miRTarBase - #MIRT665359 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol XKR4   
Synonyms XRG4
Description XK related 4
Transcript NM_052898   
Expression
Putative miRNA Targets on XKR4
3'UTR of XKR4
(miRNA target sites are highlighted)
>XKR4|NM_052898|3'UTR
   1 AGCAAAAGGAGTTGCAGGACCCACAACATCCAGATGAAGGGGTGACAGCAGGGCTGTGGCCATAATGACACTTCATCCTA
  81 GAGCAGGGCAGTGAGCCGTGAAGTTCCTAGTGGGACCGTCATCACCATTATCATTTGATCCTGTCGGCTGGGGGCGGCTG
 161 GTCTCCTTCCAAAGCAGCTGCACCCGAGAGTCTCTGACTCCACCTGAAAGAATGACGCTGGCTTAATAGGACTCTCCATT
 241 GCTACCAAACTCCTCCTGCACGGTCTTGGGTGCACCCACCAGAGGGTACTACTATTATGGAAAAATTTTGCCTCCAATCA
 321 TTAGGGTGTCTTGATGGCGTTAACTGATCTTTCCATAAAAATAGATTCAGTCATACACACATACACACACTAACACACAT
 401 AAGTTACACCAGTCCTCTGTCAAAAAAGCTTAGGTGACTTTTCTTGATGCAAAGCTCTGATTCCCACAGGAATATAAAAA
 481 CAAAGAAAGAGGGAAACATCCCTCGAGAAAAAAAATAGTATTGCTTAGAAAAGAAACCATTTTCTCATTTGGAAATCCAT
 561 ACCATGTGTGAAAATCCTATCCAACGGACAGCAAACCCAAATGTTGTCTACACATGTGTTAGCATTGATGGAGTGGTTCA
 641 TTTTCTACACATTTCAGGATTTGTTTTATATTTTAAATTTTCAGTTGCGAACATCCTTTTTGACAGAAATCCTATGCAGC
 721 CCATGTACGGCTTTCAACAAGACCAAGGAGCTCAATAACTTCATGATGTAAATTAAATAGTAATCATGATTCAGTATTCA
 801 ATTGCAAAAATGTAACAGGTACACAAAGAGGAAGTGGGGAAAAAGGCAAAATGAGAGTCTGATTCCCAGGCATGTGCAGC
 881 GCCCATTGGGACATAACGGCAGTGCGGCGCGAGCCAGAGGAATGGGCTGGAACCGGATCTGTTTCCAGACGCAGAATGAG
 961 TGGCTCTGTGTGACCATAGGCAGATGCTGACTCTGGAAGACTCCGTGCCACTCCTTTCTAGTGCCAAACACCATCCAACC
1041 ACAGGACTGACGTGGAAGCCCCAAACAACTGAGAATGAGTGGCATGAGCCCCCTAAAAGCAGGCGAGAGAACGAGCAATC
1121 AAGTTCTCCACTGTGTACAGACTTTTCCTCCCCCCAATCCAAGGTCAAAGTGATGTGTCTTTTAGAGGCTTTGGGACACT
1201 TTTTAGTAAGTATGAGCAGACAAATGCAATGAATATGCTATGAAAAAACCCTTCTGAACTGAGAGAGGGCTTATCACTAT
1281 ATCCAGCTAAGATTTGTATTTGAATCATCTGTAAAGTCGCACTCTTACAACAAGCTTCTGGGTTTTAAATACCTCCGTAC
1361 AGCAAGTAAACGTTCCCCGCTTTCTGTTCTCAGTGTCCTCGGTCATGGTGCTTTTCGTTGCATTAAAAGTGCCGGTCAAA
1441 CTTTGATAGTATTTTTTTATAGTTGGTGCAGAGTGGAATAACTCATGGATTATTTCAATATTTTTGTAATAAAAAATATA
1521 GGGTATACACATAGGCATCATCACATTTTTTATAGACCTGGAATCGTTTAAAATACTTTAAGCATCATAATTACTTGGGA
1601 TGTCAGAAACTGGTCCACAAATTCCATCAGCCTGCCTCAGCAGATTGAAAACATTTGTCTCTTGCAAGATCACCCTACTT
1681 TGCAAGTTGGTGCCCCCAGGAACCTGGCCAGGGGTGCTATCAGAATATCAGGTGAAGAGAGAATCAGCTTAAATAGAAAG
1761 GGCTTGTCAAGACTGGCCAATGTTTCCCAGGAAATCAAAGATGTAAATGATTACTTTCATCCATCCATTATAACAAACCT
1841 GACCACAGTGGAAGCTGTCTTAAACTTCCTTCCCTGGTTTTATATTAACCCAACTGATAGATTAAGTATTAGTCAAACCA
1921 CTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               :||||  | |||||:| 
Target 5' ctgtgGCCATAATGACACTTCa 3'
54 - 75 141.00 -14.80
2
miRNA  3' guuuGUGGUAAC-A--GUGUGAGGu 5'
              | |||||| |  || ||||| 
Target 5' gactCTCCATTGCTACCAAACTCCt 3'
230 - 254 132.00 -15.10
3
miRNA  3' guUUGUGG---UAACAGUGUGAGGu 5'
            | ||:|   |  |||:|||||: 
Target 5' gaATCATCTGTAAAGTCGCACTCTt 3'
1302 - 1326 128.00 -16.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30193343 7 COSMIC
COSN30463880 9 COSMIC
COSN30148239 10 COSMIC
COSN30483915 19 COSMIC
COSN30525981 22 COSMIC
COSN30170676 23 COSMIC
COSN30502837 41 COSMIC
COSN29403344 52 COSMIC
COSN27005287 61 COSMIC
COSN31487756 78 COSMIC
COSN8519151 90 COSMIC
COSN14347341 99 COSMIC
COSN30496911 118 COSMIC
COSN19671486 126 COSMIC
COSN30527838 151 COSMIC
COSN21966920 156 COSMIC
COSN26437889 217 COSMIC
COSN5684090 340 COSMIC
COSN32063203 472 COSMIC
COSN15660663 508 COSMIC
COSN16160411 648 COSMIC
COSN31557692 665 COSMIC
COSN31482411 689 COSMIC
COSN28680928 698 COSMIC
COSN24302732 729 COSMIC
COSN24302654 807 COSMIC
COSN31520720 822 COSMIC
COSN28744452 881 COSMIC
COSN31535880 899 COSMIC
COSN19578885 910 COSMIC
COSN31565705 1020 COSMIC
COSN26482130 1024 COSMIC
COSN31490313 1063 COSMIC
COSN31512902 1106 COSMIC
COSN17181905 1109 COSMIC
COSN17181951 1110 COSMIC
COSN9661139 1113 COSMIC
COSN28252133 1127 COSMIC
COSN19655709 1151 COSMIC
COSN31489255 1186 COSMIC
COSN31549132 1224 COSMIC
COSN30542985 1243 COSMIC
COSN29641082 1249 COSMIC
COSN8519152 1256 COSMIC
COSN31549139 1292 COSMIC
COSN30541371 1298 COSMIC
COSN505889 1347 COSMIC
COSN27325658 1357 COSMIC
COSN30083325 1373 COSMIC
COSN30176133 1387 COSMIC
COSN31596662 1452 COSMIC
COSN31606886 1461 COSMIC
COSN30165434 1511 COSMIC
COSN31517923 1521 COSMIC
COSN30176952 1587 COSMIC
COSN9661140 1615 COSMIC
COSN19656268 1626 COSMIC
COSN20479485 1701 COSMIC
COSN8091832 1710 COSMIC
COSN31483054 1722 COSMIC
COSN9661141 1757 COSMIC
COSN26596375 1781 COSMIC
COSN31544037 1795 COSMIC
COSN30539055 1861 COSMIC
COSN22039272 1874 COSMIC
COSN6699722 1889 COSMIC
COSN9661142 1901 COSMIC
COSN18816773 1930 COSMIC
COSN19229876 1959 COSMIC
COSN19163075 2002 COSMIC
COSN21567035 2011 COSMIC
COSN9661143 2033 COSMIC
COSN26416925 2139 COSMIC
COSN4940691 2170 COSMIC
COSN28382546 2182 COSMIC
COSN20819809 2389 COSMIC
COSN26359136 2390 COSMIC
COSN9661144 2515 COSMIC
COSN19492625 2651 COSMIC
COSN4881281 2689 COSMIC
COSN29263719 2703 COSMIC
COSN26713705 2777 COSMIC
COSN22234787 2957 COSMIC
COSN25700785 3054 COSMIC
COSN26209912 3292 COSMIC
COSN16417771 3536 COSMIC
COSN2281012 3560 COSMIC
COSN19066175 3624 COSMIC
COSN25727370 3641 COSMIC
COSN25868414 3758 COSMIC
COSN8091833 3761 COSMIC
COSN19087970 3781 COSMIC
COSN9265404 3816 COSMIC
COSN27130887 3825 COSMIC
COSN21233554 3869 COSMIC
COSN20705558 3902 COSMIC
COSN21675774 3906 COSMIC
COSN17647541 4209 COSMIC
COSN29051480 4296 COSMIC
COSN2281013 4356 COSMIC
COSN24231073 4374 COSMIC
COSN20287996 4437 COSMIC
COSN5113175 4549 COSMIC
COSN17250179 4642 COSMIC
COSN2281014 4760 COSMIC
COSN25771121 4805 COSMIC
COSN25837745 4942 COSMIC
COSN18816774 5125 COSMIC
COSN20533671 5147 COSMIC
COSN30231721 5160 COSMIC
COSN19391778 5247 COSMIC
COSN6699724 5418 COSMIC
COSN23544338 5453 COSMIC
COSN5684092 5501 COSMIC
COSN21871006 5545 COSMIC
COSN22699423 5566 COSMIC
COSN17574402 5661 COSMIC
COSN17909214 5681 COSMIC
COSN9661145 5685 COSMIC
COSN21718780 5725 COSMIC
COSN23469436 5852 COSMIC
COSN23722968 5933 COSMIC
COSN23807400 5964 COSMIC
COSN24187969 6086 COSMIC
COSN2281015 6306 COSMIC
COSN21126172 6332 COSMIC
COSN21958571 6378 COSMIC
COSN21218081 6385 COSMIC
COSN27596440 6643 COSMIC
COSN8577678 6665 COSMIC
COSN16327162 7001 COSMIC
COSN2281016 7291 COSMIC
COSN9265405 7301 COSMIC
COSN8091834 7485 COSMIC
COSN7674199 7679 COSMIC
COSN15845157 7768 COSMIC
COSN6699725 7794 COSMIC
COSN6699726 7800 COSMIC
COSN5113176 7843 COSMIC
COSN6699727 7957 COSMIC
COSN5113177 8040 COSMIC
COSN21720884 8085 COSMIC
COSN18984267 8092 COSMIC
COSN23496995 8161 COSMIC
COSN29639213 8291 COSMIC
COSN8091835 8324 COSMIC
COSN8091836 8340 COSMIC
COSN16823907 8443 COSMIC
COSN2281017 8453 COSMIC
COSN16167709 8707 COSMIC
COSN26388311 8785 COSMIC
COSN9661148 8932 COSMIC
COSN15848729 8933 COSMIC
COSN9661149 8992 COSMIC
COSN26592160 9037 COSMIC
COSN26820279 9460 COSMIC
COSN15565529 9550 COSMIC
COSN6699728 9608 COSMIC
COSN16168547 9634 COSMIC
COSN135491 9638 COSMIC
COSN23271038 9675 COSMIC
COSN8091837 9735 COSMIC
COSN15939616 9771 COSMIC
COSN25736500 10044 COSMIC
COSN21599255 10178 COSMIC
COSN8091838 10308 COSMIC
COSN25291293 10324 COSMIC
COSN21194958 10387 COSMIC
COSN26291003 10424 COSMIC
COSN9460111 10447 COSMIC
COSN22631359 10517 COSMIC
COSN17963419 10546 COSMIC
COSN27226202 10553 COSMIC
COSN29340655 10581 COSMIC
COSN18955045 10658 COSMIC
COSN22527345 10683 COSMIC
COSN20362806 10895 COSMIC
COSN17911213 10904 COSMIC
COSN5684093 10935 COSMIC
COSN32080640 11000 COSMIC
COSN18867252 11001 COSMIC
COSN17797228 11408 COSMIC
COSN2281018 11415 COSMIC
COSN21663695 11431 COSMIC
COSN2281019 11575 COSMIC
COSN9661150 11612 COSMIC
COSN2281020 11690 COSMIC
COSN8091839 11789 COSMIC
COSN20887118 11959 COSMIC
COSN29662531 12164 COSMIC
COSN8091840 12215 COSMIC
COSN24955486 12325 COSMIC
COSN30049018 12344 COSMIC
COSN2281021 12382 COSMIC
COSN15713865 12412 COSMIC
COSN21966921 12517 COSMIC
COSN16199095 12531 COSMIC
COSN9265406 12540 COSMIC
COSN24542702 12569 COSMIC
COSN27339142 12797 COSMIC
COSN14731551 12819 COSMIC
COSN27689057 12960 COSMIC
COSN1366149 12986 COSMIC
COSN21010295 13048 COSMIC
COSN2281022 13223 COSMIC
COSN21170677 13667 COSMIC
COSN2281023 13691 COSMIC
COSN2281024 13769 COSMIC
COSN24710609 13799 COSMIC
COSN22654002 14060 COSMIC
COSN22829659 14077 COSMIC
COSN22395584 14139 COSMIC
COSN2281025 14199 COSMIC
COSN4881282 14276 COSMIC
COSN17363877 14315 COSMIC
COSN5684096 14387 COSMIC
COSN9265407 14673 COSMIC
COSN22030254 14682 COSMIC
COSN17292052 14787 COSMIC
COSN2281026 14838 COSMIC
COSN28424007 15028 COSMIC
COSN24620391 15564 COSMIC
COSN7674200 15575 COSMIC
COSN5684097 15623 COSMIC
COSN6699730 15734 COSMIC
COSN8091841 15734 COSMIC
COSN21870453 15804 COSMIC
COSN28476334 16000 COSMIC
COSN17702521 16133 COSMIC
COSN26845151 16333 COSMIC
COSN21771481 16367 COSMIC
COSN18904398 16391 COSMIC
COSN29079258 16410 COSMIC
COSN21078424 16535 COSMIC
COSN19514612 16574 COSMIC
COSN16620171 16782 COSMIC
COSN29978699 16952 COSMIC
COSN15181666 17024 COSMIC
COSN27442517 17203 COSMIC
COSN17790552 17206 COSMIC
COSN23728530 17346 COSMIC
COSN15088043 17349 COSMIC
COSN28982098 17811 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1213290167 9 dbSNP
rs751038148 10 dbSNP
rs767060432 11 dbSNP
rs749579418 14 dbSNP
rs1376623817 15 dbSNP
rs1199585289 17 dbSNP
rs1363325877 18 dbSNP
rs1468518335 20 dbSNP
rs1035657800 21 dbSNP
rs752547058 25 dbSNP
rs755794817 28 dbSNP
rs1460781921 31 dbSNP
rs367544968 34 dbSNP
rs371383249 35 dbSNP
rs1392353698 36 dbSNP
rs558357179 36 dbSNP
rs907952166 38 dbSNP
rs1327543787 41 dbSNP
rs1333527225 42 dbSNP
rs1237478557 43 dbSNP
rs749290088 50 dbSNP
rs1330220952 51 dbSNP
rs940546704 58 dbSNP
rs1199010846 59 dbSNP
rs575268940 60 dbSNP
rs952882538 64 dbSNP
rs1235553365 66 dbSNP
rs985606023 68 dbSNP
rs1286395687 73 dbSNP
rs867377182 75 dbSNP
rs544954292 78 dbSNP
rs565224060 82 dbSNP
rs761563042 84 dbSNP
rs80075820 86 dbSNP
rs767345443 88 dbSNP
rs996081364 91 dbSNP
rs774751472 92 dbSNP
rs976158930 94 dbSNP
rs903545044 99 dbSNP
rs1467142812 104 dbSNP
rs530577916 116 dbSNP
rs1210970989 122 dbSNP
rs1269233279 129 dbSNP
rs1473117989 132 dbSNP
rs1461133783 133 dbSNP
rs923002783 139 dbSNP
rs1442020965 141 dbSNP
rs934314363 147 dbSNP
rs1000477402 150 dbSNP
rs550364359 154 dbSNP
rs956417091 155 dbSNP
rs77515995 156 dbSNP
rs1024398474 157 dbSNP
rs529753454 158 dbSNP
rs1281029603 160 dbSNP
rs1242367713 162 dbSNP
rs947241157 165 dbSNP
rs772445322 185 dbSNP
rs972074671 186 dbSNP
rs980404270 187 dbSNP
rs1454111657 198 dbSNP
rs1035002509 200 dbSNP
rs1385883466 202 dbSNP
rs952114657 204 dbSNP
rs1320452667 205 dbSNP
rs1458268727 206 dbSNP
rs984787913 214 dbSNP
rs907963273 217 dbSNP
rs773603063 218 dbSNP
rs940722716 222 dbSNP
rs1176637335 227 dbSNP
rs1472683284 228 dbSNP
rs1405713647 232 dbSNP
rs1458820575 233 dbSNP
rs975928559 237 dbSNP
rs923107471 238 dbSNP
rs931792199 251 dbSNP
rs1209474860 253 dbSNP
rs1468008545 256 dbSNP
rs1335814119 262 dbSNP
rs191796146 266 dbSNP
rs1286275005 277 dbSNP
rs1050396306 283 dbSNP
rs903764595 285 dbSNP
rs1355458281 286 dbSNP
rs1284405946 288 dbSNP
rs546320761 295 dbSNP
rs1247785303 299 dbSNP
rs1340649792 302 dbSNP
rs1362366191 306 dbSNP
rs1296179219 310 dbSNP
rs897181391 311 dbSNP
rs879651406 317 dbSNP
rs376469962 319 dbSNP
rs1347405875 324 dbSNP
rs1322152085 327 dbSNP
rs1440856134 330 dbSNP
rs1052015569 335 dbSNP
rs892227517 338 dbSNP
rs1013264593 339 dbSNP
rs1389806641 340 dbSNP
rs1027256664 347 dbSNP
rs538672320 350 dbSNP
rs907397895 362 dbSNP
rs1230828957 366 dbSNP
rs750343675 367 dbSNP
rs1450802497 371 dbSNP
rs1289496143 374 dbSNP
rs1002102611 375 dbSNP
rs1323319762 375 dbSNP
rs1202118443 379 dbSNP
rs1224489472 383 dbSNP
rs183622211 389 dbSNP
rs146542761 390 dbSNP
rs569545591 391 dbSNP
rs952236765 400 dbSNP
rs774622316 403 dbSNP
rs1363540875 406 dbSNP
rs1273568243 408 dbSNP
rs1204088599 410 dbSNP
rs984799305 416 dbSNP
rs538397745 420 dbSNP
rs923002895 422 dbSNP
rs554705964 431 dbSNP
rs1014907410 433 dbSNP
rs1411713473 439 dbSNP
rs1423208607 448 dbSNP
rs962141144 452 dbSNP
rs1170712631 464 dbSNP
rs1477636238 466 dbSNP
rs976192137 467 dbSNP
rs1247242175 468 dbSNP
rs923340135 481 dbSNP
rs1174051679 482 dbSNP
rs1481953931 482 dbSNP
rs1250612405 490 dbSNP
rs1402474446 491 dbSNP
rs1308714985 492 dbSNP
rs1275847393 494 dbSNP
rs931871850 499 dbSNP
rs1326426706 503 dbSNP
rs986328006 504 dbSNP
rs765740511 506 dbSNP
rs1425410743 508 dbSNP
rs202121882 508 dbSNP
rs1308836036 515 dbSNP
rs764716776 518 dbSNP
rs188167919 521 dbSNP
rs1052068620 522 dbSNP
rs369414045 538 dbSNP
rs753401516 539 dbSNP
rs1231540760 547 dbSNP
rs892155361 552 dbSNP
rs949044294 561 dbSNP
rs1429832491 564 dbSNP
rs1277044091 565 dbSNP
rs1046180475 566 dbSNP
rs1471480414 569 dbSNP
rs1346135084 577 dbSNP
rs574952953 580 dbSNP
rs1481382342 581 dbSNP
rs1214258835 586 dbSNP
rs534270566 590 dbSNP
rs574723951 591 dbSNP
rs778657568 595 dbSNP
rs1484094583 600 dbSNP
rs1205897885 601 dbSNP
rs1227140109 611 dbSNP
rs1289336956 614 dbSNP
rs1328869539 614 dbSNP
rs1057239502 616 dbSNP
rs1377180975 634 dbSNP
rs1001714183 637 dbSNP
rs1448846239 641 dbSNP
rs191883388 651 dbSNP
rs888043523 662 dbSNP
rs1489820214 663 dbSNP
rs1338598976 665 dbSNP
rs1200905606 676 dbSNP
rs1455539520 684 dbSNP
rs112982723 689 dbSNP
rs1159489590 690 dbSNP
rs1378045264 691 dbSNP
rs1048389360 692 dbSNP
rs143591798 705 dbSNP
rs1180980659 713 dbSNP
rs888705643 716 dbSNP
rs1244483028 718 dbSNP
rs577166370 723 dbSNP
rs752342446 729 dbSNP
rs1464806140 730 dbSNP
rs1269339288 731 dbSNP
rs1429847122 739 dbSNP
rs1301922966 741 dbSNP
rs546187760 742 dbSNP
rs962070550 751 dbSNP
rs1320366086 756 dbSNP
rs1312264185 760 dbSNP
rs1363167821 764 dbSNP
rs997920449 768 dbSNP
rs1385651326 781 dbSNP
rs1295434438 788 dbSNP
rs1434482303 808 dbSNP
rs1030417098 813 dbSNP
rs953551584 814 dbSNP
rs985993706 816 dbSNP
rs1326084737 820 dbSNP
rs150992549 829 dbSNP
rs373148819 831 dbSNP
rs758824775 835 dbSNP
rs1430411926 837 dbSNP
rs1455137975 838 dbSNP
rs979187312 846 dbSNP
rs988046078 848 dbSNP
rs998743450 852 dbSNP
rs1030101256 854 dbSNP
rs1448356133 858 dbSNP
rs955953747 859 dbSNP
rs1188862572 861 dbSNP
rs575515990 862 dbSNP
rs1229239067 869 dbSNP
rs1265269527 871 dbSNP
rs949094879 874 dbSNP
rs1046448370 876 dbSNP
rs1223731110 879 dbSNP
rs540529400 881 dbSNP
rs1272755662 885 dbSNP
rs1227756056 886 dbSNP
rs1211612308 887 dbSNP
rs1267931381 893 dbSNP
rs937730695 898 dbSNP
rs968346771 899 dbSNP
rs1405347900 904 dbSNP
rs560730623 905 dbSNP
rs140822944 907 dbSNP
rs887971327 910 dbSNP
rs546284070 912 dbSNP
rs1251462729 925 dbSNP
rs1428524315 927 dbSNP
rs1057336821 930 dbSNP
rs1173124955 936 dbSNP
rs1036652909 937 dbSNP
rs1490962129 938 dbSNP
rs918684818 950 dbSNP
rs1204760578 951 dbSNP
rs1253108838 955 dbSNP
rs1231185981 965 dbSNP
rs898038623 967 dbSNP
rs930008010 973 dbSNP
rs1048509144 974 dbSNP
rs868007354 976 dbSNP
rs1006884055 978 dbSNP
rs1382906749 981 dbSNP
rs1305774907 992 dbSNP
rs1030717746 997 dbSNP
rs953505534 1004 dbSNP
rs1299339645 1006 dbSNP
rs560236773 1012 dbSNP
rs1464107146 1021 dbSNP
rs1377553803 1029 dbSNP
rs1177861745 1030 dbSNP
rs1481608788 1031 dbSNP
rs1410261433 1044 dbSNP
rs998377784 1053 dbSNP
rs1438558816 1063 dbSNP
rs1008080658 1067 dbSNP
rs1198737920 1079 dbSNP
rs1032375369 1081 dbSNP
rs781087175 1089 dbSNP
rs1483008176 1091 dbSNP
rs1262422982 1092 dbSNP
rs957900756 1095 dbSNP
rs1325379141 1099 dbSNP
rs987931483 1101 dbSNP
rs531973850 1105 dbSNP
rs1238091565 1106 dbSNP
rs552156124 1113 dbSNP
rs1308779464 1114 dbSNP
rs971017328 1120 dbSNP
rs1400929405 1125 dbSNP
rs968377946 1133 dbSNP
rs769807318 1139 dbSNP
rs1034282084 1140 dbSNP
rs1158810786 1141 dbSNP
rs1400503353 1143 dbSNP
rs981815283 1143 dbSNP
rs1470721774 1150 dbSNP
rs1365757474 1154 dbSNP
rs569423767 1155 dbSNP
rs1423299548 1156 dbSNP
rs528479164 1158 dbSNP
rs1462559706 1162 dbSNP
rs548933686 1167 dbSNP
rs1436161220 1174 dbSNP
rs1266181611 1189 dbSNP
rs918457867 1198 dbSNP
rs1351204146 1200 dbSNP
rs1262100109 1212 dbSNP
rs1338815952 1213 dbSNP
rs1381620149 1217 dbSNP
rs1315075302 1222 dbSNP
rs1048649196 1223 dbSNP
rs1363565323 1226 dbSNP
rs1318325454 1228 dbSNP
rs909628314 1229 dbSNP
rs1265976819 1233 dbSNP
rs929790185 1238 dbSNP
rs942176758 1241 dbSNP
rs1161648545 1243 dbSNP
rs1206742162 1243 dbSNP
rs568650283 1244 dbSNP
rs182721073 1249 dbSNP
rs376324674 1274 dbSNP
rs909952142 1283 dbSNP
rs942696911 1285 dbSNP
rs1447332668 1294 dbSNP
rs998152634 1295 dbSNP
rs1040082221 1298 dbSNP
rs901433760 1308 dbSNP
rs1052002792 1309 dbSNP
rs1292054539 1311 dbSNP
rs1247530399 1312 dbSNP
rs1182642020 1323 dbSNP
rs889144149 1325 dbSNP
rs1253597533 1329 dbSNP
rs146650515 1332 dbSNP
rs1011009787 1333 dbSNP
rs1404735847 1343 dbSNP
rs1366356950 1353 dbSNP
rs1165766616 1359 dbSNP
rs1427877798 1362 dbSNP
rs1032429253 1373 dbSNP
rs1168595615 1376 dbSNP
rs893853226 1377 dbSNP
rs1009364372 1378 dbSNP
rs186685571 1379 dbSNP
rs970689612 1380 dbSNP
rs539423181 1385 dbSNP
rs1157571267 1387 dbSNP
rs982463487 1394 dbSNP
rs1481770606 1397 dbSNP
rs370714117 1402 dbSNP
rs1033590473 1405 dbSNP
rs959334654 1411 dbSNP
rs983746379 1413 dbSNP
rs1400272111 1417 dbSNP
rs1223265532 1419 dbSNP
rs1001162101 1420 dbSNP
rs909639698 1421 dbSNP
rs1313619610 1425 dbSNP
rs1408188813 1427 dbSNP
rs959733016 1430 dbSNP
rs939721259 1431 dbSNP
rs1329554152 1433 dbSNP
rs972243625 1435 dbSNP
rs1335236152 1436 dbSNP
rs919441633 1442 dbSNP
rs763216373 1449 dbSNP
rs993189653 1452 dbSNP
rs1174262753 1454 dbSNP
rs1025548765 1455 dbSNP
rs951219360 1461 dbSNP
rs933490642 1467 dbSNP
rs771845663 1472 dbSNP
rs1231969576 1474 dbSNP
rs1329643065 1475 dbSNP
rs1204528637 1477 dbSNP
rs1439116729 1487 dbSNP
rs1277092109 1509 dbSNP
rs1203629835 1511 dbSNP
rs556535884 1511 dbSNP
rs1052479984 1529 dbSNP
rs1285529924 1531 dbSNP
rs889373233 1533 dbSNP
rs943368241 1545 dbSNP
rs1372787321 1546 dbSNP
rs1053681014 1548 dbSNP
rs74583301 1552 dbSNP
rs893907080 1553 dbSNP
rs933993332 1558 dbSNP
rs1334574871 1560 dbSNP
rs1469196433 1561 dbSNP
rs545352870 1564 dbSNP
rs1249274479 1567 dbSNP
rs1009585026 1569 dbSNP
rs1417088696 1574 dbSNP
rs914130690 1580 dbSNP
rs946897720 1582 dbSNP
rs772992280 1584 dbSNP
rs1235200457 1593 dbSNP
rs1020978533 1601 dbSNP
rs1182470141 1605 dbSNP
rs1462109228 1610 dbSNP
rs906390250 1622 dbSNP
rs1207208298 1637 dbSNP
rs1473134306 1641 dbSNP
rs1175718216 1642 dbSNP
rs1225727973 1667 dbSNP
rs1043838329 1677 dbSNP
rs904281145 1683 dbSNP
rs1003372773 1688 dbSNP
rs576390651 1695 dbSNP
rs191451245 1710 dbSNP
rs374090222 1711 dbSNP
rs1034013857 1715 dbSNP
rs1303627059 1718 dbSNP
rs1451344461 1724 dbSNP
rs959282658 1733 dbSNP
rs1344427892 1738 dbSNP
rs867331476 1740 dbSNP
rs1055544211 1742 dbSNP
rs544076146 1743 dbSNP
rs1162300155 1758 dbSNP
rs961012919 1763 dbSNP
rs1309800795 1780 dbSNP
rs1245493320 1782 dbSNP
rs1350974134 1785 dbSNP
rs1013905233 1788 dbSNP
rs1026002376 1792 dbSNP
rs972505068 1794 dbSNP
rs560894312 1798 dbSNP
rs1299006956 1803 dbSNP
rs760547394 1807 dbSNP
rs922367572 1810 dbSNP
rs1291325215 1814 dbSNP
rs766361222 1822 dbSNP
rs987617715 1831 dbSNP
rs1313727834 1855 dbSNP
rs763807546 1878 dbSNP
rs1250378050 1883 dbSNP
rs1289173013 1896 dbSNP
rs72649516 1898 dbSNP
rs1053733858 1930 dbSNP
rs1162597451 1936 dbSNP
rs1254609238 1938 dbSNP
rs893833556 1940 dbSNP
rs1424715273 1947 dbSNP
rs540049352 1959 dbSNP
rs1191112230 1960 dbSNP
rs922690707 1961 dbSNP
rs1428394322 1965 dbSNP
rs1420870498 1968 dbSNP
rs1042486773 1970 dbSNP
rs1188585451 1987 dbSNP
rs1429754134 1988 dbSNP
rs1489981510 1989 dbSNP
rs376932255 1994 dbSNP
rs1268432393 1995 dbSNP
rs796950110 1998 dbSNP
rs988128241 1999 dbSNP
rs1249638744 2002 dbSNP
rs1435251955 2010 dbSNP
rs139089690 2011 dbSNP
rs532258217 2012 dbSNP
rs1177093647 2014 dbSNP
rs551856217 2014 dbSNP
rs1389730691 2015 dbSNP
rs562489405 2016 dbSNP
rs531363178 2017 dbSNP
rs1302113724 2018 dbSNP
rs1405139118 2019 dbSNP
rs1367080015 2026 dbSNP
rs1295891591 2027 dbSNP
rs1355622488 2035 dbSNP
rs1427920028 2035 dbSNP
rs1173240590 2036 dbSNP
rs7827845 2037 dbSNP
rs1428977184 2039 dbSNP
rs568811628 2043 dbSNP
rs143006957 2046 dbSNP
rs147027892 2047 dbSNP
rs1248687782 2055 dbSNP
rs1195297500 2063 dbSNP
rs1016847614 2064 dbSNP
rs961064749 2069 dbSNP
rs1200493410 2072 dbSNP
rs1014351460 2080 dbSNP
rs570823088 2084 dbSNP
rs539906141 2088 dbSNP
rs955118026 2095 dbSNP
rs1304508820 2103 dbSNP
rs138341076 2104 dbSNP
rs988059678 2109 dbSNP
rs185533614 2121 dbSNP
rs569709846 2122 dbSNP
rs964244856 2125 dbSNP
rs989721882 2127 dbSNP
rs1030172886 2128 dbSNP
rs915487284 2130 dbSNP
rs190554288 2131 dbSNP
rs1362263574 2133 dbSNP
rs1042355648 2135 dbSNP
rs1230159157 2138 dbSNP
rs1419715200 2147 dbSNP
rs988548202 2149 dbSNP
rs1181850404 2150 dbSNP
rs1459881501 2151 dbSNP
rs1262438878 2156 dbSNP
rs149648220 2168 dbSNP
rs939425983 2172 dbSNP
rs1055599125 2175 dbSNP
rs1237932587 2187 dbSNP
rs1336002187 2197 dbSNP
rs1310735485 2213 dbSNP
rs1489685126 2215 dbSNP
rs1382684696 2226 dbSNP
rs1338025574 2228 dbSNP
rs750333213 2230 dbSNP
rs895008221 2232 dbSNP
rs1005380569 2236 dbSNP
rs1383308591 2240 dbSNP
rs1158383114 2252 dbSNP
rs1247650917 2261 dbSNP
rs1454458743 2265 dbSNP
rs1365775399 2267 dbSNP
rs1447960833 2270 dbSNP
rs1038334014 2282 dbSNP
rs1390918455 2284 dbSNP
rs926861638 2297 dbSNP
rs114718582 2299 dbSNP
rs1162629521 2304 dbSNP
rs993842192 2313 dbSNP
rs1029302248 2321 dbSNP
rs193152831 2322 dbSNP
rs916995067 2323 dbSNP
rs553951066 2329 dbSNP
rs1319562248 2332 dbSNP
rs576999542 2337 dbSNP
rs1243114978 2341 dbSNP
rs545861518 2344 dbSNP
rs1358167037 2345 dbSNP
rs1362755298 2348 dbSNP
rs1046845356 2351 dbSNP
rs1436897037 2358 dbSNP
rs1297841957 2365 dbSNP
rs1018429003 2366 dbSNP
rs16921969 2373 dbSNP
rs1226070645 2379 dbSNP
rs1424076728 2396 dbSNP
rs989607483 2400 dbSNP
rs1165586265 2401 dbSNP
rs567840554 2412 dbSNP
rs780055059 2415 dbSNP
rs1371267367 2416 dbSNP
rs1192189675 2417 dbSNP
rs1038312665 2423 dbSNP
rs1264853036 2429 dbSNP
rs966902946 2432 dbSNP
rs978513792 2436 dbSNP
rs1291805200 2439 dbSNP
rs928009816 2444 dbSNP
rs939334001 2447 dbSNP
rs1337945512 2451 dbSNP
rs757801393 2455 dbSNP
rs1270197528 2457 dbSNP
rs185283742 2458 dbSNP
rs1267955439 2460 dbSNP
rs1281582701 2466 dbSNP
rs188485865 2475 dbSNP
rs1325529228 2481 dbSNP
rs1408344796 2483 dbSNP
rs1394227805 2484 dbSNP
rs941177159 2494 dbSNP
rs528007382 2497 dbSNP
rs1475601253 2501 dbSNP
rs1425452876 2504 dbSNP
rs1197038808 2505 dbSNP
rs1479871873 2520 dbSNP
rs1269163013 2540 dbSNP
rs1248831626 2545 dbSNP
rs1038175509 2554 dbSNP
rs1472520324 2560 dbSNP
rs1180128341 2562 dbSNP
rs1029457158 2564 dbSNP
rs897087984 2573 dbSNP
rs547807520 2574 dbSNP
rs1415876772 2578 dbSNP
rs1320664585 2582 dbSNP
rs1051435665 2591 dbSNP
rs890826641 2592 dbSNP
rs1006962066 2598 dbSNP
rs181093816 2604 dbSNP
rs530279494 2606 dbSNP
rs1335287738 2622 dbSNP
rs968047054 2633 dbSNP
rs892851802 2637 dbSNP
rs76971213 2638 dbSNP
rs185481201 2639 dbSNP
rs1445183280 2643 dbSNP
rs959616791 2651 dbSNP
rs1285515415 2656 dbSNP
rs1425416710 2658 dbSNP
rs1192618158 2661 dbSNP
rs1468132330 2665 dbSNP
rs966829594 2668 dbSNP
rs1181935424 2672 dbSNP
rs1459439572 2677 dbSNP
rs1261883359 2679 dbSNP
rs1234492175 2697 dbSNP
rs1203415702 2699 dbSNP
rs144382777 2706 dbSNP
rs77601205 2707 dbSNP
rs1350258039 2708 dbSNP
rs1280150797 2714 dbSNP
rs1449093151 2721 dbSNP
rs1379021099 2729 dbSNP
rs576660955 2729 dbSNP
rs1451618631 2733 dbSNP
rs746408919 2739 dbSNP
rs1178008835 2740 dbSNP
rs991188022 2752 dbSNP
rs1406813897 2760 dbSNP
rs1158717435 2767 dbSNP
rs1441062145 2769 dbSNP
rs1208273835 2787 dbSNP
rs916674973 2788 dbSNP
rs1483603676 2801 dbSNP
rs1239528755 2806 dbSNP
rs80216563 2806 dbSNP
rs1214104348 2817 dbSNP
rs780060879 2820 dbSNP
rs1446573108 2822 dbSNP
rs567982629 2833 dbSNP
rs1285301668 2838 dbSNP
rs899749138 2847 dbSNP
rs1357435021 2849 dbSNP
rs932623184 2856 dbSNP
rs918447652 2858 dbSNP
rs1473458302 2862 dbSNP
rs534081267 2863 dbSNP
rs1312794103 2876 dbSNP
rs1245110638 2884 dbSNP
rs1159541659 2887 dbSNP
rs929786862 2890 dbSNP
rs749442385 2892 dbSNP
rs768879188 2895 dbSNP
rs1344221819 2902 dbSNP
rs891036408 2911 dbSNP
rs1420949707 2912 dbSNP
rs553810090 2916 dbSNP
rs1412461473 2919 dbSNP
rs368372312 2920 dbSNP
rs1424846329 2922 dbSNP
rs1335754308 2923 dbSNP
rs1185136888 2927 dbSNP
rs1264146117 2928 dbSNP
rs749352316 2928 dbSNP
rs1219123362 2940 dbSNP
rs116575317 2947 dbSNP
rs1408644698 2959 dbSNP
rs1291075320 2960 dbSNP
rs1307980710 2966 dbSNP
rs148781619 2968 dbSNP
rs1314834300 2973 dbSNP
rs368016040 2977 dbSNP
rs757110251 2977 dbSNP
rs78648273 2977 dbSNP
rs199990786 2981 dbSNP
rs1401408151 3002 dbSNP
rs1280571635 3009 dbSNP
rs1363343867 3013 dbSNP
rs1301917114 3014 dbSNP
rs1033647663 3018 dbSNP
rs1352110559 3019 dbSNP
rs959634817 3024 dbSNP
rs1011302567 3026 dbSNP
rs1428257379 3030 dbSNP
rs1424738817 3034 dbSNP
rs1196330917 3043 dbSNP
rs772943025 3048 dbSNP
rs746835844 3049 dbSNP
rs950879460 3054 dbSNP
rs1000099365 3057 dbSNP
rs556255084 3061 dbSNP
rs566860632 3067 dbSNP
rs1182798257 3076 dbSNP
rs990864754 3082 dbSNP
rs576225263 3083 dbSNP
rs1258402187 3092 dbSNP
rs1220241510 3093 dbSNP
rs1343248615 3095 dbSNP
rs776618884 3096 dbSNP
rs1386825914 3102 dbSNP
rs974166188 3104 dbSNP
rs918639400 3111 dbSNP
rs929827522 3114 dbSNP
rs987034015 3116 dbSNP
rs142142309 3120 dbSNP
rs942596538 3122 dbSNP
rs1039574359 3123 dbSNP
rs145970662 3125 dbSNP
rs1173196260 3127 dbSNP
rs527312502 3129 dbSNP
rs947021777 3130 dbSNP
rs1041452013 3133 dbSNP
rs902930347 3138 dbSNP
rs999733439 3143 dbSNP
rs1166101181 3151 dbSNP
rs1371864270 3152 dbSNP
rs912447639 3154 dbSNP
rs1176703296 3158 dbSNP
rs1457211956 3168 dbSNP
rs1057021907 3170 dbSNP
rs1200289787 3178 dbSNP
rs1412287407 3181 dbSNP
rs896758541 3184 dbSNP
rs1380602219 3192 dbSNP
rs1255021063 3193 dbSNP
rs1233471752 3199 dbSNP
rs945225779 3207 dbSNP
rs1012521903 3211 dbSNP
rs1378293791 3212 dbSNP
rs1023863028 3233 dbSNP
rs1334024423 3238 dbSNP
rs962710824 3248 dbSNP
rs139844760 3250 dbSNP
rs1000944701 3258 dbSNP
rs564665437 3259 dbSNP
rs759459696 3265 dbSNP
rs1362282346 3266 dbSNP
rs1158469005 3268 dbSNP
rs779139839 3268 dbSNP
rs951536392 3269 dbSNP
rs1013980514 3270 dbSNP
rs1025237992 3272 dbSNP
rs1180476890 3273 dbSNP
rs866564699 3277 dbSNP
rs1005056550 3278 dbSNP
rs950910559 3278 dbSNP
rs1016478793 3279 dbSNP
rs1227942273 3280 dbSNP
rs986677445 3286 dbSNP
rs1294864359 3287 dbSNP
rs533525959 3288 dbSNP
rs1258663888 3302 dbSNP
rs1238779418 3310 dbSNP
rs1272647179 3312 dbSNP
rs963528544 3313 dbSNP
rs1244353315 3314 dbSNP
rs1340410076 3320 dbSNP
rs187985718 3323 dbSNP
rs1398224415 3324 dbSNP
rs1383055908 3331 dbSNP
rs1344383702 3334 dbSNP
rs973876944 3340 dbSNP
rs912405126 3348 dbSNP
rs538966299 3351 dbSNP
rs986844686 3352 dbSNP
rs975311225 3359 dbSNP
rs1289006535 3361 dbSNP
rs1449673796 3370 dbSNP
rs1200659756 3371 dbSNP
rs914452039 3377 dbSNP
rs1187996145 3379 dbSNP
rs372043243 3383 dbSNP
rs1246930063 3384 dbSNP
rs775154009 3391 dbSNP
rs569787661 3397 dbSNP
rs181031724 3401 dbSNP
rs1186263400 3411 dbSNP
rs1425401208 3423 dbSNP
rs143189006 3424 dbSNP
rs1215383235 3425 dbSNP
rs565715389 3426 dbSNP
rs772326257 3437 dbSNP
rs1429783302 3439 dbSNP
rs1169022205 3440 dbSNP
rs114192010 3442 dbSNP
rs763874153 3446 dbSNP
rs896659633 3451 dbSNP
rs1285361152 3453 dbSNP
rs1247410377 3454 dbSNP
rs547662100 3464 dbSNP
rs1012385923 3469 dbSNP
rs1045341668 3482 dbSNP
rs898744884 3483 dbSNP
rs995539288 3484 dbSNP
rs1026049869 3492 dbSNP
rs1055239774 3497 dbSNP
rs1372169589 3497 dbSNP
rs951392550 3506 dbSNP
rs1008743532 3512 dbSNP
rs1389912226 3520 dbSNP
rs570665076 3521 dbSNP
rs1013595172 3522 dbSNP
rs1371075564 3525 dbSNP
rs963849554 3553 dbSNP
rs975215814 3554 dbSNP
rs1228179299 3562 dbSNP
rs1192680632 3565 dbSNP
rs74325608 3567 dbSNP
rs1264964976 3576 dbSNP
rs556407985 3585 dbSNP
rs1196629158 3587 dbSNP
rs1450588477 3592 dbSNP
rs1354086468 3595 dbSNP
rs1291177777 3599 dbSNP
rs115763795 3603 dbSNP
rs1005169501 3610 dbSNP
rs1338043095 3612 dbSNP
rs1257762324 3613 dbSNP
rs1273642129 3615 dbSNP
rs1219641232 3624 dbSNP
rs924290127 3626 dbSNP
rs535521148 3628 dbSNP
rs1281685034 3636 dbSNP
rs1435823981 3637 dbSNP
rs1331798177 3638 dbSNP
rs938332583 3639 dbSNP
rs1016511281 3648 dbSNP
rs1406957386 3657 dbSNP
rs1398028473 3661 dbSNP
rs1169686216 3662 dbSNP
rs1249449963 3665 dbSNP
rs992994756 3670 dbSNP
rs1425295901 3678 dbSNP
rs1173862334 3680 dbSNP
rs1477509430 3685 dbSNP
rs773619619 3693 dbSNP
rs1436512154 3700 dbSNP
rs1028088122 3708 dbSNP
rs373501084 3709 dbSNP
rs558478746 3712 dbSNP
rs187370520 3716 dbSNP
rs1165489878 3724 dbSNP
rs966342237 3734 dbSNP
rs1345989112 3741 dbSNP
rs931532678 3742 dbSNP
rs1457006016 3753 dbSNP
rs978009724 3756 dbSNP
rs1047284565 3757 dbSNP
rs571995145 3758 dbSNP
rs936530352 3766 dbSNP
rs540677452 3769 dbSNP
rs750935289 3773 dbSNP
rs1382848435 3774 dbSNP
rs374639832 3775 dbSNP
rs774317284 3775 dbSNP
rs916672289 3775 dbSNP
rs991025946 3775 dbSNP
rs899920065 3780 dbSNP
rs996663708 3781 dbSNP
rs1021395759 3787 dbSNP
rs1281060461 3790 dbSNP
rs968499039 3792 dbSNP
rs1353124060 3794 dbSNP
rs977753966 3796 dbSNP
rs1240721967 3819 dbSNP
rs1031552124 3824 dbSNP
rs117873780 3828 dbSNP
rs1447103175 3830 dbSNP
rs959976434 3831 dbSNP
rs151150556 3840 dbSNP
rs1417289438 3841 dbSNP
rs915696220 3852 dbSNP
rs1037975205 3854 dbSNP
rs1226284834 3855 dbSNP
rs899388432 3855 dbSNP
rs543577308 3856 dbSNP
rs996368896 3864 dbSNP
rs1181623687 3866 dbSNP
rs1473357784 3868 dbSNP
rs948436235 3870 dbSNP
rs980956786 3871 dbSNP
rs1488099140 3874 dbSNP
rs1486031238 3876 dbSNP
rs1218896375 3882 dbSNP
rs1355764132 3885 dbSNP
rs7821684 3886 dbSNP
rs1227512172 3887 dbSNP
rs1379676662 3888 dbSNP
rs1008428637 3894 dbSNP
rs1397700207 3899 dbSNP
rs931437696 3900 dbSNP
rs1019309522 3909 dbSNP
rs966373138 3916 dbSNP
rs866408545 3920 dbSNP
rs529475833 3940 dbSNP
rs1421049685 3941 dbSNP
rs549062833 3951 dbSNP
rs977704521 3955 dbSNP
rs1406491456 3957 dbSNP
rs749391365 3961 dbSNP
rs1253529430 3971 dbSNP
rs796623851 3973 dbSNP
rs1195920145 3974 dbSNP
rs559461677 3977 dbSNP
rs192047265 3978 dbSNP
rs1263579966 3994 dbSNP
rs1472474129 3998 dbSNP
rs958153849 4003 dbSNP
rs1157307085 4007 dbSNP
rs1216638911 4008 dbSNP
rs1316904365 4012 dbSNP
rs1278496529 4017 dbSNP
rs1041039999 4018 dbSNP
rs899951149 4020 dbSNP
rs183590732 4021 dbSNP
rs1292455240 4024 dbSNP
rs1021635737 4029 dbSNP
rs1437737369 4030 dbSNP
rs1352127851 4033 dbSNP
rs748417626 4034 dbSNP
rs904372689 4047 dbSNP
rs371441718 4048 dbSNP
rs770757277 4050 dbSNP
rs1266704744 4051 dbSNP
rs554412694 4057 dbSNP
rs1032043835 4061 dbSNP
rs1254872490 4065 dbSNP
rs75544187 4083 dbSNP
rs539336087 4084 dbSNP
rs1317110599 4113 dbSNP
rs550126325 4116 dbSNP
rs940688026 4118 dbSNP
rs569862586 4126 dbSNP
rs1349724917 4135 dbSNP
rs1037673372 4138 dbSNP
rs899419938 4142 dbSNP
rs992930943 4145 dbSNP
rs932267525 4148 dbSNP
rs535684415 4150 dbSNP
rs1022616806 4151 dbSNP
rs555459378 4153 dbSNP
rs1317273337 4156 dbSNP
rs557311564 4158 dbSNP
rs1464670419 4166 dbSNP
rs1377293600 4168 dbSNP
rs534584792 4172 dbSNP
rs1176880441 4173 dbSNP
rs769645240 4174 dbSNP
rs1396790662 4182 dbSNP
rs1176652207 4187 dbSNP
rs973159706 4189 dbSNP
rs1457287119 4192 dbSNP
rs1232133943 4194 dbSNP
rs540466393 4195 dbSNP
rs1019342135 4196 dbSNP
rs902236153 4197 dbSNP
rs1346531509 4200 dbSNP
rs1349480202 4205 dbSNP
rs1210901881 4209 dbSNP
rs1306481068 4214 dbSNP
rs953033751 4215 dbSNP
rs1240004279 4217 dbSNP
rs554024244 4243 dbSNP
rs982964391 4254 dbSNP
rs908817674 4261 dbSNP
rs186590341 4265 dbSNP
rs1394727571 4268 dbSNP
rs1401734993 4276 dbSNP
rs1303695591 4278 dbSNP
rs1041258852 4279 dbSNP
rs1250438827 4280 dbSNP
rs1467796756 4281 dbSNP
rs1358660454 4284 dbSNP
rs1158129829 4289 dbSNP
rs1032006937 4290 dbSNP
rs1253162980 4291 dbSNP
rs957718674 4298 dbSNP
rs1380903745 4299 dbSNP
rs762523423 4302 dbSNP
rs577181346 4309 dbSNP
rs1376077243 4310 dbSNP
rs768333594 4317 dbSNP
rs921276703 4320 dbSNP
rs932620916 4330 dbSNP
rs72649579 4332 dbSNP
rs1012604254 4337 dbSNP
rs1283174012 4350 dbSNP
rs545782343 4353 dbSNP
rs543689226 4355 dbSNP
rs1052942427 4361 dbSNP
rs1263061549 4368 dbSNP
rs565242857 4376 dbSNP
rs1243048120 4396 dbSNP
rs1340199355 4398 dbSNP
rs1370017521 4402 dbSNP
rs1313925702 4405 dbSNP
rs1407977203 4408 dbSNP
rs563685236 4425 dbSNP
rs895743456 4434 dbSNP
rs528310429 4435 dbSNP
rs1309743630 4439 dbSNP
rs149967717 4443 dbSNP
rs530852221 4444 dbSNP
rs994503687 4447 dbSNP
rs1027442232 4449 dbSNP
rs973485022 4450 dbSNP
rs920628708 4463 dbSNP
rs931989423 4467 dbSNP
rs1234561880 4468 dbSNP
rs1273357679 4469 dbSNP
rs190734872 4471 dbSNP
rs1192268389 4476 dbSNP
rs1488361837 4481 dbSNP
rs1339420409 4482 dbSNP
rs1051141040 4483 dbSNP
rs145085927 4496 dbSNP
rs1203683379 4500 dbSNP
rs1356269214 4503 dbSNP
rs142169962 4507 dbSNP
rs983379992 4508 dbSNP
rs908728197 4511 dbSNP
rs944889923 4514 dbSNP
rs1265702661 4516 dbSNP
rs965900304 4519 dbSNP
rs565112703 4523 dbSNP
rs78746191 4524 dbSNP
rs1389936600 4529 dbSNP
rs1163606804 4530 dbSNP
rs1462876960 4536 dbSNP
rs921476751 4539 dbSNP
rs893484028 4548 dbSNP
rs932693033 4550 dbSNP
rs1043029864 4563 dbSNP
rs1172476854 4571 dbSNP
rs926056770 4584 dbSNP
rs1243279485 4586 dbSNP
rs1023984798 4590 dbSNP
rs934742557 4599 dbSNP
rs1268746769 4605 dbSNP
rs1215908082 4609 dbSNP
rs761193982 4614 dbSNP
rs1457219413 4624 dbSNP
rs1291631781 4625 dbSNP
rs970639160 4629 dbSNP
rs1053587611 4631 dbSNP
rs1232695901 4633 dbSNP
rs895661626 4636 dbSNP
rs145911239 4637 dbSNP
rs1014467580 4641 dbSNP
rs147906925 4642 dbSNP
rs575753036 4643 dbSNP
rs1298383580 4646 dbSNP
rs182516854 4653 dbSNP
rs953523662 4657 dbSNP
rs565736193 4665 dbSNP
rs1421282722 4670 dbSNP
rs1264108723 4681 dbSNP
rs1027307255 4689 dbSNP
rs886081686 4690 dbSNP
rs1214589325 4701 dbSNP
rs1004649954 4707 dbSNP
rs10504195 4709 dbSNP
rs986121120 4714 dbSNP
rs965578107 4715 dbSNP
rs1199908045 4732 dbSNP
rs1345752716 4748 dbSNP
rs976884475 4752 dbSNP
rs1305764293 4757 dbSNP
rs1236320495 4759 dbSNP
rs141623194 4763 dbSNP
rs147057359 4764 dbSNP
rs1442742759 4765 dbSNP
rs1355891292 4766 dbSNP
rs1162572783 4775 dbSNP
rs924810833 4777 dbSNP
rs936151815 4785 dbSNP
rs779032800 4787 dbSNP
rs1174979328 4790 dbSNP
rs1053962085 4816 dbSNP
rs546759638 4816 dbSNP
rs1178133149 4817 dbSNP
rs925992068 4818 dbSNP
rs1319496831 4826 dbSNP
rs1236112613 4834 dbSNP
rs1187061353 4837 dbSNP
rs557193084 4843 dbSNP
rs868714672 4844 dbSNP
rs1282496155 4845 dbSNP
rs115290955 4865 dbSNP
rs1351417916 4880 dbSNP
rs917321329 4881 dbSNP
rs1285272559 4887 dbSNP
rs1377781749 4896 dbSNP
rs1224109048 4899 dbSNP
rs949900339 4914 dbSNP
rs1282242447 4918 dbSNP
rs906198320 4929 dbSNP
rs1003497951 4930 dbSNP
rs752900599 4932 dbSNP
rs1314161715 4940 dbSNP
rs187211307 4950 dbSNP
rs553274866 4958 dbSNP
rs1234225278 4959 dbSNP
rs1267743802 4967 dbSNP
rs930567321 4978 dbSNP
rs994649318 4979 dbSNP
rs1163058987 4982 dbSNP
rs573411915 4988 dbSNP
rs953456171 4999 dbSNP
rs886115225 5006 dbSNP
rs1191561651 5007 dbSNP
rs1482949325 5009 dbSNP
rs765009600 5013 dbSNP
rs767368914 5013 dbSNP
rs986616136 5013 dbSNP
rs1491144606 5014 dbSNP
rs1419877052 5017 dbSNP
rs1318660528 5018 dbSNP
rs148096826 5020 dbSNP
rs1227586526 5028 dbSNP
rs1335067236 5032 dbSNP
rs1018736651 5035 dbSNP
rs901581104 5037 dbSNP
rs780993285 5038 dbSNP
rs1288950139 5041 dbSNP
rs745685803 5043 dbSNP
rs1323307594 5045 dbSNP
rs1462333472 5047 dbSNP
rs977666816 5048 dbSNP
rs74367809 5052 dbSNP
rs1477635789 5058 dbSNP
rs1420231716 5059 dbSNP
rs1188371746 5063 dbSNP
rs936183154 5064 dbSNP
rs1244975094 5071 dbSNP
rs990298723 5074 dbSNP
rs1468784237 5075 dbSNP
rs530883864 5081 dbSNP
rs189818207 5083 dbSNP
rs1316939937 5087 dbSNP
rs780119904 5093 dbSNP
rs1215887480 5095 dbSNP
rs1033643331 5096 dbSNP
rs1293511898 5098 dbSNP
rs563544556 5102 dbSNP
rs546678177 5103 dbSNP
rs989213234 5108 dbSNP
rs917371066 5110 dbSNP
rs1288177040 5111 dbSNP
rs1355392134 5113 dbSNP
rs1172613265 5121 dbSNP
rs549295016 5125 dbSNP
rs756054920 5126 dbSNP
rs927124132 5130 dbSNP
rs182763792 5132 dbSNP
rs1048974851 5139 dbSNP
rs1311700794 5139 dbSNP
rs1208037576 5141 dbSNP
rs1254590025 5154 dbSNP
rs1259700179 5155 dbSNP
rs565718623 5156 dbSNP
rs1251571129 5169 dbSNP
rs888939009 5173 dbSNP
rs1309885470 5183 dbSNP
rs566926355 5188 dbSNP
rs141836835 5193 dbSNP
rs1235570461 5199 dbSNP
rs1373843055 5200 dbSNP
rs1040430928 5205 dbSNP
rs1249400344 5208 dbSNP
rs7830792 5213 dbSNP
rs74747920 5214 dbSNP
rs1464749862 5216 dbSNP
rs1050104019 5218 dbSNP
rs1031890973 5230 dbSNP
rs1416904331 5237 dbSNP
rs889957877 5238 dbSNP
rs1176515282 5240 dbSNP
rs77100967 5248 dbSNP
rs1291648037 5251 dbSNP
rs1178538557 5254 dbSNP
rs879818773 5259 dbSNP
rs188970139 5264 dbSNP
rs948889184 5265 dbSNP
rs1435934377 5269 dbSNP
rs956477696 5280 dbSNP
rs1010263231 5283 dbSNP
rs1307922358 5293 dbSNP
rs771641811 5296 dbSNP
rs773585187 5300 dbSNP
rs1309640703 5304 dbSNP
rs971360299 5309 dbSNP
rs566956125 5324 dbSNP
rs1378796151 5326 dbSNP
rs939012532 5335 dbSNP
rs1035996258 5337 dbSNP
rs1334385366 5340 dbSNP
rs1377175603 5344 dbSNP
rs980190974 5350 dbSNP
rs1280371827 5359 dbSNP
rs1453008313 5361 dbSNP
rs1364093907 5365 dbSNP
rs1367086604 5366 dbSNP
rs150283342 5382 dbSNP
rs1256448898 5397 dbSNP
rs1282625469 5405 dbSNP
rs1486392695 5409 dbSNP
rs930609721 5410 dbSNP
rs1348646308 5414 dbSNP
rs1352034408 5416 dbSNP
rs1262852933 5419 dbSNP
rs553674285 5421 dbSNP
rs888977943 5422 dbSNP
rs1272332022 5431 dbSNP
rs985021856 5435 dbSNP
rs1294191798 5436 dbSNP
rs1338470862 5437 dbSNP
rs755074666 5439 dbSNP
rs1317733425 5445 dbSNP
rs1381522854 5450 dbSNP
rs1385651914 5451 dbSNP
rs907813830 5452 dbSNP
rs1182180742 5453 dbSNP
rs766777072 5461 dbSNP
rs142154644 5473 dbSNP
rs545589699 5476 dbSNP
rs922952964 5486 dbSNP
rs1420746342 5514 dbSNP
rs931612667 5516 dbSNP
rs1448306113 5527 dbSNP
rs1448080734 5530 dbSNP
rs1168530608 5532 dbSNP
rs1050134859 5534 dbSNP
rs1031673661 5542 dbSNP
rs903607695 5543 dbSNP
rs558733261 5544 dbSNP
rs1412002968 5546 dbSNP
rs1235298345 5548 dbSNP
rs1330041314 5548 dbSNP
rs1316312879 5549 dbSNP
rs1269657760 5550 dbSNP
rs1228329754 5552 dbSNP
rs1326921706 5556 dbSNP
rs1000400242 5560 dbSNP
rs957594734 5567 dbSNP
rs1011862109 5570 dbSNP
rs1055015256 5572 dbSNP
rs1023623119 5575 dbSNP
rs891941864 5576 dbSNP
rs1439036625 5581 dbSNP
rs575827927 5585 dbSNP
rs537471080 5594 dbSNP
rs1397759488 5596 dbSNP
rs1371850300 5599 dbSNP
rs1024529831 5608 dbSNP
rs1227688698 5613 dbSNP
rs1268353186 5614 dbSNP
rs971391454 5624 dbSNP
rs760042527 5627 dbSNP
rs1454225309 5629 dbSNP
rs927707269 5643 dbSNP
rs1216008566 5648 dbSNP
rs1272611882 5657 dbSNP
rs193135939 5660 dbSNP
rs1196430700 5661 dbSNP
rs78726851 5661 dbSNP
rs971798612 5665 dbSNP
rs1196287430 5667 dbSNP
rs1303876107 5678 dbSNP
rs1288934522 5686 dbSNP
rs918953611 5688 dbSNP
rs1333603173 5698 dbSNP
rs1327715530 5699 dbSNP
rs952096682 5700 dbSNP
rs1410214791 5702 dbSNP
rs984664277 5704 dbSNP
rs185750415 5717 dbSNP
rs1253186581 5722 dbSNP
rs1464058217 5726 dbSNP
rs961873227 5733 dbSNP
rs1438280311 5734 dbSNP
rs910429488 5737 dbSNP
rs1182746869 5743 dbSNP
rs943222406 5747 dbSNP
rs1040142488 5751 dbSNP
rs1374287408 5755 dbSNP
rs1476702679 5770 dbSNP
rs1168970044 5771 dbSNP
rs1413566494 5773 dbSNP
rs976411154 5775 dbSNP
rs765243830 5776 dbSNP
rs998931675 5790 dbSNP
rs1348231779 5793 dbSNP
rs1278744846 5795 dbSNP
rs1442411020 5796 dbSNP
rs1337223711 5801 dbSNP
rs923150958 5810 dbSNP
rs1310539998 5816 dbSNP
rs1053120769 5824 dbSNP
rs1376569080 5826 dbSNP
rs931684630 5832 dbSNP
rs1050038803 5836 dbSNP
rs1011970449 5840 dbSNP
rs1407625356 5843 dbSNP
rs1159520228 5847 dbSNP
rs1023230770 5851 dbSNP
rs1187289062 5852 dbSNP
rs925059648 5855 dbSNP
rs970681889 5860 dbSNP
rs1212854092 5871 dbSNP
rs1283279616 5871 dbSNP
rs1445226154 5871 dbSNP
rs936438051 5893 dbSNP
rs1003045866 5905 dbSNP
rs1052162073 5906 dbSNP
rs891967342 5907 dbSNP
rs1328249681 5913 dbSNP
rs946197903 5913 dbSNP
rs1291108223 5914 dbSNP
rs1035901295 5915 dbSNP
rs1232324595 5915 dbSNP
rs1184916765 5917 dbSNP
rs1215651106 5917 dbSNP
rs1216210454 5917 dbSNP
rs1241488316 5917 dbSNP
rs1261981588 5917 dbSNP
rs1302215668 5917 dbSNP
rs1314177164 5917 dbSNP
rs1319382120 5917 dbSNP
rs1345176228 5917 dbSNP
rs1484851302 5917 dbSNP
rs199628835 5917 dbSNP
rs560624016 5917 dbSNP
rs60739329 5917 dbSNP
rs71948929 5917 dbSNP
rs753465430 5917 dbSNP
rs755504889 5917 dbSNP
rs760409438 5917 dbSNP
rs1228112865 5920 dbSNP
rs1283482735 5923 dbSNP
rs1007549096 5924 dbSNP
rs765989072 5924 dbSNP
rs1448466342 5928 dbSNP
rs752742857 5928 dbSNP
rs758012145 5932 dbSNP
rs758610568 5932 dbSNP
rs1332439362 5934 dbSNP
rs1212606604 5935 dbSNP
rs1234842321 5936 dbSNP
rs1294576268 5938 dbSNP
rs1273431440 5939 dbSNP
rs1212355700 5940 dbSNP
rs542556882 5940 dbSNP
rs1361844920 5942 dbSNP
rs1271238597 5944 dbSNP
rs1464211849 5944 dbSNP
rs1489381417 5945 dbSNP
rs71519414 5946 dbSNP
rs1392659173 5948 dbSNP
rs67014322 5950 dbSNP
rs1462151353 5952 dbSNP
rs1261722407 5953 dbSNP
rs1168383619 5954 dbSNP
rs1428045682 5956 dbSNP
rs907444783 5957 dbSNP
rs1001563418 5958 dbSNP
rs961524490 5959 dbSNP
rs1263273333 5960 dbSNP
rs1034333079 5961 dbSNP
rs1447038287 5963 dbSNP
rs1250839701 5964 dbSNP
rs1194548152 5966 dbSNP
rs1192833977 5967 dbSNP
rs1466646084 5968 dbSNP
rs1257363974 5969 dbSNP
rs1474435151 5970 dbSNP
rs1468635779 5971 dbSNP
rs887760423 5973 dbSNP
rs1202035115 5975 dbSNP
rs1006728327 5976 dbSNP
rs537838061 5978 dbSNP
rs559643087 5979 dbSNP
rs1014973561 5980 dbSNP
rs1303127211 5982 dbSNP
rs1442153561 6005 dbSNP
rs962187262 6029 dbSNP
rs975883899 6034 dbSNP
rs910470221 6041 dbSNP
rs1296616193 6045 dbSNP
rs377115680 6046 dbSNP
rs943319161 6046 dbSNP
rs1355120368 6050 dbSNP
rs1172640537 6073 dbSNP
rs1030235985 6077 dbSNP
rs1157009908 6080 dbSNP
rs1431531852 6085 dbSNP
rs7831785 6086 dbSNP
rs1382796939 6093 dbSNP
rs985989917 6095 dbSNP
rs1454515193 6100 dbSNP
rs1269240412 6112 dbSNP
rs923138109 6115 dbSNP
rs751859044 6116 dbSNP
rs1232945559 6118 dbSNP
rs1416539668 6137 dbSNP
rs1053152455 6141 dbSNP
rs1346307985 6149 dbSNP
rs1280304046 6156 dbSNP
rs893181370 6165 dbSNP
rs1328189328 6180 dbSNP
rs1236470109 6187 dbSNP
rs1350448480 6197 dbSNP
rs35023074 6201 dbSNP
rs936317416 6201 dbSNP
rs867531025 6206 dbSNP
rs1262074950 6211 dbSNP
rs947417580 6212 dbSNP
rs551556679 6215 dbSNP
rs1350784848 6220 dbSNP
rs988298776 6225 dbSNP
rs1299962711 6230 dbSNP
rs1413055094 6231 dbSNP
rs1373529492 6233 dbSNP
rs1044752373 6238 dbSNP
rs905862490 6243 dbSNP
rs913650244 6246 dbSNP
rs564610677 6248 dbSNP
rs72649580 6252 dbSNP
rs1199325155 6257 dbSNP
rs1277572742 6260 dbSNP
rs1408320314 6265 dbSNP
rs1183690871 6268 dbSNP
rs1045918511 6274 dbSNP
rs1256229209 6278 dbSNP
rs907477310 6279 dbSNP
rs1212138720 6282 dbSNP
rs897344499 6283 dbSNP
rs1484531136 6286 dbSNP
rs994305395 6287 dbSNP
rs937594290 6290 dbSNP
rs1026072092 6291 dbSNP
rs1190664189 6300 dbSNP
rs1290496149 6301 dbSNP
rs1231723801 6310 dbSNP
rs951846179 6312 dbSNP
rs755963200 6319 dbSNP
rs984553188 6319 dbSNP
rs1404355503 6331 dbSNP
rs1286872582 6349 dbSNP
rs1452857256 6351 dbSNP
rs780058026 6361 dbSNP
rs1474022239 6363 dbSNP
rs1416445706 6367 dbSNP
rs1188113459 6374 dbSNP
rs530536252 6376 dbSNP
rs1260310464 6385 dbSNP
rs1365695778 6391 dbSNP
rs550288516 6396 dbSNP
rs1454376893 6400 dbSNP
rs1015460117 6401 dbSNP
rs964335288 6404 dbSNP
rs1172132908 6405 dbSNP
rs897898569 6407 dbSNP
rs1254956928 6408 dbSNP
rs1373694336 6411 dbSNP
rs975996570 6412 dbSNP
rs1247138964 6414 dbSNP
rs997329706 6421 dbSNP
rs923167643 6430 dbSNP
rs934507562 6431 dbSNP
rs1381614004 6433 dbSNP
rs989019023 6450 dbSNP
rs1322313119