miRTarBase - #MIRT664468 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZYG11B   
Synonyms ZYG11
Description zyg-11 family member B, cell cycle regulator
Transcript NM_024646   
Putative miRNA Targets on ZYG11B
3'UTR of ZYG11B
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             :||: || || :||||||| 
4888 - 4910 159.00 -15.50
            ||:|:|| || |   :|||||| 
2957 - 2980 143.00 -17.00
            ||:||:|   ||| |||| |||| 
4599 - 4624 140.00 -14.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30519762 4 COSMIC
COSN26506377 32 COSMIC
COSN1105674 55 COSMIC
COSN31491928 58 COSMIC
COSN31587189 60 COSMIC
COSN30188177 88 COSMIC
COSN29461043 116 COSMIC
COSN8473715 613 COSMIC
COSN15819497 710 COSMIC
COSN4750862 843 COSMIC
COSN1448867 863 COSMIC
COSN26294285 1195 COSMIC
COSN20094828 1674 COSMIC
COSN7223499 1675 COSMIC
COSN20094829 1906 COSMIC
COSN27434418 1906 COSMIC
COSN7223500 2078 COSMIC
COSN18884619 2203 COSMIC
COSN17183261 2332 COSMIC
COSN31960243 2371 COSMIC
COSN25913323 2491 COSMIC
COSN16361277 2617 COSMIC
COSN22183952 3568 COSMIC
COSN5373352 3716 COSMIC
COSN6459614 4250 COSMIC
COSN1448868 4285 COSMIC
COSN16696927 4444 COSMIC
COSN24936891 4664 COSMIC
COSN22825863 4740 COSMIC
COSN6038605 5199 COSMIC
COSN6459616 5307 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs183602283 5 dbSNP
rs773578959 7 dbSNP
rs1163160464 10 dbSNP
rs1460401903 13 dbSNP
rs761137031 14 dbSNP
rs1420661687 17 dbSNP
rs1187981926 24 dbSNP
rs763549743 31 dbSNP
rs34490646 33 dbSNP
rs766880027 33 dbSNP
rs766771140 46 dbSNP
rs745781411 47 dbSNP
rs775207094 47 dbSNP
rs762543804 50 dbSNP
rs1163120789 55 dbSNP
rs1391359428 57 dbSNP
rs943555999 62 dbSNP
rs1431965375 64 dbSNP
rs1336772839 78 dbSNP
rs756248424 80 dbSNP
rs1273752945 84 dbSNP
rs955706245 89 dbSNP
rs1167077685 92 dbSNP
rs1370374198 97 dbSNP
rs1009801357 107 dbSNP
rs1022560047 110 dbSNP
rs968234307 125 dbSNP
rs1268602329 133 dbSNP
rs902078034 135 dbSNP
rs780485784 137 dbSNP
rs1336463348 139 dbSNP
rs1338716452 140 dbSNP
rs926708423 141 dbSNP
rs961103655 143 dbSNP
rs1439179889 148 dbSNP
rs992215169 156 dbSNP
rs1344251950 157 dbSNP
rs531866169 163 dbSNP
rs188241809 164 dbSNP
rs114256017 165 dbSNP
rs535460854 174 dbSNP
rs1038217392 190 dbSNP
rs1348399701 202 dbSNP
rs1201761875 205 dbSNP
rs1299612624 208 dbSNP
rs1191450942 212 dbSNP
rs191880641 214 dbSNP
rs1441294401 224 dbSNP
rs142228334 225 dbSNP
rs539309244 227 dbSNP
rs1306967604 232 dbSNP
rs890867480 239 dbSNP
rs1216410670 245 dbSNP
rs765908333 245 dbSNP
rs1389928781 254 dbSNP
rs1274511486 255 dbSNP
rs961305670 259 dbSNP
rs1466887184 278 dbSNP
rs1373699643 280 dbSNP
rs1174466866 284 dbSNP
rs1446772249 286 dbSNP
rs1352258117 292 dbSNP
rs1330233525 293 dbSNP
rs562741228 300 dbSNP
rs1413927938 316 dbSNP
rs768381680 318 dbSNP
rs1321272145 327 dbSNP
rs1367488476 329 dbSNP
rs533263592 343 dbSNP
rs575796802 345 dbSNP
rs919569011 355 dbSNP
rs543538729 378 dbSNP
rs1395507257 379 dbSNP
rs1177914358 381 dbSNP
rs555147684 384 dbSNP
rs774144212 386 dbSNP
rs1234546695 391 dbSNP
rs891430389 396 dbSNP
rs1296804311 398 dbSNP
rs1206659466 403 dbSNP
rs1438499423 407 dbSNP
rs12080630 410 dbSNP
rs1209056683 412 dbSNP
rs1350487797 419 dbSNP
rs1304712667 420 dbSNP
rs1022548849 427 dbSNP
rs1272667674 435 dbSNP
rs1343827129 436 dbSNP
rs1371735837 436 dbSNP
rs985141030 440 dbSNP
rs1442247370 442 dbSNP
rs1358112919 447 dbSNP
rs910963658 448 dbSNP
rs1209011562 466 dbSNP
rs1436259914 476 dbSNP
rs1375831986 478 dbSNP
rs1157769885 479 dbSNP
rs1417108095 480 dbSNP
rs943822263 486 dbSNP
rs1177754334 489 dbSNP
rs540657060 491 dbSNP
rs1256975192 492 dbSNP
rs902024592 494 dbSNP
rs1002361922 498 dbSNP
rs1281322085 509 dbSNP
rs146401127 517 dbSNP
rs1286918546 523 dbSNP
rs866504006 525 dbSNP
rs1000861239 526 dbSNP
rs113169976 527 dbSNP
rs908641238 539 dbSNP
rs961351665 540 dbSNP
rs1330814131 541 dbSNP
rs760249010 546 dbSNP
rs765843659 552 dbSNP
rs974084298 559 dbSNP
rs1159729442 567 dbSNP
rs1404762368 570 dbSNP
rs182526652 571 dbSNP
rs564688945 594 dbSNP
rs1185825890 597 dbSNP
rs531927625 605 dbSNP
rs1258441169 610 dbSNP
rs932590088 615 dbSNP
rs1485084483 629 dbSNP
rs1244247324 631 dbSNP
rs550277045 637 dbSNP
rs961520372 638 dbSNP
rs972583638 641 dbSNP
rs1334966428 649 dbSNP
rs912362566 651 dbSNP
rs1455716683 654 dbSNP
rs943857789 656 dbSNP
rs1052822998 663 dbSNP
rs79245914 664 dbSNP
rs1289164776 675 dbSNP
rs947015105 687 dbSNP
rs116301767 695 dbSNP
rs985086550 696 dbSNP
rs139354429 698 dbSNP
rs910910410 700 dbSNP
rs1330374147 707 dbSNP
rs1169987823 712 dbSNP
rs1002844345 724 dbSNP
rs1421919262 730 dbSNP
rs12081849 732 dbSNP
rs896612363 733 dbSNP
rs539362477 734 dbSNP
rs375666272 743 dbSNP
rs1015629245 760 dbSNP
rs1216154633 766 dbSNP
rs45581033 767 dbSNP
rs1250338223 768 dbSNP
rs1224618792 770 dbSNP
rs1308837364 772 dbSNP
rs1295881263 775 dbSNP
rs1233239815 781 dbSNP
rs1368563140 783 dbSNP
rs1260598430 789 dbSNP
rs187318553 790 dbSNP
rs746481628 798 dbSNP
rs1220969415 806 dbSNP
rs1391540058 811 dbSNP
rs925523584 814 dbSNP
rs1212191324 820 dbSNP
rs1374952189 826 dbSNP
rs936931346 831 dbSNP
rs1454091032 833 dbSNP
rs1055119752 856 dbSNP
rs974032022 859 dbSNP
rs764400098 860 dbSNP
rs1250455333 877 dbSNP
rs1193524232 880 dbSNP
rs895150893 884 dbSNP
rs1013646166 889 dbSNP
rs954091513 892 dbSNP
rs1345449081 893 dbSNP
rs896951038 907 dbSNP
rs1414505919 909 dbSNP
rs1335036717 911 dbSNP
rs536848674 916 dbSNP
rs1389714460 923 dbSNP
rs1026812837 936 dbSNP
rs1158496498 938 dbSNP
rs1048058 939 dbSNP
rs1459379421 947 dbSNP
rs1373877645 954 dbSNP
rs144339712 959 dbSNP
rs1389671250 966 dbSNP
rs56392930 977 dbSNP
rs1309421694 996 dbSNP
rs1420327935 1006 dbSNP
rs1250682120 1007 dbSNP
rs1348265668 1009 dbSNP
rs1484447198 1013 dbSNP
rs1282038978 1016 dbSNP
rs769490236 1016 dbSNP
rs534664518 1018 dbSNP
rs1258873133 1037 dbSNP
rs1241170110 1038 dbSNP
rs768196339 1047 dbSNP
rs965420890 1048 dbSNP
rs1414264338 1049 dbSNP
rs912970623 1051 dbSNP
rs1353746432 1055 dbSNP
rs947090088 1057 dbSNP
rs912966055 1061 dbSNP
rs750961050 1063 dbSNP
rs1157321998 1066 dbSNP
rs905486315 1074 dbSNP
rs191413738 1086 dbSNP
rs1055776488 1089 dbSNP
rs573108055 1092 dbSNP
rs1163507478 1099 dbSNP
rs756299234 1119 dbSNP
rs896781976 1120 dbSNP
rs1055804049 1125 dbSNP
rs916545629 1127 dbSNP
rs1359123039 1135 dbSNP
rs1446202512 1138 dbSNP
rs949421004 1145 dbSNP
rs1206679076 1147 dbSNP
rs1351244737 1149 dbSNP
rs1046425615 1153 dbSNP
rs1013689041 1154 dbSNP
rs897240961 1166 dbSNP
rs1332823064 1168 dbSNP
rs577679005 1174 dbSNP
rs1176912508 1178 dbSNP
rs1295323812 1185 dbSNP
rs1256942703 1191 dbSNP
rs1326201528 1200 dbSNP
rs1316591278 1201 dbSNP
rs540129208 1203 dbSNP
rs1015743941 1209 dbSNP
rs1384288841 1213 dbSNP
rs1389954554 1220 dbSNP
rs1325861692 1236 dbSNP
rs994234017 1246 dbSNP
rs897343889 1248 dbSNP
rs1419466299 1264 dbSNP
rs1425646482 1269 dbSNP
rs1474838896 1274 dbSNP
rs1048189218 1281 dbSNP
rs1371001425 1283 dbSNP
rs780157334 1290 dbSNP
rs1195006339 1292 dbSNP
rs1465209363 1301 dbSNP
rs1252265130 1308 dbSNP
rs888300939 1312 dbSNP
rs1006770392 1315 dbSNP
rs1018618481 1316 dbSNP
rs1275194560 1316 dbSNP
rs1338917688 1319 dbSNP
rs546556525 1330 dbSNP
rs1268658470 1342 dbSNP
rs1162515818 1345 dbSNP
rs1366423857 1347 dbSNP
rs1027075499 1349 dbSNP
rs564750577 1361 dbSNP
rs965358639 1378 dbSNP
rs1439426418 1379 dbSNP
rs998258853 1385 dbSNP
rs1323579520 1389 dbSNP
rs1408890033 1407 dbSNP
rs1393824543 1408 dbSNP
rs1019972026 1411 dbSNP
rs1169330836 1413 dbSNP
rs954151268 1420 dbSNP
rs967106485 1426 dbSNP
rs183884128 1429 dbSNP
rs148627264 1437 dbSNP
rs1032488582 1444 dbSNP
rs1455477289 1446 dbSNP
rs1019928255 1468 dbSNP
rs1408833107 1469 dbSNP
rs1437348182 1471 dbSNP
rs965315968 1482 dbSNP
rs988737686 1483 dbSNP
rs1303125365 1484 dbSNP
rs1343315562 1484 dbSNP
rs1380625621 1506 dbSNP
rs1373771850 1516 dbSNP
rs1275998157 1529 dbSNP
rs913032633 1535 dbSNP
rs1311146117 1565 dbSNP
rs1382667660 1567 dbSNP
rs562269336 1568 dbSNP
rs1048112 1570 dbSNP
rs1171455809 1573 dbSNP
rs916808326 1574 dbSNP
rs947222852 1577 dbSNP
rs1340559927 1581 dbSNP
rs982500941 1583 dbSNP
rs978890173 1584 dbSNP
rs188981807 1587 dbSNP
rs1184446462 1596 dbSNP
rs1129807 1597 dbSNP
rs1279908179 1603 dbSNP
rs927093774 1607 dbSNP
rs1314353258 1617 dbSNP
rs3177646 1624 dbSNP
rs1279927508 1637 dbSNP
rs1223775809 1638 dbSNP
rs936984419 1642 dbSNP
rs77332181 1643 dbSNP
rs559354490 1653 dbSNP
rs942522778 1654 dbSNP
rs1354373107 1656 dbSNP
rs1310726407 1658 dbSNP
rs1039579726 1659 dbSNP
rs1398813208 1663 dbSNP
rs199878820 1663 dbSNP
rs901067561 1663 dbSNP
rs1257044150 1674 dbSNP
rs34249507 1674 dbSNP
rs918160530 1674 dbSNP
rs77742320 1675 dbSNP
rs1037247006 1680 dbSNP
rs897304712 1686 dbSNP
rs995701384 1687 dbSNP
rs1315587946 1693 dbSNP
rs1228429120 1704 dbSNP
rs1333570040 1708 dbSNP
rs567912665 1715 dbSNP
rs1388073935 1725 dbSNP
rs889899185 1726 dbSNP
rs1007297485 1728 dbSNP
rs1032769923 1729 dbSNP
rs1019594284 1733 dbSNP
rs1428411112 1736 dbSNP
rs538548796 1737 dbSNP
rs958515266 1740 dbSNP
rs1176286308 1747 dbSNP
rs1360562236 1748 dbSNP
rs965375816 1751 dbSNP
rs1417320577 1755 dbSNP
rs1464274839 1756 dbSNP
rs1163052075 1757 dbSNP
rs72895452 1763 dbSNP
rs1388822562 1767 dbSNP
rs1414812469 1775 dbSNP
rs193029286 1778 dbSNP
rs982405399 1784 dbSNP
rs17107414 1795 dbSNP
rs929988903 1805 dbSNP
rs550098268 1816 dbSNP
rs1214379055 1830 dbSNP
rs185766736 1831 dbSNP
rs1270798111 1837 dbSNP
rs909968535 1839 dbSNP
rs1314138185 1851 dbSNP
rs1321899288 1864 dbSNP
rs1208332394 1866 dbSNP
rs1262583795 1867 dbSNP
rs1465444789 1871 dbSNP
rs758410113 1876 dbSNP
rs1298229051 1884 dbSNP
rs1440168937 1885 dbSNP
rs1392204137 1886 dbSNP
rs1210448426 1889 dbSNP
rs1039931489 1890 dbSNP
rs1170057384 1890 dbSNP
rs1350641984 1890 dbSNP
rs546178877 1890 dbSNP
rs879095966 1890 dbSNP
rs79416985 1892 dbSNP
rs1189768792 1894 dbSNP
rs1454176712 1895 dbSNP
rs1474933007 1897 dbSNP
rs1191534914 1906 dbSNP
rs933877424 1906 dbSNP
rs1449178201 1907 dbSNP
rs200985165 1908 dbSNP
rs80047585 1914 dbSNP
rs539140922 1915 dbSNP
rs1411988202 1916 dbSNP
rs1458366219 1919 dbSNP
rs1323087578 1922 dbSNP
rs1343968470 1925 dbSNP
rs1233304321 1933 dbSNP
rs927033162 1947 dbSNP
rs958515360 1948 dbSNP
rs1303356127 1963 dbSNP
rs1388557676 1968 dbSNP
rs1368458357 1982 dbSNP
rs1430699406 1983 dbSNP
rs17107416 1984 dbSNP
rs999854560 1986 dbSNP
rs916874162 1990 dbSNP
rs1370261961 1991 dbSNP
rs1434521067 1994 dbSNP
rs534436518 1995 dbSNP
rs1037215663 2010 dbSNP
rs894195172 2017 dbSNP
rs553091305 2024 dbSNP
rs1252110889 2028 dbSNP
rs1345516289 2031 dbSNP
rs201098838 2031 dbSNP
rs1257667033 2038 dbSNP
rs931453172 2047 dbSNP
rs1048592794 2051 dbSNP
rs1306298667 2061 dbSNP
rs1408102761 2062 dbSNP
rs1446324691 2063 dbSNP
rs1308911152 2064 dbSNP
rs1414531136 2064 dbSNP
rs1400593271 2077 dbSNP
rs1222306174 2078 dbSNP
rs577745536 2080 dbSNP
rs572621861 2091 dbSNP
rs538635074 2094 dbSNP
rs1363746034 2095 dbSNP
rs1025847185 2096 dbSNP
rs558529644 2096 dbSNP
rs951673139 2118 dbSNP
rs1186839285 2127 dbSNP
rs1484559178 2140 dbSNP
rs1006938758 2144 dbSNP
rs1473257678 2149 dbSNP
rs984069025 2157 dbSNP
rs1200827513 2158 dbSNP
rs1041169851 2162 dbSNP
rs901146821 2165 dbSNP
rs189812421 2172 dbSNP
rs1400631940 2176 dbSNP
rs533496197 2179 dbSNP
rs975543482 2183 dbSNP
rs1336498984 2188 dbSNP
rs1396992984 2203 dbSNP
rs1384817413 2207 dbSNP
rs1319176367 2209 dbSNP
rs11206028 2211 dbSNP
rs933847127 2213 dbSNP
rs1302730816 2217 dbSNP
rs1351318668 2218 dbSNP
rs1411945333 2228 dbSNP
rs1286526748 2229 dbSNP
rs968704185 2229 dbSNP
rs1350125178 2232 dbSNP
rs1000428508 2235 dbSNP
rs1041607519 2236 dbSNP
rs1034152781 2241 dbSNP
rs1427746440 2250 dbSNP
rs1259550851 2251 dbSNP
rs958788193 2264 dbSNP
rs992512862 2268 dbSNP
rs1228761846 2269 dbSNP
rs1213163255 2271 dbSNP
rs759117614 2273 dbSNP
rs769427797 2274 dbSNP
rs1245941457 2278 dbSNP
rs971725591 2279 dbSNP
rs935925079 2280 dbSNP
rs918833465 2282 dbSNP
rs1221491879 2285 dbSNP
rs931550690 2286 dbSNP
rs1390021172 2294 dbSNP
rs768447507 2300 dbSNP
rs1392395886 2301 dbSNP
rs894153636 2308 dbSNP
rs574161488 2312 dbSNP
rs1483812488 2313 dbSNP
rs1474954129 2314 dbSNP
rs1013043969 2316 dbSNP
rs911372396 2318 dbSNP
rs1231802627 2319 dbSNP
rs1252326093 2321 dbSNP
rs1198206070 2325 dbSNP
rs776355963 2328 dbSNP
rs181580472 2331 dbSNP
rs1416619656 2332 dbSNP
rs1339132790 2333 dbSNP
rs906982645 2336 dbSNP
rs1231092283 2345 dbSNP
rs1003665766 2348 dbSNP
rs1041139023 2353 dbSNP
rs1025791877 2354 dbSNP
rs1163303409 2365 dbSNP
rs901282578 2366 dbSNP
rs1332379170 2370 dbSNP
rs1323806775 2371 dbSNP
rs1408943102 2373 dbSNP
rs1368331159 2375 dbSNP
rs147763771 2377 dbSNP
rs1431851844 2381 dbSNP
rs1170198417 2382 dbSNP
rs1327123718 2399 dbSNP
rs1430205524 2399 dbSNP
rs946028234 2401 dbSNP
rs1041774516 2402 dbSNP
rs533191274 2406 dbSNP
rs1380458025 2407 dbSNP
rs1248594926 2417 dbSNP
rs1245196954 2422 dbSNP
rs1199677061 2424 dbSNP
rs1017325528 2438 dbSNP
rs1249917188 2445 dbSNP
rs1000077170 2449 dbSNP
rs545008600 2463 dbSNP
rs563293356 2464 dbSNP
rs975868352 2468 dbSNP
rs1347760436 2477 dbSNP
rs1271856027 2487 dbSNP
rs111907442 2490 dbSNP
rs1309517853 2491 dbSNP
rs1410180182 2492 dbSNP
rs567384943 2494 dbSNP
rs1188995542 2496 dbSNP
rs1374682873 2499 dbSNP
rs1173859868 2502 dbSNP
rs1173183454 2503 dbSNP
rs528269920 2503 dbSNP
rs977231283 2503 dbSNP
rs924465633 2507 dbSNP
rs546766582 2508 dbSNP
rs935873354 2512 dbSNP
rs1054390528 2516 dbSNP
rs1237198389 2516 dbSNP
rs1208483527 2517 dbSNP
rs183966778 2518 dbSNP
rs915530398 2519 dbSNP
rs1235287295 2523 dbSNP
rs1279995126 2527 dbSNP
rs72895454 2529 dbSNP
rs1045850513 2535 dbSNP
rs573586994 2537 dbSNP
rs1183577144 2538 dbSNP
rs1023989043 2540 dbSNP
rs961806785 2543 dbSNP
rs1391112659 2544 dbSNP
rs1354430407 2546 dbSNP
rs1300801671 2551 dbSNP
rs993236620 2559 dbSNP
rs556999778 2567 dbSNP
rs1451730132 2576 dbSNP
rs1317605041 2577 dbSNP
rs971797610 2584 dbSNP
rs544539819 2586 dbSNP
rs1386633771 2593 dbSNP
rs1161470305 2603 dbSNP
rs1027284910 2604 dbSNP
rs951823054 2606 dbSNP
rs984362658 2609 dbSNP
rs911493993 2610 dbSNP
rs1474003731 2623 dbSNP
rs568807954 2626 dbSNP
rs1396075377 2628 dbSNP
rs942865666 2634 dbSNP
rs976958378 2635 dbSNP
rs1404081628 2636 dbSNP
rs887295867 2637 dbSNP
rs922673549 2641 dbSNP
rs1310178076 2651 dbSNP
rs1229788128 2662 dbSNP
rs1379694571 2664 dbSNP
rs1298259308 2675 dbSNP
rs1367007592 2678 dbSNP
rs1432728566 2679 dbSNP
rs377404176 2682 dbSNP
rs900117242 2684 dbSNP
rs139483751 2689 dbSNP
rs556003132 2699 dbSNP
rs1349487578 2701 dbSNP
rs574198019 2713 dbSNP
rs955426984 2715 dbSNP
rs1415057733 2716 dbSNP
rs936011401 2722 dbSNP
rs1448138001 2724 dbSNP
rs1055700746 2725 dbSNP
rs1487895871 2731 dbSNP
rs368763299 2734 dbSNP
rs894404577 2735 dbSNP
rs1031483052 2739 dbSNP
rs957201939 2740 dbSNP
rs1249225430 2741 dbSNP
rs1466493998 2750 dbSNP
rs188742946 2751 dbSNP
rs1024123938 2755 dbSNP
rs897668635 2756 dbSNP
rs1298296990 2764 dbSNP
rs1382830803 2775 dbSNP
rs1367073647 2776 dbSNP
rs145287175 2778 dbSNP
rs577802099 2779 dbSNP
rs1168297738 2788 dbSNP
rs1428253816 2790 dbSNP
rs1174588619 2794 dbSNP
rs1392534178 2801 dbSNP
rs951734045 2807 dbSNP
rs1432087323 2808 dbSNP
rs986226057 2809 dbSNP
rs1165590449 2829 dbSNP
rs1018525987 2837 dbSNP
rs948670715 2842 dbSNP
rs981117855 2844 dbSNP
rs1488574268 2846 dbSNP
rs964324580 2852 dbSNP
rs977010595 2854 dbSNP
rs922727175 2861 dbSNP
rs1321093988 2862 dbSNP
rs1344101416 2879 dbSNP
rs1275243603 2880 dbSNP
rs1390774126 2882 dbSNP
rs1299214256 2885 dbSNP
rs967556969 2886 dbSNP
rs977503874 2898 dbSNP
rs544889567 2903 dbSNP
rs577716951 2909 dbSNP
rs941523337 2921 dbSNP
rs1234891185 2925 dbSNP
rs1280983653 2926 dbSNP
rs926058188 2928 dbSNP
rs1465928116 2934 dbSNP
rs1376454046 2951 dbSNP
rs1322168735 2960 dbSNP
rs1433302312 2962 dbSNP
rs1410737674 2969 dbSNP
rs375978092 2970 dbSNP
rs1179638014 2973 dbSNP
rs1051644345 2976 dbSNP
rs1483908857 2977 dbSNP
rs1252195719 2984 dbSNP
rs935997299 2986 dbSNP
rs1482209070 2988 dbSNP
rs527989522 2990 dbSNP
rs1269531613 2994 dbSNP
rs1324425848 2997 dbSNP
rs1487117459 3001 dbSNP
rs1287949835 3005 dbSNP
rs563545790 3006 dbSNP
rs1291799578 3010 dbSNP
rs1308093831 3010 dbSNP
rs1376494471 3010 dbSNP
rs997534519 3010 dbSNP
rs1387353778 3019 dbSNP
rs1156330279 3025 dbSNP
rs1367236771 3026 dbSNP
rs1412289767 3033 dbSNP
rs1029632379 3034 dbSNP
rs868384848 3036 dbSNP
rs915819930 3040 dbSNP
rs949934067 3043 dbSNP
rs1031754486 3051 dbSNP
rs180764094 3056 dbSNP
rs1267521798 3059 dbSNP
rs1267075978 3060 dbSNP
rs1045644367 3067 dbSNP
rs1261571015 3072 dbSNP
rs1159963826 3073 dbSNP
rs151020150 3074 dbSNP
rs993321693 3075 dbSNP
rs186093936 3080 dbSNP
rs1317901957 3083 dbSNP
rs969971862 3084 dbSNP
rs981784453 3088 dbSNP
rs928264580 3097 dbSNP
rs528335634 3098 dbSNP
rs928983703 3100 dbSNP
rs1448742100 3103 dbSNP
rs887563697 3108 dbSNP
rs983112088 3113 dbSNP
rs1285199609 3122 dbSNP
rs1209535799 3132 dbSNP
rs560543202 3138 dbSNP
rs941798982 3139 dbSNP
rs191095481 3143 dbSNP
rs965703607 3154 dbSNP
rs998414203 3156 dbSNP
rs1296097689 3161 dbSNP
rs900009580 3163 dbSNP
rs377413309 3168 dbSNP
rs1410093253 3173 dbSNP
rs1289669723 3180 dbSNP
rs1029932342 3181 dbSNP
rs890294709 3185 dbSNP
rs932893468 3192 dbSNP
rs967526211 3194 dbSNP
rs1237440231 3198 dbSNP
rs978015033 3209 dbSNP
rs1357445894 3211 dbSNP
rs1428914165 3214 dbSNP
rs181990903 3216 dbSNP
rs957717817 3221 dbSNP
rs893215799 3233 dbSNP
rs1290102861 3235 dbSNP
rs1450038737 3237 dbSNP
rs1223649778 3242 dbSNP
rs1271365817 3242 dbSNP
rs1012088575 3254 dbSNP
rs1490246813 3255 dbSNP
rs1273095623 3256 dbSNP
rs766398617 3261 dbSNP
rs1340685723 3276 dbSNP
rs1022774498 3277 dbSNP
rs375773990 3279 dbSNP
rs1183240380 3301 dbSNP
rs970299680 3303 dbSNP
rs1252691033 3307 dbSNP
rs532268693 3308 dbSNP
rs11557321 3314 dbSNP
rs915891250 3318 dbSNP
rs1368546112 3319 dbSNP
rs1180953021 3331 dbSNP
rs1369012316 3343 dbSNP
rs950070339 3344 dbSNP
rs1045611828 3353 dbSNP
rs983059941 3358 dbSNP
rs762021992 3365 dbSNP
rs140826961 3368 dbSNP
rs1249985954 3372 dbSNP
rs1207082327 3375 dbSNP
rs929139751 3377 dbSNP
rs1429979622 3381 dbSNP
rs1278586012 3386 dbSNP
rs1198206681 3390 dbSNP
rs1049402152 3402 dbSNP
rs921402030 3404 dbSNP
rs1227322274 3416 dbSNP
rs887626093 3421 dbSNP
rs1370452492 3429 dbSNP
rs1289927753 3431 dbSNP
rs1007683062 3432 dbSNP
rs1306853776 3438 dbSNP
rs1038800318 3443 dbSNP
rs901479166 3456 dbSNP
rs997212275 3469 dbSNP
rs1029901142 3470 dbSNP
rs1248889051 3473 dbSNP
rs1408476053 3474 dbSNP
rs1472353924 3475 dbSNP
rs568787794 3476 dbSNP
rs967660145 3482 dbSNP
rs1290028265 3483 dbSNP
rs999023831 3486 dbSNP
rs187423395 3488 dbSNP
rs1470744138 3490 dbSNP
rs1237397344 3495 dbSNP
rs1359196323 3497 dbSNP
rs571067688 3500 dbSNP
rs1463050851 3502 dbSNP
rs1033558218 3504 dbSNP
rs1206056720 3511 dbSNP
rs1253335781 3512 dbSNP
rs1285965054 3517 dbSNP
rs934931129 3521 dbSNP
rs957562121 3525 dbSNP
rs1053081514 3527 dbSNP
rs115995516 3537 dbSNP
rs1011622960 3557 dbSNP
rs1044883344 3558 dbSNP
rs1023036472 3561 dbSNP
rs1456816070 3576 dbSNP
rs1386699546 3582 dbSNP
rs1161627059 3583 dbSNP
rs1401646850 3584 dbSNP
rs1413436661 3592 dbSNP
rs1180490690 3594 dbSNP
rs1257005324 3596 dbSNP
rs1446361918 3599 dbSNP
rs555827258 3601 dbSNP
rs1463203004 3622 dbSNP
rs1243477851 3634 dbSNP
rs1384314623 3638 dbSNP
rs1320749764 3639 dbSNP
rs1247927690 3643 dbSNP
rs527790932 3643 dbSNP
rs774177101 3647 dbSNP
rs11557316 3651 dbSNP
rs150130645 3652 dbSNP
rs1434444553 3654 dbSNP
rs553170258 3655 dbSNP
rs1352421010 3657 dbSNP
rs919168834 3658 dbSNP
rs950623139 3660 dbSNP
rs1431678894 3661 dbSNP
rs1349535291 3663 dbSNP
rs929180269 3664 dbSNP
rs577780271 3665 dbSNP
rs1426994828 3666 dbSNP
rs1168579325 3669 dbSNP
rs1007367632 3675 dbSNP
rs909015510 3678 dbSNP
rs1018787445 3680 dbSNP
rs1015856652 3685 dbSNP
rs779265733 3686 dbSNP
rs974482350 3688 dbSNP
rs1487926811 3700 dbSNP
rs1038788363 3704 dbSNP
rs1313562939 3707 dbSNP
rs1490468755 3707 dbSNP
rs1225996102 3711 dbSNP
rs538783221 3717 dbSNP
rs932969335 3718 dbSNP
rs1229635661 3735 dbSNP
rs986955532 3743 dbSNP
rs1298254184 3747 dbSNP
rs1305958671 3750 dbSNP
rs1367130930 3756 dbSNP
rs912750397 3760 dbSNP
rs934875607 3761 dbSNP
rs1366656055 3771 dbSNP
rs543004784 3777 dbSNP
rs1307817594 3786 dbSNP
rs557407437 3787 dbSNP
rs1375309201 3792 dbSNP
rs191537378 3806 dbSNP
rs752889141 3816 dbSNP
rs145574522 3821 dbSNP
rs1432135069 3827 dbSNP
rs1422602468 3836 dbSNP
rs767178278 3842 dbSNP
rs758238299 3844 dbSNP
rs183194777 3846 dbSNP
rs902187194 3847 dbSNP
rs561307290 3851 dbSNP
rs538440721 3863 dbSNP
rs1481550865 3876 dbSNP
rs1033281776 3877 dbSNP
rs1205285644 3879 dbSNP
rs531909565 3881 dbSNP
rs1311741260 3894 dbSNP
rs187083239 3896 dbSNP
rs1288063479 3902 dbSNP
rs1465140778 3903 dbSNP
rs1056863910 3920 dbSNP
rs571736228 3930 dbSNP
rs532323387 3932 dbSNP
rs550449194 3933 dbSNP
rs1403182014 3941 dbSNP
rs1177984745 3945 dbSNP
rs1023005463 3956 dbSNP
rs1410803687 3966 dbSNP
rs1179708010 3967 dbSNP
rs1176350553 3971 dbSNP
rs1420701957 3979 dbSNP
rs1251141238 3992 dbSNP
rs1181278333 4010 dbSNP
rs1482240735 4013 dbSNP
rs1430710295 4017 dbSNP
rs562594472 4021 dbSNP
rs529714049 4023 dbSNP
rs1237309546 4025 dbSNP
rs1308163509 4025 dbSNP
rs1324489172 4025 dbSNP
rs1338076818 4025 dbSNP
rs1381250054 4025 dbSNP
rs1452779994 4025 dbSNP
rs541294177 4025 dbSNP
rs557342392 4025 dbSNP
rs60789299 4025 dbSNP
rs759774432 4025 dbSNP
rs774887021 4025 dbSNP
rs775961394 4025 dbSNP
rs1335260950 4026 dbSNP
rs1016141610 4042 dbSNP
rs1156509053 4042 dbSNP
rs1455150424 4043 dbSNP
rs1405967752 4045 dbSNP
rs1436520067 4048 dbSNP
rs981501317 4048 dbSNP
rs1244926551 4049 dbSNP
rs1026233756 4050 dbSNP
rs1461869384 4054 dbSNP
rs950766552 4055 dbSNP
rs899115227 4061 dbSNP
rs996227639 4062 dbSNP
rs1353125414 4066 dbSNP
rs1360380566 4066 dbSNP
rs1261631558 4067 dbSNP
rs985084025 4068 dbSNP
rs909161059 4069 dbSNP
rs552372707 4072 dbSNP
rs548169331 4088 dbSNP
rs1019754950 4090 dbSNP
rs943178416 4092 dbSNP
rs566100662 4093 dbSNP
rs956201486 4096 dbSNP
rs1329741360 4099 dbSNP
rs974612711 4100 dbSNP
rs923006596 4103 dbSNP
rs1386992194 4106 dbSNP
rs1164199941 4107 dbSNP
rs1448794855 4116 dbSNP
rs933021862 4117 dbSNP
rs947685461 4120 dbSNP
rs1042160364 4121 dbSNP
rs1262737954 4125 dbSNP
rs927329639 4129 dbSNP
rs902152066 4159 dbSNP
rs936381426 4160 dbSNP
rs1270626570 4166 dbSNP
rs1055100127 4175 dbSNP
rs1294587512 4184 dbSNP
rs746982174 4188 dbSNP
rs1412157286 4191 dbSNP
rs1342097581 4192 dbSNP
rs1013031315 4196 dbSNP
rs1401786021 4197 dbSNP
rs535000356 4200 dbSNP
rs1267851230 4204 dbSNP
rs1023056289 4206 dbSNP
rs907384390 4208 dbSNP
rs878924823 4210 dbSNP
rs1326622283 4213 dbSNP
rs546872201 4214 dbSNP
rs770836929 4218 dbSNP
rs1402859656 4220 dbSNP
rs571537203 4221 dbSNP
rs1672917 4250 dbSNP
rs1428973725 4252 dbSNP
rs940519481 4258 dbSNP
rs1037578465 4259 dbSNP
rs950764140 4262 dbSNP
rs745437871 4267 dbSNP
rs1282720893 4268 dbSNP
rs1016592342 4271 dbSNP
rs1351198734 4289 dbSNP
rs1199051235 4291 dbSNP
rs374459671 4315 dbSNP
rs556755357 4315 dbSNP
rs1271428585 4318 dbSNP
rs769178877 4324 dbSNP
rs557216986 4326 dbSNP
rs974664872 4329 dbSNP
rs1316068378 4332 dbSNP
rs141284834 4334 dbSNP
rs1293726740 4337 dbSNP
rs190369616 4340 dbSNP
rs1008617788 4343 dbSNP
rs1489720021 4349 dbSNP
rs554970631 4352 dbSNP
rs573240980 4355 dbSNP
rs1339554428 4357 dbSNP
rs540560223 4361 dbSNP
rs758715414 4367 dbSNP
rs1347030616 4371 dbSNP
rs1179419083 4372 dbSNP
rs1283639017 4389 dbSNP
rs988958847 4397 dbSNP
rs1333882523 4400 dbSNP
rs1411723921 4403 dbSNP
rs1397223018 4407 dbSNP
rs1175818195 4425 dbSNP
rs1468389429 4426 dbSNP
rs775244645 4430 dbSNP
rs1431766174 4431 dbSNP
rs1200562404 4432 dbSNP
rs1469991919 4435 dbSNP
rs1231659770 4437 dbSNP
rs1184688063 4449 dbSNP
rs1438910902 4456 dbSNP
rs762672212 4457 dbSNP
rs969346963 4465 dbSNP
rs936333213 4469 dbSNP
rs1325206434 4470 dbSNP
rs1263421123 4478 dbSNP
rs980399028 4484 dbSNP
rs1400686850 4485 dbSNP
rs927247452 4495 dbSNP
rs1367922384 4514 dbSNP
rs1442765570 4517 dbSNP
rs1339829454 4518 dbSNP
rs938691239 4520 dbSNP
rs1450597897 4522 dbSNP
rs1053492062 4524 dbSNP
rs77387735 4538 dbSNP
rs866699951 4545 dbSNP
rs948935573 4548 dbSNP
rs1406158922 4550 dbSNP
rs1160675652 4552 dbSNP
rs1470775024 4555 dbSNP
rs1243110935 4558 dbSNP
rs1444489005 4583 dbSNP
rs1044647234 4586 dbSNP
rs1372492080 4590 dbSNP
rs1462308853 4595 dbSNP
rs1243369449 4602 dbSNP
rs1214545616 4605 dbSNP
rs1037911185 4609 dbSNP
rs920458413 4616 dbSNP
rs1358611394 4619 dbSNP
rs1312897406 4627 dbSNP
rs907353293 4632 dbSNP
rs931852495 4637 dbSNP
rs1003024931 4664 dbSNP
rs1357031985 4665 dbSNP
rs1048257698 4666 dbSNP
rs1337478768 4666 dbSNP
rs1430214877 4669 dbSNP
rs1343683880 4679 dbSNP
rs772587366 4682 dbSNP
rs886563664 4690 dbSNP
rs1401699904 4691 dbSNP
rs1008567018 4714 dbSNP
rs1438991286 4717 dbSNP
rs1006626997 4718 dbSNP
rs1231849486 4726 dbSNP
rs892205401 4729 dbSNP
rs1470069081 4732 dbSNP
rs1184811630 4750 dbSNP
rs1016230557 4753 dbSNP
rs1387396337 4756 dbSNP
rs79234904 4758 dbSNP
rs1163120976 4759 dbSNP
rs1243532352 4777 dbSNP
rs1216216717 4779 dbSNP
rs996068863 4792 dbSNP
rs768014621 4797 dbSNP
rs1022185825 4798 dbSNP
rs773670016 4800 dbSNP
rs968914757 4801 dbSNP
rs977960015 4802 dbSNP
rs547608134 4803 dbSNP
rs1214100440 4804 dbSNP
rs1354073023 4817 dbSNP
rs1272206110 4818 dbSNP
rs1002158538 4819 dbSNP
rs1034599022 4820 dbSNP
rs753071408 4829 dbSNP
rs756444522 4832 dbSNP
rs923681029 4836 dbSNP
rs1427057814 4838 dbSNP
rs992768930 4841 dbSNP
rs1169100742 4842 dbSNP
rs1426273841 4851 dbSNP
rs544405351 4853 dbSNP
rs562494340 4861 dbSNP
rs1266436496 4867 dbSNP
rs1224481031 4868 dbSNP
rs1270598057 4894 dbSNP
rs1490483756 4899 dbSNP
rs17107426 4900 dbSNP
rs1203895307 4902 dbSNP
rs12035320 4904 dbSNP
rs866841260 4907 dbSNP
rs1271663928 4910 dbSNP
rs757282903 4915 dbSNP
rs931829048 4918 dbSNP
rs947738361 4921 dbSNP
rs1345137844 4927 dbSNP
rs1044614595 4928 dbSNP
rs1204822726 4932 dbSNP
rs944633521 4935 dbSNP
rs559749698 4936 dbSNP
rs1298164578 4937 dbSNP
rs1460025007 4938 dbSNP
rs892152959 4942 dbSNP
rs1460410908 4946 dbSNP
rs938849520 4949 dbSNP
rs1047926365 4954 dbSNP
rs1183337967 4958 dbSNP
rs1468923314 4979 dbSNP
rs41299547 4985 dbSNP
rs1201283361 4998 dbSNP
rs546937697 5006 dbSNP
rs566951652 5022 dbSNP
rs538926444 5031 dbSNP
rs1234622025 5038 dbSNP
rs1199387678 5039 dbSNP
rs1034502610 5044 dbSNP
rs1261556076 5045 dbSNP
rs752942450 5050 dbSNP
rs960253207 5056 dbSNP
rs551157082 5057 dbSNP
rs1306745675 5059 dbSNP
rs751068381 5065 dbSNP
rs569324583 5067 dbSNP
rs1331395750 5070 dbSNP
rs1451338128 5071 dbSNP
rs536768058 5072 dbSNP
rs758582967 5077 dbSNP
rs554751401 5078 dbSNP
rs1403419367 5082 dbSNP
rs1178436460 5087 dbSNP
rs1466235514 5106 dbSNP
rs1362949475 5108 dbSNP
rs1156694655 5116 dbSNP
rs1408682969 5117 dbSNP
rs182722382 5122 dbSNP
rs1460974594 5130 dbSNP
rs1403783172 5132 dbSNP
rs996205015 5139 dbSNP
rs1205738651 5141 dbSNP
rs746936384 5148 dbSNP
rs1260458183 5151 dbSNP
rs537734318 5153 dbSNP
rs1237376339 5161 dbSNP
rs962077957 5162 dbSNP
rs1451874024 5164 dbSNP
rs566918026 5172 dbSNP
rs1328039029 5175 dbSNP
rs1030252546 5187 dbSNP
rs556388315 5198 dbSNP
rs754863104 5204 dbSNP
rs1323560258 5207 dbSNP
rs1286867249 5210 dbSNP
rs781000190 5214 dbSNP
rs1030795016 5215 dbSNP
rs1380828394 5222 dbSNP
rs985970514 5223 dbSNP
rs1442711621 5230 dbSNP
rs1383403401 5232 dbSNP
rs1185526820 5234 dbSNP
rs1424576733 5235 dbSNP
rs534172479 5239 dbSNP
rs1203739075 5240 dbSNP
rs989217368 5242 dbSNP
rs1023835639 5247 dbSNP
rs969007621 5250 dbSNP
rs1487090758 5257 dbSNP
rs577880656 5276 dbSNP
rs1203651777 5282 dbSNP
rs1262801197 5297 dbSNP
rs1316481376 5302 dbSNP
rs928882544 5305 dbSNP
rs475969 5307 dbSNP
rs1293073219 5315 dbSNP
rs1383703670 5318 dbSNP
rs1360856475 5332 dbSNP
rs1241764344 5338 dbSNP
rs41301269 5351 dbSNP
rs946395430 5353 dbSNP
rs755694167 5356 dbSNP
rs138690430 5358 dbSNP
rs370746737 5358 dbSNP
rs1372712001 5362 dbSNP
rs1191212642 5363 dbSNP
rs1478930381 5365 dbSNP
rs1264286877 5368 dbSNP
rs937786363 5368 dbSNP
rs1489993622 5370 dbSNP
rs1055867331 5372 dbSNP
rs895991195 5375 dbSNP
rs78335417 5392 dbSNP
rs1037775557 5401 dbSNP
rs1469215570 5402 dbSNP
rs1229090438 5409 dbSNP
rs1159086685 5411 dbSNP
rs900628868 5431 dbSNP
rs556339259 5435 dbSNP
rs1051733884 5442 dbSNP
rs572563521 5449 dbSNP
rs890464525 5452 dbSNP
rs1347304656 5461 dbSNP
rs1317438453 5474 dbSNP
rs772730397 5478 dbSNP
rs574529245 5487 dbSNP
rs749061019 5487 dbSNP
rs1395785361 5509 dbSNP
rs776786651 5536 dbSNP
rs1031350062 5537 dbSNP
rs1467340621 5543 dbSNP
rs893628334 5544 dbSNP
rs1406464798 5547 dbSNP
rs541935370 5562 dbSNP
rs953458029 5570 dbSNP
rs1023337907 5600 dbSNP
rs1233083580 5601 dbSNP
rs1248961679 5602 dbSNP
rs187502200 5604 dbSNP
rs543191743 5612 dbSNP
rs1247749686 5629 dbSNP
rs986231414 5635 dbSNP
rs1034606870 5640 dbSNP
rs1285808787 5642 dbSNP
rs763280618 5649 dbSNP
rs1018748512 5654 dbSNP
rs951067676 5655 dbSNP
rs1490574446 5658 dbSNP
rs983691917 5662 dbSNP
rs1325332479 5663 dbSNP
rs111675772 5669 dbSNP
rs768014093 5674 dbSNP
rs1326901609 5675 dbSNP
rs200259722 5675 dbSNP
rs537206889 5675 dbSNP
rs1480153634 5686 dbSNP
rs1401284537 5690 dbSNP
rs1300319457 5691 dbSNP
rs1336400645 5696 dbSNP
rs942211558 5700 dbSNP
rs974015198 5702 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             |::||| |   :|||||| 
Target 5' aucAUGCCACU---GCACUCCa 3'
2 - 20
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760631. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             |:|:|| || |   :|||||| 
1 - 21
Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM1084064
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000294353.6 | 3UTR | UAUCAUGCCACUGCACUCCAGCCUGGGUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.499 6.5e-3 0.485 8.1e-3 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.379 3.1e-2 -0.338 4.9e-2 25 Click to see details
GSE38226 Liver fibrosis 0.273 1.2e-1 0.350 6.0e-2 21 Click to see details
GSE21687 Ependynoma primary tumors 0.121 1.7e-1 0.032 4.0e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.374 2.3e-1 0.486 1.6e-1 6 Click to see details
GSE42095 Differentiated embryonic stem cells 0.158 2.4e-1 0.476 1.1e-2 23 Click to see details
GSE27834 Pluripotent stem cells -0.191 2.4e-1 -0.206 2.2e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.15 2.4e-1 0.204 1.7e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.115 2.7e-1 -0.148 2.1e-1 32 Click to see details
GSE21849 B cell lymphoma -0.108 2.9e-1 0.221 1.2e-1 29 Click to see details
GSE14794 Lymphoblastoid cells -0.045 3.4e-1 -0.069 2.6e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.129 3.4e-1 -0.088 3.9e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.085 3.4e-1 -0.220 1.5e-1 25 Click to see details
GSE17306 Multiple myeloma -0.059 3.4e-1 -0.029 4.2e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.102 3.8e-1 0.444 7.4e-2 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.074 3.8e-1 -0.205 1.9e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.342 0.01 0.335 0.01 49 Click to see details
STAD -0.68 0.03 -0.595 0.06 8 Click to see details
KIRC 0.265 0.08 0.258 0.09 29 Click to see details
HNSC 0.795 0.21 0.500 0.33 3 Click to see details
ESCA -0.43 0.23 -0.300 0.31 5 Click to see details
KICH -0.298 0.24 -0.381 0.18 8 Click to see details
THCA 0.356 0.28 0.500 0.2 5 Click to see details
KIRP 0.112 0.39 0.267 0.24 9 Click to see details
CHOL 0.024 0.48 0.200 0.3 9 Click to see details
CHOL 0.024 0.48 0.200 0.3 9 Click to see details
CHOL 0.024 0.48 0.200 0.3 9 Click to see details
CHOL 0.024 0.48 0.200 0.3 9 Click to see details
CHOL 0.024 0.48 0.200 0.3 9 Click to see details
CHOL 0.024 0.48 0.200 0.3 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3