rs1375439875 1694 dbSNP
rs1241272218 1696 dbSNP
rs934441958 1698 dbSNP
rs1054106118 1701 dbSNP
rs1237227692 1705 dbSNP
rs892992885 1706 dbSNP
rs1196336461 1721 dbSNP
rs1353590746 1722 dbSNP
rs1037908337 1726 dbSNP
rs80075799 1727 dbSNP
rs1017845713 1729 dbSNP
rs948159758 1733 dbSNP
rs901796747 1735 dbSNP
rs1236681113 1737 dbSNP
rs1371780803 1747 dbSNP
rs879299422 1749 dbSNP
rs1046380062 1750 dbSNP
rs906503155 1750 dbSNP
rs999535463 1751 dbSNP
rs1199579714 1752 dbSNP
rs1250790325 1760 dbSNP
rs1174217110 1763 dbSNP
rs1052747076 1770 dbSNP
rs540555369 1772 dbSNP
rs1176425425 1774 dbSNP
rs1441082636 1776 dbSNP
rs554375085 1778 dbSNP
rs1026345322 1784 dbSNP
rs1439083807 1790 dbSNP
rs1183064572 1791 dbSNP
rs950665940 1795 dbSNP
rs1179018269 1798 dbSNP
rs1213619403 1803 dbSNP
rs1379636764 1813 dbSNP
rs572514020 1816 dbSNP
rs1010690514 1818 dbSNP
rs542711985 1818 dbSNP
rs1280353899 1825 dbSNP
rs984890554 1828 dbSNP
rs12948771 1829 dbSNP
rs1018086033 1830 dbSNP
rs1338459063 1833 dbSNP
rs1314668265 1839 dbSNP
rs1435213464 1848 dbSNP
rs1359350412 1850 dbSNP
rs140273198 1861 dbSNP
rs1420975027 1861 dbSNP
rs1408354261 1862 dbSNP
rs753776430 1864 dbSNP
rs959815029 1871 dbSNP
rs144059349 1879 dbSNP
rs1029434385 1880 dbSNP
rs1392970162 1881 dbSNP
rs1486248254 1885 dbSNP
rs918077651 1889 dbSNP
rs1263082791 1892 dbSNP
rs1214627652 1894 dbSNP
rs951082146 1896 dbSNP
rs1285277870 1908 dbSNP
rs1465350715 1924 dbSNP
rs1302558512 1937 dbSNP
rs1227903334 1941 dbSNP
rs1354028201 1945 dbSNP
rs1397447723 1947 dbSNP
rs1294824021 1948 dbSNP
rs543387224 1949 dbSNP
rs1393268578 1951 dbSNP
rs1339830232 1972 dbSNP
rs908118067 1974 dbSNP
rs963664852 1980 dbSNP
rs973550594 1982 dbSNP
rs1329342488 1983 dbSNP
rs949686478 1986 dbSNP
rs916780139 2002 dbSNP
rs1167621393 2003 dbSNP
rs761444876 2004 dbSNP
rs1423593986 2007 dbSNP
rs767027407 2012 dbSNP
rs78165198 2013 dbSNP
rs1054136796 2014 dbSNP
rs1235572657 2015 dbSNP
rs1450024024 2016 dbSNP
rs1275272743 2017 dbSNP
rs928077170 2019 dbSNP
rs914359418 2024 dbSNP
rs532237319 2033 dbSNP
rs1306103735 2036 dbSNP
rs540836087 2045 dbSNP
rs935321537 2048 dbSNP
rs755785965 2050 dbSNP
rs1216208630 2054 dbSNP
rs1310880742 2056 dbSNP
rs1362082822 2062 dbSNP
rs1232948514 2067 dbSNP
rs1292371017 2084 dbSNP
rs1251579048 2090 dbSNP
rs1326127523 2102 dbSNP
rs1340975809 2137 dbSNP
rs1423296658 2140 dbSNP
rs1052424946 2143 dbSNP
rs1196239568 2156 dbSNP
rs559236190 2163 dbSNP
rs146481855 2165 dbSNP
rs372062661 2171 dbSNP
rs186321351 2179 dbSNP
rs1477080629 2181 dbSNP
rs569718337 2190 dbSNP
rs997446745 2208 dbSNP
rs78005711 2220 dbSNP
rs1170857694 2227 dbSNP
rs1373880973 2228 dbSNP
rs1029794690 2229 dbSNP
rs1300489437 2237 dbSNP
rs755289164 2239 dbSNP
rs1372510281 2240 dbSNP
rs1303722451 2250 dbSNP
rs191230650 2256 dbSNP
rs1400027771 2257 dbSNP
rs539300720 2263 dbSNP
rs1016265754 2268 dbSNP
rs571885130 2269 dbSNP
rs539281546 2293 dbSNP
rs1012727836 2303 dbSNP
rs1025170720 2304 dbSNP
rs369506574 2307 dbSNP
rs1004284002 2312 dbSNP
rs1415324171 2312 dbSNP
rs971277921 2314 dbSNP
rs1248167037 2318 dbSNP
rs978334870 2319 dbSNP
rs566192518 2323 dbSNP
rs955716344 2324 dbSNP
rs1207873226 2329 dbSNP
rs1349461747 2336 dbSNP
rs1386584880 2339 dbSNP
rs989812970 2341 dbSNP
rs536835448 2343 dbSNP
rs1374268022 2355 dbSNP
rs1308687394 2357 dbSNP
rs1308892065 2366 dbSNP
rs1191709566 2375 dbSNP
rs914202688 2375 dbSNP
rs750554621 2381 dbSNP
rs943160115 2399 dbSNP
rs182824899 2402 dbSNP
rs973624079 2404 dbSNP
rs1377359358 2405 dbSNP
rs923146771 2418 dbSNP
rs1419160623 2427 dbSNP
rs1362348752 2430 dbSNP
rs1161524157 2452 dbSNP
rs933101886 2453 dbSNP
rs1419476979 2454 dbSNP
rs779429328 2465 dbSNP
rs1185712363 2469 dbSNP
rs1486576171 2472 dbSNP
rs1258117983 2474 dbSNP
rs1047684621 2482 dbSNP
rs1347884790 2483 dbSNP
rs1488091297 2494 dbSNP
rs748622447 2497 dbSNP
rs576098272 2498 dbSNP
rs1312378132 2500 dbSNP
rs1478934097 2501 dbSNP
rs141054944 2502 dbSNP
rs1423142537 2505 dbSNP
rs1462076533 2508 dbSNP
rs1382815144 2513 dbSNP
rs1167131874 2514 dbSNP
rs143184288 2523 dbSNP
rs1162597770 2537 dbSNP
rs988086650 2541 dbSNP
rs1418534730 2542 dbSNP
rs1457782054 2548 dbSNP
rs915212040 2553 dbSNP
rs1205359397 2555 dbSNP
rs946735708 2558 dbSNP
rs1289829835 2561 dbSNP
rs1039558963 2563 dbSNP
rs1231919882 2572 dbSNP
rs1398541561 2579 dbSNP
rs1337371089 2583 dbSNP
rs1294464350 2587 dbSNP
rs1012347819 2591 dbSNP
rs1025459087 2599 dbSNP
rs1297740667 2603 dbSNP
rs780467331 2614 dbSNP
rs933813919 2619 dbSNP
rs1462865791 2620 dbSNP
rs554667812 2620 dbSNP
rs970924607 2631 dbSNP
rs867991025 2632 dbSNP
rs1003993659 2636 dbSNP
rs1321053711 2644 dbSNP
rs1216341455 2645 dbSNP
rs187516045 2646 dbSNP
rs958304900 2647 dbSNP
rs553687905 2649 dbSNP
rs898141357 2651 dbSNP
rs1262769698 2653 dbSNP
rs777899306 2662 dbSNP
rs1475635238 2666 dbSNP
rs1274122141 2668 dbSNP
rs914254415 2669 dbSNP
rs372924605 2680 dbSNP
rs1338080442 2683 dbSNP
rs1272425465 2684 dbSNP
rs974521432 2704 dbSNP
rs1411638521 2712 dbSNP
rs573677809 2713 dbSNP
rs1443329359 2716 dbSNP
rs1160552643 2717 dbSNP
rs1407992611 2720 dbSNP
rs982669527 2730 dbSNP
rs541986538 2731 dbSNP
rs1035222204 2737 dbSNP
rs1392676021 2743 dbSNP
rs1195113250 2744 dbSNP
rs957103663 2745 dbSNP
rs563261972 2758 dbSNP
rs530588892 2763 dbSNP
rs1375717014 2764 dbSNP
rs1416173404 2767 dbSNP
rs1281938474 2775 dbSNP
rs1196839353 2776 dbSNP
rs1348946662 2776 dbSNP
rs34612576 2776 dbSNP
rs774264509 2776 dbSNP
rs1377887688 2777 dbSNP
rs1279187192 2782 dbSNP
rs552213548 2784 dbSNP
rs1309120677 2785 dbSNP
rs1329489753 2786 dbSNP
rs1395314560 2787 dbSNP
rs921179458 2788 dbSNP
rs975421009 2788 dbSNP
rs1434795474 2789 dbSNP
rs1379342983 2791 dbSNP
rs933048218 2793 dbSNP
rs1239196531 2796 dbSNP
rs771190738 2797 dbSNP
rs1280693850 2805 dbSNP
rs1156423831 2814 dbSNP
rs564025627 2827 dbSNP
rs983323680 2840 dbSNP
rs907691855 2846 dbSNP
rs941955032 2851 dbSNP
rs1212581231 2863 dbSNP
rs1256010002 2868 dbSNP
rs1037994566 2874 dbSNP
rs528093312 2887 dbSNP
rs542704085 2888 dbSNP
rs1482991863 2890 dbSNP
rs1177832166 2895 dbSNP
rs939854006 2899 dbSNP
rs1279857651 2901 dbSNP
rs190750065 2908 dbSNP
rs1038091826 2916 dbSNP
rs948012564 2921 dbSNP
rs1357523567 2928 dbSNP
rs1012585231 2950 dbSNP
rs1044091400 2956 dbSNP
rs1046485375 2959 dbSNP
rs1158424375 2962 dbSNP
rs1410638947 2973 dbSNP
rs73995955 2976 dbSNP
rs1190670882 2982 dbSNP
rs536464816 2982 dbSNP
rs1486054595 2987 dbSNP
rs1031157195 2992 dbSNP
rs183319803 2997 dbSNP
rs1331868488 3000 dbSNP
rs1241520111 3002 dbSNP
rs377120218 3003 dbSNP
rs1011173707 3005 dbSNP
rs1442326350 3007 dbSNP
rs7212204 3020 dbSNP
rs1009701069 3033 dbSNP
rs1374576086 3040 dbSNP
rs556613158 3045 dbSNP
rs1022330569 3046 dbSNP
rs968146223 3055 dbSNP
rs1360666112 3056 dbSNP
rs964415576 3060 dbSNP
rs1267842891 3061 dbSNP
rs1432273213 3071 dbSNP
rs1445878106 3077 dbSNP
rs1324772120 3086 dbSNP
rs558622532 3094 dbSNP
rs76896709 3095 dbSNP
rs761828471 3099 dbSNP
rs1217229407 3103 dbSNP
rs1276836730 3106 dbSNP
rs1419407255 3109 dbSNP
rs954468557 3110 dbSNP
rs983188011 3111 dbSNP
rs767003207 3113 dbSNP
rs1213245952 3129 dbSNP
rs1205352819 3136 dbSNP
rs1274745705 3141 dbSNP
rs1214261804 3142 dbSNP
rs986714025 3144 dbSNP
rs1240035531 3145 dbSNP
rs1270793267 3146 dbSNP
rs907722979 3153 dbSNP
rs941820905 3154 dbSNP
rs908458867 3156 dbSNP
rs867912148 3163 dbSNP
rs939827492 3171 dbSNP
rs1369254642 3172 dbSNP
rs1456834938 3174 dbSNP
rs1178627851 3176 dbSNP
rs973348492 3177 dbSNP
rs1458727512 3184 dbSNP
rs1354506875 3185 dbSNP
rs1168924021 3187 dbSNP
rs919657359 3193 dbSNP
rs1254173362 3195 dbSNP
rs1390820304 3195 dbSNP
rs948480352 3201 dbSNP
rs1452750225 3202 dbSNP
rs1171134284 3207 dbSNP
rs1424067380 3224 dbSNP
rs916452107 3227 dbSNP
rs17781472 3231 dbSNP
rs1480170194 3238 dbSNP
rs1049780284 3253 dbSNP
rs1231158049 3255 dbSNP
rs906842249 3257 dbSNP
rs1046853834 3278 dbSNP
rs1278909085 3286 dbSNP
rs1231419687 3306 dbSNP
rs1349680652 3313 dbSNP
rs188842373 3316 dbSNP
rs1387754080 3317 dbSNP
rs1372992104 3319 dbSNP
rs1326539551 3320 dbSNP
rs1056682994 3329 dbSNP
rs574649496 3331 dbSNP
rs1371261155 3336 dbSNP
rs1173160186 3337 dbSNP
rs935430013 3342 dbSNP
rs374526695 3343 dbSNP
rs376615995 3345 dbSNP
rs541675474 3348 dbSNP
rs1367179881 3350 dbSNP
rs1248105890 3364 dbSNP
rs1178887815 3379 dbSNP
rs1215326629 3380 dbSNP
rs1483373103 3381 dbSNP
rs1018437245 3383 dbSNP
rs1260221072 3385 dbSNP
rs1208149624 3389 dbSNP
rs900122321 3394 dbSNP
rs998430026 3396 dbSNP
rs1030031670 3397 dbSNP
rs954333222 3398 dbSNP
rs116716835 3403 dbSNP
rs1014644693 3406 dbSNP
rs1197205069 3417 dbSNP
rs1351719716 3418 dbSNP
rs192623859 3419 dbSNP
rs1413066934 3420 dbSNP
rs1377307788 3422 dbSNP
rs182582308 3426 dbSNP
rs59381361 3427 dbSNP
rs1161101160 3428 dbSNP
rs1472776739 3429 dbSNP
rs1420979114 3431 dbSNP
rs140399284 3436 dbSNP
rs982019771 3438 dbSNP
rs1256161810 3440 dbSNP
rs554077157 3442 dbSNP
rs1262119593 3451 dbSNP
rs753451445 3452 dbSNP
rs1218434320 3472 dbSNP
rs911193082 3475 dbSNP
rs973888630 3480 dbSNP
rs1293241763 3481 dbSNP
rs1231957842 3482 dbSNP
rs150184948 3484 dbSNP
rs771539035 3490 dbSNP
rs915359576 3501 dbSNP
rs946819387 3505 dbSNP
rs1383122016 3516 dbSNP
rs1290830029 3518 dbSNP
rs1401613557 3520 dbSNP
rs1393405467 3527 dbSNP
rs1280380318 3529 dbSNP
rs1462896227 3533 dbSNP
rs1368972175 3541 dbSNP
rs1191933473 3545 dbSNP
rs1426188735 3550 dbSNP
rs1338687324 3562 dbSNP
rs1188748268 3564 dbSNP
rs1465658205 3566 dbSNP
rs1218123491 3568 dbSNP
rs374581849 3569 dbSNP
rs899985085 3570 dbSNP
rs1266512406 3578 dbSNP
rs979835946 3581 dbSNP
rs1208640143 3591 dbSNP
rs1298034773 3598 dbSNP
rs188096333 3602 dbSNP
rs867041044 3603 dbSNP
rs890130820 3605 dbSNP
rs1323713407 3616 dbSNP
rs569960816 3617 dbSNP
rs1004519807 3619 dbSNP
rs1260624450 3624 dbSNP
rs1014593014 3625 dbSNP
rs537236943 3626 dbSNP
rs112088474 3628 dbSNP
rs1023899821 3632 dbSNP
rs570590638 3635 dbSNP
rs1453659214 3638 dbSNP
rs1195687761 3655 dbSNP
rs1268691136 3655 dbSNP
rs534732106 3656 dbSNP
rs553298551 3657 dbSNP
rs945662522 3658 dbSNP
rs969224075 3665 dbSNP
rs1347514673 3666 dbSNP
rs1301486931 3673 dbSNP
rs1438406341 3678 dbSNP
rs1331425971 3681 dbSNP
rs1328138449 3683 dbSNP
rs1389539521 3687 dbSNP
rs1308176989 3695 dbSNP
rs1284296405 3699 dbSNP
rs137866584 3700 dbSNP
rs1485722519 3700 dbSNP
rs34454185 3700 dbSNP
rs57107283 3700 dbSNP
rs1162660182 3702 dbSNP
rs1408587514 3704 dbSNP
rs1421341603 3711 dbSNP
rs1254588108 3715 dbSNP
rs1296072300 3716 dbSNP
rs1358865898 3718 dbSNP
rs1399571202 3719 dbSNP
rs1335089136 3720 dbSNP
rs77442767 3721 dbSNP
rs1278487451 3725 dbSNP
rs981995803 3730 dbSNP
rs927850488 3731 dbSNP
rs1187051068 3736 dbSNP
rs904007110 3741 dbSNP
rs191640807 3743 dbSNP
rs1352337159 3749 dbSNP
rs184151481 3750 dbSNP
rs531073207 3753 dbSNP
rs557292039 3760 dbSNP
rs1476240608 3768 dbSNP
rs1314332525 3771 dbSNP
rs946819878 3784 dbSNP
rs1039762648 3785 dbSNP
rs921452428 3790 dbSNP
rs1487767246 3798 dbSNP
rs1211234179 3800 dbSNP
rs753265015 3802 dbSNP
rs575553120 3803 dbSNP
rs546007673 3804 dbSNP
rs887394470 3805 dbSNP
rs557906124 3806 dbSNP
rs1036055512 3811 dbSNP
rs572859365 3814 dbSNP
rs980375108 3815 dbSNP
rs188843192 3816 dbSNP
rs928403381 3818 dbSNP
rs995010871 3820 dbSNP
rs1379519494 3821 dbSNP
rs1211506756 3822 dbSNP
rs1435100555 3823 dbSNP
rs1173412304 3828 dbSNP
rs1023343615 3843 dbSNP
rs1203208343 3852 dbSNP
rs78699170 3861 dbSNP
rs1394383599 3863 dbSNP
rs192228106 3865 dbSNP
rs1378302954 3868 dbSNP
rs776468430 3871 dbSNP
rs1353033239 3877 dbSNP
rs542549608 3880 dbSNP
rs563624152 3881 dbSNP
rs1325529733 3885 dbSNP
rs531037467 3897 dbSNP
rs1455995857 3900 dbSNP
rs1418577550 3902 dbSNP
rs1034813204 3903 dbSNP
rs956645339 3911 dbSNP
rs552325076 3913 dbSNP
rs988005001 3914 dbSNP
rs143090015 3926 dbSNP
rs185541840 3940 dbSNP
rs1473151821 3941 dbSNP
rs975906060 3944 dbSNP
rs921325505 3945 dbSNP
rs74430996 3951 dbSNP
rs987008831 3956 dbSNP
rs1332668812 3957 dbSNP
rs995513067 3961 dbSNP
rs1228444199 3962 dbSNP
rs908694172 3970 dbSNP
rs1268079758 3973 dbSNP
rs1436744614 3974 dbSNP
rs117990285 3982 dbSNP
rs1237457850 3984 dbSNP
rs147493250 3988 dbSNP
rs1440628156 3992 dbSNP
rs1454584599 3995 dbSNP
rs1348692104 3997 dbSNP
rs970420773 4006 dbSNP
rs190468637 4008 dbSNP
rs1038605622 4010 dbSNP
rs1451620774 4014 dbSNP
rs77820613 4014 dbSNP
rs746061182 4015 dbSNP
rs1466953294 4017 dbSNP
rs796132953 4029 dbSNP
rs930290600 4029 dbSNP
rs180720677 4030 dbSNP
rs185927087 4031 dbSNP
rs1172083864 4034 dbSNP
rs562505819 4042 dbSNP
rs572853735 4047 dbSNP
rs1229960675 4050 dbSNP
rs1034844502 4052 dbSNP
rs768627102 4054 dbSNP
rs968322209 4057 dbSNP
rs138473116 4063 dbSNP
rs1022174219 4064 dbSNP
rs555159885 4070 dbSNP
rs1303812964 4078 dbSNP
rs932924283 4091 dbSNP
rs867396793 4097 dbSNP
rs968461447 4098 dbSNP
rs975475300 4108 dbSNP
rs376828680 4115 dbSNP
rs189654290 4116 dbSNP
rs1431260561 4119 dbSNP
rs955468031 4121 dbSNP
rs543783622 4123 dbSNP
rs944220561 4128 dbSNP
rs1037083174 4132 dbSNP
rs897275848 4132 dbSNP
rs1279194073 4139 dbSNP
rs1220171235 4140 dbSNP
rs1231534912 4140 dbSNP
rs1303937930 4140 dbSNP
rs995503138 4140 dbSNP
rs1373299452 4144 dbSNP
rs1286977195 4147 dbSNP
rs1411765312 4151 dbSNP
rs1196180880 4156 dbSNP
rs200368770 4160 dbSNP
rs767190554 4160 dbSNP
rs1464682564 4168 dbSNP
rs905768683 4170 dbSNP
rs1488742116 4174 dbSNP
rs563660698 4191 dbSNP
rs531076210 4204 dbSNP
rs1418259654 4211 dbSNP
rs545998179 4226 dbSNP
rs974735850 4231 dbSNP
rs920222493 4239 dbSNP
rs1472633489 4243 dbSNP
rs1010033985 4255 dbSNP
rs1256121484 4261 dbSNP
rs1198214528 4269 dbSNP
rs564295181 4275 dbSNP
rs1211321977 4285 dbSNP
rs968461858 4290 dbSNP
rs1424566239 4291 dbSNP
rs1044758764 4301 dbSNP
rs528676200 4303 dbSNP
rs1168564149 4304 dbSNP
rs1292812310 4311 dbSNP
rs953091221 4318 dbSNP
rs986074098 4330 dbSNP
rs1303626133 4336 dbSNP
rs1295785549 4339 dbSNP
rs1389106492 4340 dbSNP
rs912819483 4353 dbSNP
rs904843712 4357 dbSNP
rs1161295252 4366 dbSNP
rs939117568 4371 dbSNP
rs1056118505 4377 dbSNP
rs892302815 4383 dbSNP
rs1341934904 4393 dbSNP
rs1184827256 4401 dbSNP
rs766557630 4402 dbSNP
rs1216287840 4403 dbSNP
rs1276945945 4404 dbSNP
rs1322273522 4408 dbSNP
rs143941305 4412 dbSNP
rs1037240165 4416 dbSNP
rs1464754108 4419 dbSNP
rs1266572208 4423 dbSNP
rs1210945044 4424 dbSNP
rs572278192 4426 dbSNP
rs918657527 4428 dbSNP
rs903809930 4432 dbSNP
rs1048525769 4448 dbSNP
rs1323514911 4449 dbSNP
rs997151111 4453 dbSNP
rs1339208113 4456 dbSNP
rs1313706209 4457 dbSNP
rs1381818842 4466 dbSNP
rs1028356453 4469 dbSNP
rs1264202545 4501 dbSNP
rs1001545849 4504 dbSNP
rs955332500 4517 dbSNP
rs1008316732 4518 dbSNP
rs1458999270 4523 dbSNP
rs765777436 4528 dbSNP
rs895767478 4531 dbSNP
rs1418963968 4538 dbSNP
rs1169335250 4541 dbSNP
rs1447334798 4547 dbSNP
rs1249468742 4554 dbSNP
rs1015651608 4571 dbSNP
rs1020101725 4572 dbSNP
rs749917091 4572 dbSNP
rs765158315 4572 dbSNP
rs1167573043 4575 dbSNP
rs1208501580 4593 dbSNP
rs961444876 4595 dbSNP
rs1489521659 4598 dbSNP
rs1266165472 4599 dbSNP
rs1227726894 4602 dbSNP
rs144342596 4606 dbSNP
rs1457738923 4607 dbSNP
rs1228886349 4614 dbSNP
rs1299142987 4619 dbSNP
rs148787685 4623 dbSNP
rs970364388 4633 dbSNP
rs987186525 4642 dbSNP
rs116478701 4645 dbSNP
rs1427252790 4654 dbSNP
rs965640236 4663 dbSNP
rs1168771475 4666 dbSNP
rs1450483114 4673 dbSNP
rs181186230 4679 dbSNP
rs938981889 4682 dbSNP
rs1268667414 4691 dbSNP
rs1204600948 4698 dbSNP
rs1277043409 4700 dbSNP
rs1056150241 4704 dbSNP
rs913688923 4705 dbSNP
rs75391475 4707 dbSNP
rs752631640 4709 dbSNP
rs1331675499 4710 dbSNP
rs1229507095 4715 dbSNP
rs1043592082 4721 dbSNP
rs185836485 4734 dbSNP
rs996791419 4736 dbSNP
rs1371794267 4742 dbSNP
rs984575183 4749 dbSNP
rs1050065909 4763 dbSNP
rs1399576431 4765 dbSNP
rs891137516 4766 dbSNP
rs1240644533 4773 dbSNP
rs1479203471 4790 dbSNP
rs1008264357 4797 dbSNP
rs937332963 4802 dbSNP
rs566698407 4803 dbSNP
rs1347917633 4810 dbSNP
rs1015599365 4814 dbSNP
rs1471670199 4829 dbSNP
rs1254011363 4835 dbSNP
rs1182963611 4837 dbSNP
rs1487177003 4845 dbSNP
rs1057174553 4853 dbSNP
rs1345380458 4856 dbSNP
rs961476074 4861 dbSNP
rs1335720069 4866 dbSNP
rs1338398823 4866 dbSNP
rs1446652270 4866 dbSNP
rs377027288 4866 dbSNP
rs67929884 4866 dbSNP
rs72306555 4866 dbSNP
rs1483645878 4869 dbSNP
rs1012397902 4885 dbSNP
rs1254722804 4886 dbSNP
rs1444489720 4887 dbSNP
rs533726734 4891 dbSNP
rs1159104900 4892 dbSNP
rs1456160769 4893 dbSNP
rs1159640474 4894 dbSNP
rs1382615697 4895 dbSNP
rs1418250510 4896 dbSNP
rs1157719915 4897 dbSNP
rs945937385 4898 dbSNP
rs755231257 4910 dbSNP
rs1235957482 4917 dbSNP
rs995983282 4919 dbSNP
rs567057148 4920 dbSNP
rs970607340 4926 dbSNP
rs781228568 4929 dbSNP
rs1447354225 4930 dbSNP
rs1331230415 4932 dbSNP
rs888909013 4943 dbSNP
rs1227260512 4953 dbSNP
rs1353568530 4954 dbSNP
rs1285627471 4955 dbSNP
rs1448241192 4958 dbSNP
rs571096623 4959 dbSNP
rs753068880 4960 dbSNP
rs61612827 4962 dbSNP
rs1239128587 4964 dbSNP
rs1283846950 4967 dbSNP
rs1411667271 4976 dbSNP
rs764687077 4976 dbSNP
rs972958951 4978 dbSNP
rs751976363 4979 dbSNP
rs372428934 4987 dbSNP
rs547289046 4993 dbSNP
rs1186509362 4997 dbSNP
rs1466045060 4999 dbSNP
rs945177278 5000 dbSNP
rs555692871 5002 dbSNP
rs1254265535 5003 dbSNP
rs1291466670 5004 dbSNP
rs757403199 5013 dbSNP
rs575541632 5016 dbSNP
rs925140243 5023 dbSNP
rs932439671 5024 dbSNP
rs1049580190 5027 dbSNP
rs1438282405 5030 dbSNP
rs891086234 5032 dbSNP
rs1425473014 5033 dbSNP
rs1008128661 5034 dbSNP
rs150713046 5039 dbSNP
rs1325653606 5051 dbSNP
rs1173364192 5052 dbSNP
rs937466928 5058 dbSNP
rs139130468 5064 dbSNP
rs573410042 5066 dbSNP
rs144036988 5068 dbSNP
rs1186869255 5069 dbSNP
rs562235048 5071 dbSNP
rs9907227 5082 dbSNP
rs946051404 5091 dbSNP
rs1390506887 5102 dbSNP
rs1041579598 5105 dbSNP
rs1477023311 5108 dbSNP
rs1248380919 5109 dbSNP
rs925905795 5110 dbSNP
rs935830096 5111 dbSNP
rs1272045945 5113 dbSNP
rs1374502304 5114 dbSNP
rs756409715 5118 dbSNP
rs1050296006 5124 dbSNP
rs190505488 5125 dbSNP
rs1296801500 5131 dbSNP
rs1002143868 5133 dbSNP
rs1035818722 5134 dbSNP
rs1275152887 5138 dbSNP
rs888848866 5139 dbSNP
rs1405637245 5145 dbSNP
rs1368588391 5148 dbSNP
rs1221209925 5149 dbSNP
rs1008619875 5151 dbSNP
rs1276768434 5155 dbSNP
rs551006943 5156 dbSNP
rs747996220 5157 dbSNP
rs562912540 5158 dbSNP
rs749789985 5159 dbSNP
rs1474904079 5163 dbSNP
rs897456806 5175 dbSNP
rs1471995559 5179 dbSNP
rs993171191 5179 dbSNP
rs1183683566 5184 dbSNP
rs1483199334 5184 dbSNP
rs1255042553 5186 dbSNP
rs1204277248 5192 dbSNP
rs533362968 5194 dbSNP
rs551728810 5196 dbSNP
rs556237774 5197 dbSNP
rs779551772 5203 dbSNP
rs1477872703 5204 dbSNP
rs1006117119 5205 dbSNP
rs183113952 5208 dbSNP
rs1302422379 5214 dbSNP
rs9915918 5216 dbSNP
rs1177093439 5217 dbSNP
rs917337258 5220 dbSNP
rs967342916 5228 dbSNP
rs770532523 5231 dbSNP
rs1160824884 5232 dbSNP
rs1324110974 5250 dbSNP
rs567356785 5252 dbSNP
rs537506828 5254 dbSNP
rs776117669 5255 dbSNP
rs985313325 5259 dbSNP
rs1179713989 5264 dbSNP
rs1433992069 5271 dbSNP
rs912386416 5283 dbSNP
rs943948054 5290 dbSNP
rs925853396 5302 dbSNP
rs935961314 5310 dbSNP
rs1050786773 5312 dbSNP
rs1230316236 5320 dbSNP
rs1273347550 5321 dbSNP
rs1394460851 5352 dbSNP
rs1381585798 5367 dbSNP
rs1036926260 5370 dbSNP
rs944540999 5371 dbSNP
rs1345067836 5379 dbSNP
rs542729379 5387 dbSNP
rs1453898358 5390 dbSNP
rs931273259 5391 dbSNP
rs1367332662 5392 dbSNP
rs1162068817 5403 dbSNP
rs1280105482 5403 dbSNP
rs1425230353 5404 dbSNP
rs746464075 5416 dbSNP
rs1040113889 5418 dbSNP
rs897615116 5424 dbSNP
rs1246730487 5446 dbSNP
rs1048382572 5452 dbSNP
rs111466696 5455 dbSNP
rs140908308 5456 dbSNP
rs538222657 5464 dbSNP
rs1264986110 5469 dbSNP
rs1001557447 5472 dbSNP
rs187196625 5475 dbSNP
rs888684033 5486 dbSNP
rs1291176399 5498 dbSNP
rs1005776586 5519 dbSNP
rs1227407895 5522 dbSNP
rs573420715 5523 dbSNP
rs958865730 5524 dbSNP
rs895961544 5530 dbSNP
rs1010464932 5535 dbSNP
rs540827139 5536 dbSNP
rs1020456805 5544 dbSNP
rs1024341226 5545 dbSNP
rs968987016 5547 dbSNP
rs1458984725 5559 dbSNP
rs979545227 5570 dbSNP
rs1488374859 5578 dbSNP
rs1195230343 5585 dbSNP
rs1420910652 5586 dbSNP
rs1474791595 5590 dbSNP
rs967458832 5592 dbSNP
rs1163814375 5601 dbSNP
rs562104006 5602 dbSNP
rs925925445 5605 dbSNP
rs1031986792 5614 dbSNP
rs953956968 5616 dbSNP
rs1490843563 5620 dbSNP
rs1415849277 5628 dbSNP
rs957620726 5633 dbSNP
rs986026406 5634 dbSNP
rs112936975 5645 dbSNP
rs985178105 5645 dbSNP
rs944548612 5654 dbSNP
rs975954719 5659 dbSNP
rs1299034407 5661 dbSNP
rs918992908 5665 dbSNP
rs1345550157 5670 dbSNP
rs912417740 5671 dbSNP
rs1324832415 5673 dbSNP
rs1371987966 5690 dbSNP
rs554678524 5697 dbSNP
rs1462799570 5698 dbSNP
rs544766086 5706 dbSNP
rs972653539 5710 dbSNP
rs1481474261 5711 dbSNP
rs1048859030 5713 dbSNP
rs1359026209 5722 dbSNP
rs1226965680 5723 dbSNP
rs1275363401 5726 dbSNP
rs918534091 5730 dbSNP
rs937679999 5731 dbSNP
rs1254207088 5732 dbSNP
rs1354847512 5734 dbSNP
rs1218421559 5735 dbSNP
rs931245021 5745 dbSNP
rs1260548403 5746 dbSNP
rs1287203549 5747 dbSNP
rs1407446495 5753 dbSNP
rs1352008175 5758 dbSNP
rs1329043341 5769 dbSNP
rs1056040100 5779 dbSNP
rs62071643 5793 dbSNP
rs1239166891 5796 dbSNP
rs1471731894 5797 dbSNP
rs1471268062 5810 dbSNP
rs1162714590 5814 dbSNP
rs775078477 5815 dbSNP
rs1471618354 5817 dbSNP
rs1234822101 5818 dbSNP
rs370652403 5819 dbSNP
rs1441654544 5827 dbSNP
rs1253875096 5828 dbSNP
rs1205295864 5833 dbSNP
rs903374156 5836 dbSNP
rs998873118 5838 dbSNP
rs1057122617 5840 dbSNP
rs867995517 5850 dbSNP
rs896004116 5855 dbSNP
rs1279800286 5857 dbSNP
rs73355064 5863 dbSNP
rs1381749091 5868 dbSNP
rs1334836117 5869 dbSNP
rs1454908558 5871 dbSNP
rs986571667 5873 dbSNP
rs149709128 5876 dbSNP
rs764341044 5881 dbSNP
rs904813941 5882 dbSNP
rs752162804 5884 dbSNP
rs1451170562 5886 dbSNP
rs1410189191 5887 dbSNP
rs1314958211 5896 dbSNP
rs1472615040 5902 dbSNP
rs560418388 5905 dbSNP
rs527546493 5907 dbSNP
rs919065830 5910 dbSNP
rs1185251991 5916 dbSNP
rs540077538 5919 dbSNP
rs796702223 5925 dbSNP
rs1000446017 5926 dbSNP
rs757697495 5935 dbSNP
rs768069831 5948 dbSNP
rs549169964 5953 dbSNP
rs1284396009 5966 dbSNP
rs560352892 5975 dbSNP
rs1349454921 5981 dbSNP
rs1200539872 5983 dbSNP
rs1280061993 5986 dbSNP
rs191990992 5996 dbSNP
rs576124913 5997 dbSNP
rs965110940 6005 dbSNP
rs972584700 6011 dbSNP
rs549491455 6012 dbSNP
rs1429298006 6013 dbSNP
rs1347430528 6015 dbSNP
rs950272788 6017 dbSNP
rs1045980321 6018 dbSNP
rs1363954120 6018 dbSNP
rs184208154 6019 dbSNP
rs1389263051 6020 dbSNP
rs952771534 6032 dbSNP
rs561473553 6033 dbSNP
rs758264377 6034 dbSNP
rs927286837 6039 dbSNP
rs1173362654 6043 dbSNP
rs1033090691 6047 dbSNP
rs937317147 6054 dbSNP
rs1468267225 6060 dbSNP
rs1336702424 6063 dbSNP
rs1222711105 6066 dbSNP
rs553445290 6071 dbSNP
rs917356933 6072 dbSNP
rs1213175276 6080 dbSNP
rs1364772622 6082 dbSNP
rs1271223285 6087 dbSNP
rs1018052751 6089 dbSNP
rs946134807 6092 dbSNP
rs756901805 6098 dbSNP
rs966049154 6098 dbSNP
rs1026241365 6099 dbSNP
rs950520672 6099 dbSNP
rs1411396956 6100 dbSNP
rs1420147328 6104 dbSNP
rs1190514129 6107 dbSNP
rs1476769667 6107 dbSNP
rs1199467321 6109 dbSNP
rs187585037 6109 dbSNP
rs904656649 6111 dbSNP
rs1482561373 6114 dbSNP
rs544114259 6134 dbSNP
rs1202880036 6136 dbSNP
rs1309559490 6136 dbSNP
rs1274356594 6139 dbSNP
rs529211161 6144 dbSNP
rs556023806 6147 dbSNP
rs1219102826 6150 dbSNP
rs959411557 6153 dbSNP
rs990596558 6153 dbSNP
rs1405619644 6157 dbSNP
rs917549438 6160 dbSNP
rs770862638 6163 dbSNP
rs574313507 6170 dbSNP
rs1354851362 6174 dbSNP
rs1175066366 6198 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :::|||||   :|||||| 
Target 5' aucGUGCCAUU---GCACUCC- 3'
19 - 36
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000315332.2 | 3UTR | AGAUUGCGGUGAGCUGAGAUCGUGCCAUUGCACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10