miRTarBase - #MIRT663496 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IYD   
Synonyms C6orf71, DEHAL1, IYD-1, TDH4
Description iodotyrosine deiodinase
Transcript NM_001164695   
Other Transcripts NM_001164694 , NM_203395   
Expression
Putative miRNA Targets on IYD
3'UTR of IYD
(miRNA target sites are highlighted)
>IYD|NM_001164695|3'UTR
   1 GCAGAATGCAGGTCTGGTGACTGTCACTACCACTCCTCTCAACTGTGGCCCTCGACTGAGGGTGCTCCTGGGCCGCCCCG
  81 CACATGAAAAGCTGCTGATGCTGCTCCCCGTGGGGTACCCCAGCAAGGAGGCCACGGTGCCTGACCTCAAGCGCAAACCT
 161 CTGGACCAGATCATGGTGACAGTGTAGGCAGGGCCCCCCAAGGGAGTGGCAGGGAGATGGCGCCCCTGCTTTTCCCTGAG
 241 CCTCTCGCCTGCTCCTCTTGGGTCTCTTGGCTGCTCTTTCTCCAGGTGTCAGGTCCCCTCATTGCTCTTCTCAGGTGGCC
 321 ACACTATGTCAAGAAGCCTCTCCACACTCTGTGGCACTTCCAGTCCCATAAATCCTGTTTCTTATCCACTTTGGAAATGC
 401 ATGAACACTTTACAAAGAACATGCCCGGGTTTTTACATTTTAAAAGTTATTCTAGACAATCACTATTGGCTTTTTTCTTT
 481 TATTTTTAAAAAACTCACATAGAGGAGACAATCAGAAATTTACCATAGTCCCAAGAATTCAGCTACATGATGACTCGAAT
 561 TTAAATTTAGATTAATCAAATGGTCTCCTGTTCTCTGATTTCTGGTGGCTTTTAGACACTAATTTTTGAGAACTACTTTT
 641 TTTTTTTTACCAAACTTCAGGGACACTCTGCTAGTTTTGAATAAGTAACCATCAAAGTTACTAAAACATGGCCAGGCGCA
 721 GTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGCAGATTGCCTGAGCTCAAGAGTTCGAGACCAGCCT
 801 GGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGCTGGGCATGCACTTGTAATTCCAGCTACTCAGG
 881 AGGCTGAGGCAAGAGAACTGCTTGAATCCGGGAGGTAGAGATTGCAGTGAGTCAAGATGCTGAGATGCCACCACTGCACT
 961 CCAGCCTGGGCAACAGAGCGAGAACCTGTCTCAAAAAAAACAAAAACAAAGTTACTAAAATGTCACCTTCACAGAACAGG
1041 ACAGGGTACCCTTGGGTCGCACGGGCCTGGCTGGCATGTAAACGGTCAGTTGCACTGCCTAGTGGTTTGGTAGATCTGAC
1121 TTGTAAGCAGTTCATAGAAGCTGCTCAATACTCAAGAATCTTGCAAGACAGTTATTAAACATTCATAGCTTGAAATTGCC
1201 CATGGTGGGAGAGTTTACATCACAACCACTACAAATCAGCACTTGCTTTCTTCTTCTTAAAGAGAGCTGCTTACCATACA
1281 TAGCACCCACAGTGTCTCCCTTCTCTTCTACCCCAACCCCTGAAACACACTGACCCCTATTCTCCAGATGACAGCACAGC
1361 TGTTTGGGACTGATAGGGTCACAGTTGCCAGGTTGGGAATGCTAGATGTAGTCTTCACCCATCACCTTCTGTCGTCCTCC
1441 CAGGGGTGTCATATTTACAGAGGCAAACTCTTACAGCTTGGATGATTTCTCATCAAGCAACTCTACTCACCTCTTTTTCC
1521 CCTTTCCCTGTGCGTTTCTTCTTCTTGTCCTCATTTTCCTTGAGAAAACTCTCTCTATAAAAAATTTCCATAGAGTATGT
1601 GGCTGATAAACAACAGAAATTTGTTTCTCACAGTTCTGGAGGCTGGAAGTCCAAGGTCGGGGTGCCCTCATGGTCAGGTG
1681 CTGGTGAGGACCCTGATCTGGGTTGCAGACTGCTGACTTCTTATTGTGTCCTCGTGGTAGAAAGAGGGTTAGAGCCTCTG
1761 GCATGCCTTTTATAAGGGTACTAATCCCATCATGAGGCCCCGTCCTTATGACCTCATCACCTCCCAAAGGACCCCCTCCT
1841 AATACCATCACATTGGGGGTTAGGGTTTCAACATATGAATTGCGGGGGACACAAACATTCCGTCCATGGCACCTACTTCA
1921 TAGGGTTTGGCATGCTGCTCGGTACATGGTTAACATTCATAAATGGTGGGGGCCCTTACTGTGGTAGAAACCATTGTCAC
2001 TGCAAGGCAGCCCTGCTTGGGATTCAGGTGAACAAATGTAACGTGGGTGGGTGAGGGACTCCCTCCTCTTCAGAGAAGCC
2081 CTCCTGTGGCTCAGGGGCAGCTGCAGGGCCAGATGGAGTTGGCCTGCAGGGAGTCAGCCTTACCCCATCAGAGACCAACT
2161 TGAAAGATTTTTTTCTCTGTGTAGTTCGTGTTATCAATCTGATCTGCAGCCAGGTTATTTACTTCTGAAGCATTGGAGTT
2241 ATCGATTGCCATTGCCCCATGGTTCTCACTCTTTGCAGGCACTCTTCAAATTTTTATTTTAAAAATTATAATGCAAACAT
2321 CTGGCCATCACCTTAACCAAGTGACAAAGTCCTAGCACACCATTAATGGTAGGATAACTGACATTAAGTGTTCCTGCTGG
2401 GATGAATTATGAAGTATTCCTTCCAAAGATGTCAATGGAAACTAATCGAGTCTTACACCTAATTTTCAGTTTACAGTAAA
2481 TACAGAGGATAAAGAAGTTAATGGCATGGTGGAATAACCAAAATGTGTATCATTCTACAAAAAAATAGGCCTGGACTATT
2561 TAAGGAGTGAGTGTCACTGTGGGAAGAATAAGAGGGGGACTGTCTTGTCCTTGCTACTCAAAGAGTGGTCCTGGGCCTGT
2641 ATCATCATTGGGACCACCTGGGCGCTTGTTAGAATCAAAGACTCTCAGGCCTCACCTAGACATCCAGAATCAAAATCTGC
2721 ATTTTAACAAGATGCCCAGGTGATCTGCATGCCTGTTAAAGTCTGAGCTCTGTTGCAGATAACCAGAGACCCAACAACCA
2801 AAGGCAAAGCGTAAGCCTTGATTGGATTTTGGTTTAGGAAAAATCTCATAGGTATAAAAGACAACTGGGAATGTTGAATG
2881 TGGATCTGGTGGTAGGTGATATTGTTAGTGATGTGAGTGATGCCTGCTGAAGTACTGAGAGATGAAGCATCATATTGACA
2961 ACTTACTCCAGGAAAAAAGGTGTGTGTATAGGTGTGTGTTTGGAGAGTGTGAGCGAGAACTAACATGGTAAAATGTTAGG
3041 TGGAGCATATACAGTTCTCATTATACTCTTATTTTAAATTTATATTTGAACACAGTCAAATCTGAATGGAAATACATTTA
3121 AATAAGCATTTCTTTCAGTCATATAAGTAATTTGCCTAAAAATGCCCTCTAAGTCCATCATTAGGTTAAGCGATTTACTG
3201 AAGGTGCAGATATCATGCTTATTTCATTGGGTTGTTTTGGAATGTCCCCCACTTGGAGAGTTTGAGGAATGGAAATGAGA
3281 ATCGGAGGAGAAATAAGGCCAGAGGCTCACATTGCTTGCAGGGAACCGACTGAGTAATGAAGAAGAGGAAGGAAGCCCTT
3361 GGAAGGAACGTAAAATCCATTTCAGCCTGCCGCCCCTTGGAATGGAGGGTCTTCTAGGGACCAGAAACACCAGACACTTC
3441 TTCTGCCCCAAGCACACCCCACACTAATTTCTGCTGCAGCATCACGATCAGGGCAAATCAGCACAGCCCCCCAGCCATCA
3521 GTGGTGTCTAGAAAAGTAAGGATAATTTTCTTCCTTCTCACTGCAGCCCCAAGCTCTTATTAACCTTCTTTTATGTGTTC
3601 ATTAAATGCAGTCATGTGACAACTGTGTTCAAAGTTAGAAATAGTGGTCGGGGAGGCTTATAGATCCTCTTGCTGTTCTG
3681 AGGCCTTAAAACCAAAAAAATAATGGAATGATTGCATCACTGCGAGGAAGTATACTTAATTAAGAAAGTTGAAAATGGTT
3761 TGTGTCTTACTAATAGGACTCACCTGAAGACTCTACTTTGCCAAGAGGGAATTTTTAACTCAAAGTTGTGTCAGCCAGCA
3841 CGGGGTAGAGCCATGGTCCTCATACTTGCTGGCATCCCTCATCTGGTGGTCTGTTAAAGCACAGATTGCTGGGCCGCACC
3921 CTCAGGGTGTGTGATTGTGTGATTCAGTATTGCTGGGTGGTGCCCAAATGCTCCAGTTCTAATGTATTCCCAGGTGTTGC
4001 TGATGCTGGTGATTGGGTACCACATTTTGAGAACCATGGGGCATTGGCAATCAACAAATGCAATGCTTGTGACTTGACGT
4081 GATAAAAGTTCATTTATTGGGCAGGCAAAGTCCTCTGCAGGCCTGGAAACCCTCCGAGACAATTACTTGCATGGGGTAAC
4161 CCAGTAATACTGTGGGATGCAACTTCTAGGGCATGGCTGCCTCCTTCCTAGAGGCAGCAGGGGGAGAAAACACTGGAAGA
4241 GGTCACCCCAACAATTCCATCGTACCTTGGCCTAGGAGTGACCTCCTCAGTCTCACAACCCTTTGGCTAGAACTAGTCAT
4321 GTGACCTCACAGGAGGTGGAGCAGTGTCGTCAATGTTATCATCCCCCTGCACCTGCAAGGAAGGAGGCCCAGATGTGTGT
4401 AGGTGCTGGATGTCTCTTCCCCAAAACATATAACTCTGGATTTGGAAAACAAAACTGGATATAACAGAAAAGAAAAGGAG
4481 GGGAGAAGGAAAGTTGAAGAAATTGGTGAAATCAGAATAGGACAGTGAAAGGCATAAAGATTTTCTTCTGAAACGCTAAG
4561 ATCGGTTGATATTTGTCTAATACAGCTTTAAATAGAGTATCACTTTGGGCCAAAGAAAATTGATATAAACATACATAAAG
4641 TGGAACTAAGATTGACTTCTTCCTAGACATCTCTGCCTCTGTCCACAAAATGGAAACTTCCATCAAGGAGTACTGGAGGA
4721 CAGTTCAGTATTTCTTCTTATTTGCTCCTCCCTATGAAAGGAAGAGTGACTTCTCTGCTGCATGATATTGGGGGTAAATA
4801 GTTATTGCACATTTGCTCAAACCCCAGCAAAGTGCACCCCATTTTAAGCCAAATTTACAAACTTACAAAGATGATCCACC
4881 AATAGTTTTCTCTATTTACTTTATTCTTGCTCTGTCACCCAGGCTAGAATGCAGTGGTGTGATTATAGCTCACTGCAGCC
4961 TCCAACTTCTGGACTCAAGTGATCCTCCCACCTTAGCTTCCCAGGTAGCTGGGATACAGGTGCACGCCACCACACCCAGG
5041 CTAGTTTTTCTAAATATTGGAGTTCCCAAAGAGTATTCAAACTGATGTGATATTTTAAAAGACATTTTGTAAGCATCTTT
5121 TAGGAATATCAGTAAGTGGAAGAAAAACACATAGTTATCAGTGGATATTATGCCAGAGAGGCATGAGAAATATAATTTTA
5201 TTTTGCTAGGTATCAGCAGAGTGCCCTCTTATAATTTGTGTGAAATGGAAACAAAGGTAACATCGTGTTTTCAATTCACA
5281 CATATATACAAGTAATGAGAGGTCCAGAAGAAATGTGGCTTCAGCTCTGCTGCTACTGTGCCTCCCTTCTCCTGCCCCAC
5361 TCAGCCCACAAAATAGGCTGGACACTCAAAAAACGTTGCGTTTATCTACCTTTTAGAGAGGGTGAATAGCAGAGAACTGG
5441 AGGTGGGAATGGTAAGGAACTCCCAGCAGGGTAGTGGAGGGAATGGGCTGACGCATCTAAGGCTGATGCCAGGTCTGCTC
5521 CCTATCTGGGTGGCCTCAGCAAATGACGTCCAGCACATCCAGGGGCAGGCTCAAGGGAGAACAGCCCCCAAAGCTAAGAT
5601 CCTGCCAAGCTAAATACAGTAGTTCTAATGAAATGTGAGAGGCTATAATCCCATTTGGGAAATTCCTAAAAAGTCATGAG
5681 GCAGGGGATTGGTTTATGTTATTATCATGACCTGAGAGTCATGGCTCAGAGCCAAATGTTCAGGATTGAATTCAACAGCA
5761 TTTAAATGTCTTTAGAGCAGGATGGAAATATGTTAGCAATGCCTGCAGAGTGCCAAGTAAACGCAAAAGCCAATGAGATC
5841 ATAAAGGAAGTTGTTAGCTAACCTAGGTGGAGTCGCCAACTTCCTTCTACTCTAATAATTAAAAATAAAAATAATACTTG
5921 GGAGGTAACTGGAATAAAGGTTCTAAAATCAAAACCCTCTGAAGGGTGAAAACTGGGAGCCTCCTGTTCCCATAGTAACC
6001 ACAGCACTCAGGGCACTGTCTCCCAGCGCTGGAGTACTGTCTTATGACCAGAGATCCTAAGCAACCTCTGCTCATCTGAG
6081 TTGTCCACCATATTGTGGGCATGAGTCCTTGACAATAGTAAATAGCACCTCTGTTCCCTTATTGGGTAAATGATTTTCCA
6161 ACTCTGGGAATGTGTAGAATTCATTATGGAAATAATGCAATAATTCAAATCCATAATATTGATACTTTCATGTTAAGTTT
6241 AGGACTAATCTTGTGTATGCTCCTTAAGTGATTTGAATCTTTAAAAAGCTTATGATTCCAATTTGAAATGTGAAATTGAT
6321 TTTACGTTTGTGATTTGAAGTTGAAAGGTATAAGAATATTTAACTTAGCTCATGAAAAGTATTAGACTAGATTTACTATA
6401 AGTTTAATGTATTAGATTTACAAGAGATGCTTAAATATATGAGAATGTTTTGTCTTAATTGGTTATAATCTTGTCATATC
6481 AATGATTTGAAGTGCTAAAATAGAAAATTAAATATGATAAATTACACAAGAAGTTTAGAATGTTTAAAAGATTTTAATAA
6561 ACAAAGCCTATAACTAAGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |||||||  |  |||||:| 
Target 5' gaAACACCA--G--ACACTTCt 3'
3424 - 3441 144.00 -16.50
2
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ||||| |   :|||||| 
Target 5' atgcCACCACT---GCACTCCa 3'
945 - 963 139.00 -17.00
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||| :||  |  ||||||: 
Target 5' caAACTTCA--GGGACACTCTg 3'
651 - 670 136.00 -13.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
257584 111 ClinVar
716354 2655 ClinVar
355678 2680 ClinVar
712375 2740 ClinVar
355691 3237 ClinVar
355692 3237 ClinVar
355700 3460 ClinVar
355712 4169 ClinVar
355753 6189 ClinVar
355766 7462 ClinVar
355782 8569 ClinVar
355791 9162 ClinVar
COSM3744981 3 COSMIC
COSM7277750 8 COSMIC
COSM4149175 36 COSMIC
COSM9827954 40 COSMIC
COSM9042724 80 COSMIC
COSM5688569 86 COSMIC
COSM5428600 112 COSMIC
COSM1074521 127 COSMIC
COSM3829293 133 COSMIC
COSM6051683 151 COSMIC
COSM5414332 169 COSMIC
COSN26458169 316 COSMIC
COSN28882545 822 COSMIC
COSN29605465 822 COSMIC
COSN23000140 922 COSMIC
COSN28191592 939 COSMIC
COSN15665260 1008 COSMIC
COSM7457563 1019 COSMIC
COSM5794993 1022 COSMIC
COSN26728981 1055 COSMIC
COSN29916522 1082 COSMIC
COSN30568513 1132 COSMIC
COSN20358878 1218 COSMIC
COSN16980713 1403 COSMIC
COSN7785950 1891 COSMIC
COSN19104854 2022 COSMIC
COSN22900699 2135 COSMIC
COSN23252313 2274 COSMIC
COSN8493818 2430 COSMIC
COSN28844470 2534 COSMIC
COSM8526968 2600 COSMIC
COSM161818 2612 COSMIC
COSM6689149 2627 COSMIC
COSM3725775 2646 COSMIC
COSM7116159 2649 COSMIC
COSM6689162 2656 COSMIC
COSM3948162 2659 COSMIC
COSM6689147 2662 COSMIC
COSM8128700 2671 COSMIC
COSM9624233 2675 COSMIC
COSM1165510 2676 COSMIC
COSM5758200 2677 COSMIC
COSM382436 2679 COSMIC
COSM1698135 2680 COSMIC
COSM4693696 2681 COSMIC
COSM3829294 2692 COSMIC
COSM5676895 2692 COSMIC
COSM6241523 2702 COSMIC
COSM5900045 2708 COSMIC
COSM1579179 2709 COSMIC
COSM5357818 2710 COSMIC
COSM4559225 2714 COSMIC
COSM1732378 2715 COSMIC
COSM7794438 2716 COSMIC
COSM7828289 2725 COSMIC
COSM7208755 2736 COSMIC
COSM6547740 2740 COSMIC
COSM8091542 2744 COSMIC
COSM1255131 2757 COSMIC
COSM8118117 2773 COSMIC
COSM6867490 2776 COSMIC
COSM9087927 2781 COSMIC
COSM5672907 2785 COSMIC
COSN32058564 2789 COSMIC
COSN28645974 2795 COSMIC
COSN26980824 2801 COSMIC
COSN30491605 2803 COSMIC
COSN30473696 2804 COSMIC
COSN30486369 2805 COSMIC
COSN30146302 2809 COSMIC
COSN28652046 2819 COSMIC
COSN508811 2859 COSMIC
COSN30101339 2901 COSMIC
COSN31558525 2911 COSMIC
COSN30524539 2931 COSMIC
COSN30138900 2958 COSMIC
COSN14704150 3132 COSMIC
COSN20103492 3248 COSMIC
COSN27312034 3249 COSMIC
COSN29491537 3398 COSMIC
COSN1326827 4063 COSMIC
COSN20920774 4165 COSMIC
COSN14728127 4502 COSMIC
COSN2147366 4595 COSMIC
COSN7694230 5403 COSMIC
COSN9497215 5604 COSMIC
COSN21394902 6193 COSMIC
COSN6589471 6680 COSMIC
COSN32058565 6735 COSMIC
COSN14796494 6783 COSMIC
COSN25604389 6863 COSMIC
COSN6589472 7048 COSMIC
COSN9497216 7387 COSMIC
COSN20103494 7464 COSMIC
COSN29922011 7522 COSMIC
COSN17884345 8000 COSMIC
COSN2147368 8388 COSMIC
COSN32198535 8409 COSMIC
COSN32057760 8445 COSMIC
COSN15604147 8464 COSMIC
COSN18900844 8503 COSMIC
COSN20103498 8506 COSMIC
COSN21329471 8519 COSMIC
COSN4919627 8789 COSMIC
COSN6308576 8895 COSMIC
COSN9497217 9342 COSMIC
COSN14834565 9512 COSMIC
COSN23349892 9693 COSMIC
COSN22900010 9807 COSMIC
COSN14949207 10314 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1377504233 4 dbSNP
rs1315809193 11 dbSNP
rs1476659652 15 dbSNP
rs1189890889 21 dbSNP
rs1320156803 21 dbSNP
rs1242235607 24 dbSNP
rs73617694 27 dbSNP
rs372758590 32 dbSNP
rs1219444051 38 dbSNP
rs1432305710 40 dbSNP
rs1356375662 41 dbSNP
rs1440176272 43 dbSNP
rs1202439426 45 dbSNP
rs1385379352 47 dbSNP
rs1016365834 48 dbSNP
rs1459436520 49 dbSNP
rs763820757 54 dbSNP
rs1363576317 55 dbSNP
rs1407673829 63 dbSNP
rs1236255328 64 dbSNP
rs75380096 66 dbSNP
rs1447945270 67 dbSNP
rs1262918250 68 dbSNP
rs1174509659 70 dbSNP
rs1423264574 75 dbSNP
rs1214801708 80 dbSNP
rs370025417 81 dbSNP
rs570975922 83 dbSNP
rs115446362 88 dbSNP
rs1402568598 97 dbSNP
rs746288487 99 dbSNP
rs745678203 102 dbSNP
rs879704806 105 dbSNP
rs377090365 109 dbSNP
rs386707040 110 dbSNP
rs612421 111 dbSNP
rs4479949 112 dbSNP
rs1285378877 117 dbSNP
rs1320888667 121 dbSNP
rs967075736 123 dbSNP
rs1327206886 124 dbSNP
rs1222539593 136 dbSNP
rs1258127670 146 dbSNP
rs1208235792 147 dbSNP
rs1319465334 149 dbSNP
rs1476018191 150 dbSNP
rs1019538958 154 dbSNP
rs1197264380 157 dbSNP
rs768884980 158 dbSNP
rs965129063 162 dbSNP
rs1452712345 167 dbSNP
rs768762764 173 dbSNP
rs774553256 178 dbSNP
rs1480201824 183 dbSNP
rs1171734787 185 dbSNP
rs748427886 186 dbSNP
rs548065860 191 dbSNP
rs933621889 196 dbSNP
rs1488976950 202 dbSNP
rs1166068792 204 dbSNP
rs1395627823 206 dbSNP
rs1387282302 208 dbSNP
rs1325212966 213 dbSNP
rs1343471043 216 dbSNP
rs1403946818 218 dbSNP
rs932297269 225 dbSNP
rs774663395 236 dbSNP
rs910770695 237 dbSNP
rs942039614 239 dbSNP
rs1391960832 244 dbSNP
rs1330746467 245 dbSNP
rs201867502 245 dbSNP
rs143130779 251 dbSNP
rs897937064 256 dbSNP
rs1169107358 257 dbSNP
rs1481633248 259 dbSNP
rs1430341810 262 dbSNP
rs1293652419 263 dbSNP
rs1477156119 273 dbSNP
rs1234725843 275 dbSNP
rs1205271811 277 dbSNP
rs56303813 278 dbSNP
rs139068258 280 dbSNP
rs906375546 287 dbSNP
rs77143354 300 dbSNP
rs907029914 301 dbSNP
rs3823259 303 dbSNP
rs1254628130 310 dbSNP
rs1279726034 314 dbSNP
rs1034686470 321 dbSNP
rs1373944520 327 dbSNP
rs1329919635 329 dbSNP
rs1471241883 335 dbSNP
rs895264785 336 dbSNP
rs1175773124 338 dbSNP
rs1413022801 340 dbSNP
rs1011213902 344 dbSNP
rs1177949037 350 dbSNP
rs1021225774 353 dbSNP
rs1260017790 360 dbSNP
rs1185403266 364 dbSNP
rs1461693237 365 dbSNP
rs994795838 369 dbSNP
rs967128066 381 dbSNP
rs1422290625 382 dbSNP
rs1027615508 394 dbSNP
rs1284540613 396 dbSNP
rs977131859 397 dbSNP
rs1350958369 405 dbSNP
rs374247224 407 dbSNP
rs1455101983 409 dbSNP
rs1400036419 422 dbSNP
rs1380490962 424 dbSNP
rs1413823211 425 dbSNP
rs1313321680 426 dbSNP
rs774867046 427 dbSNP
rs1159548876 440 dbSNP
rs1398391995 445 dbSNP
rs1419311708 446 dbSNP
rs1378598847 451 dbSNP
rs1277737242 456 dbSNP
rs1327124673 457 dbSNP
rs1229651634 459 dbSNP
rs1254297201 464 dbSNP
rs1005104929 466 dbSNP
rs1255410323 467 dbSNP
rs3823260 469 dbSNP
rs1242487714 470 dbSNP
rs966595682 471 dbSNP
rs766316283 473 dbSNP
rs1487092799 475 dbSNP
rs535246428 476 dbSNP
rs1246118206 478 dbSNP
rs1282993146 493 dbSNP
rs35116414 513 dbSNP
rs1487472936 526 dbSNP
rs1214033969 535 dbSNP
rs1227101240 540 dbSNP
rs1364594120 545 dbSNP
rs910814065 546 dbSNP
rs76373113 547 dbSNP
rs188783992 551 dbSNP
rs543072775 553 dbSNP
rs929417314 555 dbSNP
rs571911415 556 dbSNP
rs1477696383 559 dbSNP
rs1174112563 573 dbSNP
rs953777333 575 dbSNP
rs1476696459 576 dbSNP
rs1417577364 577 dbSNP
rs562945915 580 dbSNP
rs1297852871 587 dbSNP
rs906586200 588 dbSNP
rs1384113101 593 dbSNP
rs1289915039 595 dbSNP
rs1220065828 598 dbSNP
rs938525288 599 dbSNP
rs989110808 610 dbSNP
rs610171 613 dbSNP
rs796077633 621 dbSNP
rs74881079 622 dbSNP
rs78134050 623 dbSNP
rs927930008 628 dbSNP
rs1387564578 631 dbSNP
rs1390186570 639 dbSNP
rs528352741 642 dbSNP
rs939173653 643 dbSNP
rs998437763 661 dbSNP
rs1383881287 665 dbSNP
rs548412525 667 dbSNP
rs1169813933 670 dbSNP
rs73617698 678 dbSNP
rs1431073160 681 dbSNP
rs1261658771 703 dbSNP
rs1432213037 707 dbSNP
rs986728553 708 dbSNP
rs1313023121 714 dbSNP
rs1017759455 715 dbSNP
rs1178459944 727 dbSNP
rs1457780534 741 dbSNP
rs930736573 745 dbSNP
rs1049023755 766 dbSNP
rs973647094 771 dbSNP
rs530228985 788 dbSNP
rs1206526700 791 dbSNP
rs1004865486 796 dbSNP
rs1330714464 809 dbSNP
rs1299417789 812 dbSNP
rs1377668757 813 dbSNP
rs929297538 813 dbSNP
rs1264663008 814 dbSNP
rs1463987881 819 dbSNP
rs1450482949 822 dbSNP
rs1194206904 823 dbSNP
rs1465324112 835 dbSNP
rs1041015899 838 dbSNP
rs928058789 847 dbSNP
rs550253073 849 dbSNP
rs570090422 860 dbSNP
rs1157874095 862 dbSNP
rs1056063825 864 dbSNP
rs894302617 869 dbSNP
rs1029168105 871 dbSNP
rs947345989 873 dbSNP
rs1042957132 874 dbSNP
rs1254500212 888 dbSNP
rs1242501270 897 dbSNP
rs953744744 919 dbSNP
rs765883366 921 dbSNP
rs1364146342 926 dbSNP
rs1010677145 929 dbSNP
rs564701302 930 dbSNP
rs998495154 944 dbSNP
rs1395250274 945 dbSNP
rs1399706886 946 dbSNP
rs1160005102 950 dbSNP
rs1419917904 951 dbSNP
rs1455599168 955 dbSNP
rs1291935347 958 dbSNP
rs966352635 960 dbSNP
rs1445882132 965 dbSNP
rs1370726633 970 dbSNP
rs1188785982 971 dbSNP
rs1278486355 973 dbSNP
rs1442211994 974 dbSNP
rs1254507001 980 dbSNP
rs1219133267 985 dbSNP
rs773384070 987 dbSNP
rs1224545986 988 dbSNP
rs1199722719 990 dbSNP
rs1250297817 992 dbSNP
rs1357592848 993 dbSNP
rs1212170959 1002 dbSNP
rs1238083883 1006 dbSNP
rs538991617 1007 dbSNP
rs1471387753 1010 dbSNP
rs77309958 1013 dbSNP
rs75732193 1014 dbSNP
rs1490308050 1016 dbSNP
rs927867425 1017 dbSNP
rs1243967348 1026 dbSNP
rs1194617881 1029 dbSNP
rs1007301840 1030 dbSNP
rs1018227608 1031 dbSNP
rs552265079 1039 dbSNP
rs1369138460 1040 dbSNP
rs973532325 1041 dbSNP
rs1026577527 1042 dbSNP
rs1164999960 1043 dbSNP
rs566407973 1050 dbSNP
rs916429590 1051 dbSNP
rs1298603207 1054 dbSNP
rs7774077 1055 dbSNP
rs927975623 1057 dbSNP
rs1380177980 1058 dbSNP
rs1294168377 1067 dbSNP
rs938129467 1070 dbSNP
rs73617699 1072 dbSNP
rs907995718 1081 dbSNP
rs1262757415 1091 dbSNP
rs947229886 1101 dbSNP
rs1453462582 1103 dbSNP
rs1290660806 1107 dbSNP
rs192853059 1112 dbSNP
rs536769817 1118 dbSNP
rs556604376 1132 dbSNP
rs1279977278 1141 dbSNP
rs902057268 1147 dbSNP
rs996452663 1148 dbSNP
rs576848485 1151 dbSNP
rs749833219 1153 dbSNP
rs1011779537 1154 dbSNP
rs1038787447 1158 dbSNP
rs898884049 1161 dbSNP
rs1173383145 1162 dbSNP
rs1466471675 1163 dbSNP
rs185713768 1164 dbSNP
rs1191846254 1166 dbSNP
rs966489621 1168 dbSNP
rs1026469261 1170 dbSNP
rs1299188481 1171 dbSNP
rs1376014308 1172 dbSNP
rs1259935858 1175 dbSNP
rs552692427 1179 dbSNP
rs1317143126 1180 dbSNP
rs189133499 1185 dbSNP
rs1220646156 1186 dbSNP
rs1367901570 1191 dbSNP
rs960878659 1192 dbSNP
rs541719853 1193 dbSNP
rs373947463 1195 dbSNP
rs1274578475 1196 dbSNP
rs1315449997 1197 dbSNP
rs181859008 1200 dbSNP
rs951869606 1201 dbSNP
rs7769542 1203 dbSNP
rs1481558848 1204 dbSNP
rs907964703 1204 dbSNP
rs968086265 1207 dbSNP
rs866540585 1208 dbSNP
rs1256525570 1216 dbSNP
rs183756402 1218 dbSNP
rs1190253074 1219 dbSNP
rs1421597889 1220 dbSNP
rs976458756 1221 dbSNP
rs757572396 1222 dbSNP
rs934611644 1223 dbSNP
rs1296909269 1224 dbSNP
rs1051687916 1225 dbSNP
rs188089330 1226 dbSNP
rs1356830394 1227 dbSNP
rs1050652546 1229 dbSNP
rs893425444 1232 dbSNP
rs947533125 1235 dbSNP
rs181505309 1236 dbSNP
rs943060462 1236 dbSNP
rs1236664153 1237 dbSNP
rs78779451 1239 dbSNP
rs898941285 1240 dbSNP
rs9397954 1241 dbSNP
rs1035076051 1242 dbSNP
rs528783474 1244 dbSNP
rs1415023981 1247 dbSNP
rs1413212619 1248 dbSNP
rs896135806 1249 dbSNP
rs1294684096 1251 dbSNP
rs1362713867 1251 dbSNP
rs373324134 1252 dbSNP
rs568330772 1254 dbSNP
rs537281974 1255 dbSNP
rs7774404 1257 dbSNP
rs1412848564 1259 dbSNP
rs1309248030 1262 dbSNP
rs746786291 1268 dbSNP
rs755226391 1269 dbSNP
rs952006246 1269 dbSNP
rs984551883 1277 dbSNP
rs140870909 1282 dbSNP
rs1224492718 1285 dbSNP
rs1213323794 1286 dbSNP
rs962412215 1287 dbSNP
rs976173271 1288 dbSNP
rs1187231584 1289 dbSNP
rs1279155126 1290 dbSNP
rs923377309 1291 dbSNP
rs931992805 1293 dbSNP
rs775629537 1294 dbSNP
rs539152764 1295 dbSNP
rs1458436821 1296 dbSNP
rs986167956 1297 dbSNP
rs567594210 1298 dbSNP
rs978143892 1304 dbSNP
rs1314361783 1305 dbSNP
rs1358289791 1309 dbSNP
rs947625705 1311 dbSNP
rs1429576537 1314 dbSNP
rs1268895821 1317 dbSNP
rs923986414 1317 dbSNP
rs572705615 1318 dbSNP
rs1212361729 1320 dbSNP
rs1217423934 1325 dbSNP
rs1320518383 1333 dbSNP
rs1259080450 1335 dbSNP
rs903370129 1340 dbSNP
rs186239199 1341 dbSNP
rs555669420 1342 dbSNP
rs943265210 1345 dbSNP
rs896260644 1349 dbSNP
rs1323889154 1351 dbSNP
rs920252441 1352 dbSNP
rs191936003 1357 dbSNP
rs1023262808 1361 dbSNP
rs1379030636 1362 dbSNP
rs887664091 1363 dbSNP
rs1176248628 1366 dbSNP
rs1006110896 1367 dbSNP
rs1014815992 1371 dbSNP
rs372184778 1373 dbSNP
rs997791316 1374 dbSNP
rs1030412316 1375 dbSNP
rs939548801 1376 dbSNP
rs953589527 1380 dbSNP
rs1193582832 1381 dbSNP
rs181503288 1382 dbSNP
rs1455939609 1387 dbSNP
rs375673212 1389 dbSNP
rs968935098 1390 dbSNP
rs12201055 1391 dbSNP
rs924886854 1392 dbSNP
rs1399759290 1395 dbSNP
rs938856458 1397 dbSNP
rs903864825 1402 dbSNP
rs1057493896 1403 dbSNP
rs1346481356 1404 dbSNP
rs1381487141 1408 dbSNP
rs1181638868 1411 dbSNP
rs776428097 1412 dbSNP
rs1278412689 1417 dbSNP
rs71570218 1418 dbSNP
rs1371706765 1419 dbSNP
rs545929159 1420 dbSNP
rs1236774854 1423 dbSNP
rs1313121167 1423 dbSNP
rs1491324361 1423 dbSNP
rs1158559435 1424 dbSNP
rs1370603879 1424 dbSNP
rs1395193502 1424 dbSNP
rs1419779763 1424 dbSNP
rs1491435104 1424 dbSNP
rs199817229 1424 dbSNP
rs546981400 1424 dbSNP
rs59328359 1424 dbSNP
rs750167055 1424 dbSNP
rs1188718875 1426 dbSNP
rs1349596090 1427 dbSNP
rs999447821 1430 dbSNP
rs1255688517 1439 dbSNP
rs1224554860 1440 dbSNP
rs1286547224 1442 dbSNP
rs917638478 1443 dbSNP
rs947816759 1444 dbSNP
rs1044685221 1463 dbSNP
rs1358414715 1466 dbSNP
rs1265904707 1474 dbSNP
rs887424377 1475 dbSNP
rs1253692238 1476 dbSNP
rs955617185 1479 dbSNP
rs1400216435 1483 dbSNP
rs1315580496 1485 dbSNP
rs987343503 1485 dbSNP
rs559718570 1489 dbSNP
rs1005869453 1495 dbSNP
rs1177243699 1497 dbSNP
rs1019183746 1498 dbSNP
rs1036272672 1502 dbSNP
rs551524909 1503 dbSNP
rs528439598 1505 dbSNP
rs1416124219 1506 dbSNP
rs548161932 1516 dbSNP
rs997319445 1527 dbSNP
rs12214529 1535 dbSNP
rs1191138689 1539 dbSNP
rs1453338489 1552 dbSNP
rs1267977008 1557 dbSNP
rs953459599 1560 dbSNP
rs1212983944 1564 dbSNP
rs1332486872 1570 dbSNP
rs1259727828 1571 dbSNP
rs1218905055 1573 dbSNP
rs920472475 1574 dbSNP
rs1007666170 1584 dbSNP
rs1438008941 1589 dbSNP
rs1021742206 1591 dbSNP
rs7762616 1601 dbSNP
rs977455167 1608 dbSNP
rs1440785585 1611 dbSNP
rs58125059 1611 dbSNP
rs72113558 1611 dbSNP
rs1173309455 1612 dbSNP
rs1419090228 1613 dbSNP
rs1459532458 1613 dbSNP
rs939085289 1616 dbSNP
rs1163654223 1617 dbSNP
rs1479085281 1619 dbSNP
rs924887973 1627 dbSNP
rs960573603 1629 dbSNP
rs1192986612 1634 dbSNP
rs1467061123 1640 dbSNP
rs1239892316 1642 dbSNP
rs1199067160 1643 dbSNP
rs1056667530 1649 dbSNP
rs895300306 1653 dbSNP
rs948183831 1680 dbSNP
rs1345167947 1681 dbSNP
rs1462948961 1688 dbSNP
rs147023324 1689 dbSNP
rs916080225 1697 dbSNP
rs1369452698 1703 dbSNP
rs1333886301 1710 dbSNP
rs570917198 1712 dbSNP
rs1354307042 1716 dbSNP
rs752647362 1716 dbSNP
rs1327168989 1718 dbSNP
rs999498694 1720 dbSNP
rs1044777095 1721 dbSNP
rs1031400539 1729 dbSNP
rs908998555 1734 dbSNP
rs1173128104 1743 dbSNP
rs1452609572 1747 dbSNP
rs1281038619 1757 dbSNP
rs941695336 1759 dbSNP
rs572674828 1764 dbSNP
rs1230940052 1773 dbSNP
rs1018820541 1774 dbSNP
rs1442670498 1792 dbSNP
rs897707051 1793 dbSNP
rs964906983 1796 dbSNP
rs1208119471 1800 dbSNP
rs933246329 1801 dbSNP
rs1273896105 1818 dbSNP
rs1051581520 1820 dbSNP
rs974540747 1827 dbSNP
rs12530375 1833 dbSNP
rs1376315711 1837 dbSNP
rs1312445941 1841 dbSNP
rs1432951547 1844 dbSNP
rs1007428794 1869 dbSNP
rs1159819262 1871 dbSNP
rs1400008300 1872 dbSNP
rs983139213 1882 dbSNP
rs1183398361 1884 dbSNP
rs907524466 1888 dbSNP
rs762422987 1890 dbSNP
rs1236076469 1891 dbSNP
rs1489017500 1894 dbSNP
rs960526334 1897 dbSNP
rs904649064 1917 dbSNP
rs1316876873 1920 dbSNP
rs992318873 1927 dbSNP
rs1315070932 1933 dbSNP
rs1356429567 1936 dbSNP
rs998829226 1945 dbSNP
rs1413154239 1957 dbSNP
rs1417963128 1964 dbSNP
rs57376755 1968 dbSNP
rs1166118683 1973 dbSNP
rs948234682 1975 dbSNP
rs960293401 1980 dbSNP
rs751204929 1982 dbSNP
rs138289572 1988 dbSNP
rs1330725772 1991 dbSNP
rs1373323948 1995 dbSNP
rs1416878749 1998 dbSNP
rs935570608 2009 dbSNP
rs555396232 2016 dbSNP
rs1052482525 2017 dbSNP
rs575648921 2019 dbSNP
rs1261948716 2027 dbSNP
rs970190661 2032 dbSNP
rs1414410788 2037 dbSNP
rs1185454722 2040 dbSNP
rs1294082330 2044 dbSNP
rs762652609 2049 dbSNP
rs1484575020 2054 dbSNP
rs1357486113 2057 dbSNP
rs1224429225 2065 dbSNP
rs868250795 2066 dbSNP
rs908926268 2067 dbSNP
rs941791981 2069 dbSNP
rs538096006 2070 dbSNP
rs1296487982 2077 dbSNP
rs918936667 2081 dbSNP
rs933024543 2091 dbSNP
rs557934116 2098 dbSNP
rs1359949174 2100 dbSNP
rs1198067288 2102 dbSNP
rs1441515086 2104 dbSNP
rs1276949937 2109 dbSNP
rs1485513961 2113 dbSNP
rs1311644067 2119 dbSNP
rs1323683234 2119 dbSNP
rs1393508139 2119 dbSNP
rs67591922 2120 dbSNP
rs747971279 2120 dbSNP
rs950501812 2120 dbSNP
rs1196112659 2122 dbSNP
rs1469328398 2124 dbSNP
rs1209734282 2125 dbSNP
rs1252864023 2125 dbSNP
rs377471791 2126 dbSNP
rs1475966143 2127 dbSNP
rs1190458453 2128 dbSNP
rs1252173503 2129 dbSNP
rs891120967 2129 dbSNP
rs1305886643 2130 dbSNP
rs199594163 2130 dbSNP
rs630186 2131 dbSNP
rs765869613 2131 dbSNP
rs1301086744 2132 dbSNP
rs1419682659 2132 dbSNP
rs1448725335 2133 dbSNP
rs1460134828 2133 dbSNP
rs1360432196 2134 dbSNP
rs546293643 2134 dbSNP
rs1475704242 2135 dbSNP
rs1453204248 2136 dbSNP
rs1491009057 2136 dbSNP
rs1052103887 2137 dbSNP
rs1192300427 2137 dbSNP
rs372716452 2137 dbSNP
rs11382566 2138 dbSNP
rs1008191232 2139 dbSNP
rs1433824338 2140 dbSNP
rs1195483305 2143 dbSNP
rs889070945 2144 dbSNP
rs1040202714 2145 dbSNP
rs867200998 2147 dbSNP
rs1317810656 2148 dbSNP
rs996029435 2149 dbSNP
rs559625093 2150 dbSNP
rs11760118 2153 dbSNP
rs751046049 2163 dbSNP
rs1336184539 2164 dbSNP
rs73619503 2173 dbSNP
rs756701986 2175 dbSNP
rs543066747 2176 dbSNP
rs1380904862 2182 dbSNP
rs1313033437 2190 dbSNP
rs1014803774 2207 dbSNP
rs561738938 2208 dbSNP
rs764642753 2209 dbSNP
rs1172368174 2210 dbSNP
rs1282883631 2220 dbSNP
rs1455776345 2222 dbSNP
rs1364837464 2223 dbSNP
rs991808223 2228 dbSNP
rs1417645122 2237 dbSNP
rs766664876 2240 dbSNP
rs1014289600 2245 dbSNP
rs1188918469 2247 dbSNP
rs62432540 2261 dbSNP
rs1202932037 2272 dbSNP
rs970285435 2273 dbSNP
rs984218214 2274 dbSNP
rs1351354384 2281 dbSNP
rs1195278280 2289 dbSNP
rs1236615370 2290 dbSNP
rs1393241218 2292 dbSNP
rs376972158 2295 dbSNP
rs1293586921 2299 dbSNP
rs1453706624 2301 dbSNP
rs1174093926 2307 dbSNP
rs1353064521 2309 dbSNP
rs925448905 2310 dbSNP
rs1382248055 2311 dbSNP
rs1386334279 2322 dbSNP
rs1158431873 2328 dbSNP
rs1451897738 2331 dbSNP
rs1420457840 2335 dbSNP
rs62432541 2352 dbSNP
rs1474988186 2353 dbSNP
rs1385786539 2361 dbSNP
rs1255623910 2366 dbSNP
rs1195430549 2367 dbSNP
rs963074673 2386 dbSNP
rs1261031464 2398 dbSNP
rs779621790 2401 dbSNP
rs1203296559 2402 dbSNP
rs1383951524 2406 dbSNP
rs1336733501 2409 dbSNP
rs1273546640 2410 dbSNP
rs972205724 2411 dbSNP
rs1323936839 2413 dbSNP
rs919041943 2414 dbSNP
rs1227528054 2415 dbSNP
rs932973312 2418 dbSNP
rs1442263334 2419 dbSNP
rs987194787 2422 dbSNP
rs1306175258 2423 dbSNP
rs910433331 2428 dbSNP
rs1397199111 2430 dbSNP
rs946543619 2431 dbSNP
rs564726818 2436 dbSNP
rs34368065 2438 dbSNP
rs1039685735 2439 dbSNP
rs899941631 2444 dbSNP
rs1169865836 2449 dbSNP
rs995578379 2450 dbSNP
rs1372551923 2451 dbSNP
rs1190983174 2453 dbSNP
rs1048962846 2462 dbSNP
rs1253494945 2472 dbSNP
rs887612318 2473 dbSNP
rs1004684368 2477 dbSNP
rs1274761423 2479 dbSNP
rs1015268532 2487 dbSNP
rs1210109672 2492 dbSNP
rs1338238406 2495 dbSNP
rs1043532755 2496 dbSNP
rs1235803360 2501 dbSNP
rs1373862032 2511 dbSNP
rs1304739625 2515 dbSNP
rs960631686 2518 dbSNP
rs1194114331 2520 dbSNP
rs1013692454 2522 dbSNP
rs748214500 2527 dbSNP
rs969142036 2540 dbSNP
rs934537779 2547 dbSNP
rs533332585 2548 dbSNP
rs1032015031 2550 dbSNP
rs1313604962 2555 dbSNP
rs895938436 2557 dbSNP
rs751123570 2560 dbSNP
rs761487330 2562 dbSNP
rs767227607 2563 dbSNP
rs1288643628 2566 dbSNP
rs1484981510 2572 dbSNP
rs758446257 2574 dbSNP
rs1234374239 2581 dbSNP
rs1204832553 2583 dbSNP
rs750134943 2591 dbSNP
rs1425676541 2593 dbSNP
rs755984631 2594 dbSNP
rs138679389 2605 dbSNP
rs753839381 2610 dbSNP
rs1014630709 2612 dbSNP
rs1158953029 2613 dbSNP
rs750120687 2615 dbSNP
rs755037990 2615 dbSNP
rs988299966 2616 dbSNP
rs778906350 2618 dbSNP
rs1044382311 2620 dbSNP
rs778003823 2623 dbSNP
rs1287996137 2625 dbSNP
rs912826182 2634 dbSNP
rs1365977063 2636 dbSNP
rs772146561 2644 dbSNP
rs778081545 2645 dbSNP
rs1281671695 2646 dbSNP
rs1334148969 2649 dbSNP
rs747316491 2652 dbSNP
rs186449515 2654 dbSNP
rs73619510 2655 dbSNP
rs1436737360 2657 dbSNP
rs1315573594 2660 dbSNP
rs921262460 2662 dbSNP
rs202223369 2663 dbSNP
rs773956205 2666 dbSNP
rs761428166 2667 dbSNP
rs767052537 2668 dbSNP
rs750130138 2675 dbSNP
rs369994249 2676 dbSNP
rs1179246518 2678 dbSNP
rs200771803 2680 dbSNP
rs376409306 2681 dbSNP
rs1189602761 2682 dbSNP
rs754844753 2686 dbSNP
rs17854906 2697 dbSNP
rs778854875 2699 dbSNP
rs752727675 2700 dbSNP
rs371592620 2710 dbSNP
rs777830615 2711 dbSNP
rs1404794107 2716 dbSNP
rs747326363 2723 dbSNP
rs144729952 2725 dbSNP
rs781631921 2728 dbSNP
rs1416833599 2729 dbSNP
rs36063028 2729 dbSNP
rs1356221593 2731 dbSNP
rs141250255 2736 dbSNP
rs368233638 2737 dbSNP
rs1221922233 2738 dbSNP
rs1159664102 2739 dbSNP
rs771678940 2740 dbSNP
rs372023699 2741 dbSNP
rs934484161 2744 dbSNP
rs760317121 2749 dbSNP
rs1234579635 2752 dbSNP
rs1052959039 2753 dbSNP
rs917286641 2754 dbSNP
rs1000455981 2757 dbSNP
rs765952815 2760 dbSNP
rs755987952 2768 dbSNP
rs557732058 2774 dbSNP
rs1173892900 2775 dbSNP
rs1032066874 2777 dbSNP
rs1244398563 2782 dbSNP
rs775449079 2787 dbSNP
rs1465734393 2788 dbSNP
rs886061167 2791 dbSNP
rs375061738 2793 dbSNP
rs759349874 2794 dbSNP
rs766336153 2794 dbSNP
rs2076286 2795 dbSNP
rs1005538229 2796 dbSNP
rs764295810 2797 dbSNP
rs751591526 2799 dbSNP
rs757456538 2800 dbSNP
rs1282930353 2802 dbSNP
rs781585023 2804 dbSNP
rs746209507 2805 dbSNP
rs1029839982 2807 dbSNP
rs1271010004 2808 dbSNP
rs756585423 2810 dbSNP
rs780702101 2813 dbSNP
rs935442437 2816 dbSNP
rs1490790586 2817 dbSNP
rs954585212 2818 dbSNP
rs2076285 2819 dbSNP
rs1327693754 2820 dbSNP
rs375902260 2822 dbSNP
rs746533729 2823 dbSNP
rs770523357 2826 dbSNP
rs776316943 2827 dbSNP
rs1429836595 2828 dbSNP
rs6916275 2829 dbSNP
rs765086846 2830 dbSNP
rs1367817928 2835 dbSNP
rs775280647 2838 dbSNP
rs921481339 2842 dbSNP
rs1399007228 2847 dbSNP
rs561751337 2848 dbSNP
rs886061168 2849 dbSNP
rs931313685 2872 dbSNP
rs1272864205 2875 dbSNP
rs1219614723 2876 dbSNP
rs575208977 2881 dbSNP
rs544907783 2882 dbSNP
rs1296421174 2885 dbSNP
rs925861794 2889 dbSNP
rs956017670 2894 dbSNP
rs989038694 2898 dbSNP
rs908648964 2899 dbSNP
rs940104934 2902 dbSNP
rs1463171955 2903 dbSNP
rs1233407292 2920 dbSNP
rs1036637096 2927 dbSNP
rs896315713 2932 dbSNP
rs564663691 2938 dbSNP
rs1388867847 2951 dbSNP
rs533657803 2955 dbSNP
rs1196053096 2957 dbSNP
rs949205111 2958 dbSNP
rs917113916 2961 dbSNP
rs905091627 2965 dbSNP
rs1481753081 2966 dbSNP
rs886061169 2969 dbSNP
rs949906539 2973 dbSNP
rs1203918593 2976 dbSNP
rs773994804 2990 dbSNP
rs1305752370 2995 dbSNP
rs546916403 2996 dbSNP
rs980127675 3003 dbSNP
rs1031951427 3006 dbSNP
rs1203727325 3008 dbSNP
rs1234905170 3021 dbSNP
rs1251677564 3023 dbSNP
rs372416788 3027 dbSNP
rs377077837 3027 dbSNP
rs2076284 3028 dbSNP
rs115654530 3029 dbSNP
rs1297181824 3032 dbSNP
rs897390812 3037 dbSNP
rs996988393 3047 dbSNP
rs1176118601 3049 dbSNP
rs1443127848 3061 dbSNP
rs1377509339 3065 dbSNP
rs1174413522 3066 dbSNP
rs1486109413 3088 dbSNP
rs191221830 3095 dbSNP
rs1183732638 3098 dbSNP
rs930270755 3099 dbSNP
rs370299286 3104 dbSNP
rs1181711864 3105 dbSNP
rs1051680770 3110 dbSNP
rs1482142806 3111 dbSNP
rs891269111 3113 dbSNP
rs781503445 3116 dbSNP
rs675804 3125 dbSNP
rs1344249320 3126 dbSNP
rs1375161343 3134 dbSNP
rs1433198655 3147 dbSNP
rs984148393 3148 dbSNP
rs1240925838 3149 dbSNP
rs60286185 3157 dbSNP
rs1407596767 3158 dbSNP
rs1356926802 3162 dbSNP
rs1312979558 3179 dbSNP
rs1413563994 3180 dbSNP
rs1374521469 3184 dbSNP
rs1301600757 3191 dbSNP
rs1455728846 3193 dbSNP
rs1364716577 3195 dbSNP
rs1158759412 3216 dbSNP
rs1471751866 3220 dbSNP
rs1420232638 3221 dbSNP
rs1188764563 3236 dbSNP
rs1206813691 3237 dbSNP
rs1449789680 3237 dbSNP
rs565361648 3237 dbSNP
rs61597872 3237 dbSNP
rs796976552 3237 dbSNP
rs900294908 3245 dbSNP
rs999856322 3247 dbSNP
rs200663182 3248 dbSNP
rs1032709150 3249 dbSNP
rs1491352606 3249 dbSNP
rs1293453400 3250 dbSNP
rs1304143908 3252 dbSNP
rs1232219557 3261 dbSNP
rs956133279 3266 dbSNP
rs886061170 3267 dbSNP
rs1332824840 3271 dbSNP
rs1384388072 3274 dbSNP
rs1024656550 3280 dbSNP
rs971170855 3282 dbSNP
rs765806953 3284 dbSNP
rs551333912 3288 dbSNP
rs1296157802 3296 dbSNP
rs979908341 3298 dbSNP
rs1231875497 3307 dbSNP
rs1396969519 3310 dbSNP
rs150215575 3318 dbSNP
rs6921360 3319 dbSNP
rs1195295888 3321 dbSNP
rs1044855221 3328 dbSNP
rs535377347 3335 dbSNP
rs936579643 3337 dbSNP
rs1212430504 3339 dbSNP
rs886061171 3341 dbSNP
rs974466183 3348 dbSNP
rs183339748 3351 dbSNP
rs929984119 3358 dbSNP
rs186932363 3359 dbSNP
rs891377539 3364 dbSNP
rs1453092223 3368 dbSNP
rs1366577619 3369 dbSNP
rs1297428559 3372 dbSNP
rs1433436187 3379 dbSNP
rs773053365 3380 dbSNP
rs942845635 3390 dbSNP
rs1173466247 3393 dbSNP
rs1040810962 3397 dbSNP
rs747181072 3398 dbSNP
rs1388779780 3408 dbSNP
rs900241094 3410 dbSNP
rs999971765 3419 dbSNP
rs1389544955 3422 dbSNP
rs1186593038 3429 dbSNP
rs1455454076 3430 dbSNP
rs997040576 3436 dbSNP
rs1197839921 3440 dbSNP
rs1028480168 3442 dbSNP
rs1274594413 3443 dbSNP
rs1033195601 3445 dbSNP
rs1195885119 3448 dbSNP
rs1340824368 3455 dbSNP
rs757408803 3456 dbSNP
rs201924267 3457 dbSNP
rs374913437 3459 dbSNP
rs6938901 3460 dbSNP
rs6909655 3461 dbSNP
rs1275830089 3463 dbSNP
rs1024186680 3481 dbSNP
rs575320262 3502 dbSNP
rs552732246 3510 dbSNP
rs774020729 3511 dbSNP
rs1369993764 3512 dbSNP
rs1348260128 3516 dbSNP
rs1436529734 3516 dbSNP
rs962748867 3517 dbSNP
rs1476884564 3518 dbSNP
rs558132966 3523 dbSNP
rs936632180 3529 dbSNP
rs578192509 3532 dbSNP
rs1053716539 3542 dbSNP
rs7742659 3544 dbSNP
rs1248953960 3552 dbSNP
rs918677894 3556 dbSNP
rs769610221 3568 dbSNP
rs183369866 3569 dbSNP
rs1467576569 3574 dbSNP
rs1219071882 3575 dbSNP
rs529474029 3580 dbSNP
rs11962096 3582 dbSNP
rs888617345 3583 dbSNP
rs942963114 3586 dbSNP
rs1479181800 3587 dbSNP
rs1359684576 3591 dbSNP
rs1005691084 3593 dbSNP
rs1412608305 3593 dbSNP
rs1409846861 3595 dbSNP
rs1158834104 3601 dbSNP
rs1405405787 3604 dbSNP
rs1039878828 3608 dbSNP
rs897379185 3611 dbSNP
rs562598290 3633 dbSNP
rs531431703 3645 dbSNP
rs866364448 3650 dbSNP
rs1459825376 3651 dbSNP
rs115313333 3652 dbSNP
rs773725663 3656 dbSNP
rs1209996538 3657 dbSNP
rs761441089 3659 dbSNP
rs767100639 3660 dbSNP
rs970151159 3662 dbSNP
rs1438390196 3663 dbSNP
rs1009902441 3664 dbSNP
rs980155360 3666 dbSNP
rs1372942384 3668 dbSNP
rs1033019354 3670 dbSNP
rs1445699351 3677 dbSNP
rs571183281 3680 dbSNP
rs1321009653 3689 dbSNP
rs1456457650 3696 dbSNP
rs1045842726 3700 dbSNP
rs527594355 3705 dbSNP
rs371311730 3706 dbSNP
rs957878090 3707 dbSNP
rs547641965 3710 dbSNP
rs989695194 3717 dbSNP
rs1290295848 3723 dbSNP
rs1179561340 3724 dbSNP
rs1472114478 3725 dbSNP
rs1001429887 3730 dbSNP
rs1034247165 3735 dbSNP
rs962488948 3748 dbSNP
rs773037621 3753 dbSNP
rs1025727078 3755 dbSNP
rs1464717589 3759 dbSNP
rs951582740 3760 dbSNP
rs1215751953 3764 dbSNP
rs1322453966 3769 dbSNP
rs1289266831 3770 dbSNP
rs1274395737 3786 dbSNP
rs567141048 3790 dbSNP
rs986807438 3791 dbSNP
rs912592713 3801 dbSNP
rs1298232126 3802 dbSNP
rs536079140 3803 dbSNP
rs1362734951 3805 dbSNP
rs922258253 3806 dbSNP
rs975634052 3808 dbSNP
rs1458118044 3810 dbSNP
rs1348900567 3828 dbSNP
rs1162097325 3833 dbSNP
rs925533652 3844 dbSNP
rs866337073 3849 dbSNP
rs672605 3854 dbSNP
rs1202939205 3860 dbSNP
rs1232660613 3862 dbSNP
rs1189768759 3867 dbSNP
rs1449282427 3868 dbSNP
rs1053071339 3876 dbSNP
rs187855996 3880 dbSNP
rs1195831306 3881 dbSNP
rs1488945096 3884 dbSNP
rs888169504 3887 dbSNP
rs945814210 3888 dbSNP
rs563592613 3893 dbSNP
rs1182382545 3905 dbSNP
rs9322260 3909 dbSNP
rs906852924 3911 dbSNP
rs763367917 3912 dbSNP
rs62432542 3917 dbSNP
rs898419081 3932 dbSNP
rs1387070702 3940 dbSNP
rs577938626 3949 dbSNP
rs1391420900 3950 dbSNP
rs1407001445 3956 dbSNP
rs1443827942 3975 dbSNP
rs1326681151 3976 dbSNP
rs1014913568 3978 dbSNP
rs601223 3986 dbSNP
rs1388811290 3988 dbSNP
rs554538647 3992 dbSNP
rs1178690297 3993 dbSNP
rs574364565 3993 dbSNP
rs780205374 3994 dbSNP
rs1410680768 3996 dbSNP
rs1267025054 4003 dbSNP
rs1189667092 4006 dbSNP
rs1484106854 4008 dbSNP
rs1290393300 4013 dbSNP
rs1252659368 4017 dbSNP
rs1204476204 4020 dbSNP
rs1001457766 4022 dbSNP
rs543290065 4032 dbSNP
rs6901038 4034 dbSNP
rs868805117 4035 dbSNP
rs1298790287 4037 dbSNP
rs1293970158 4038 dbSNP
rs542628325 4046 dbSNP
rs989356897 4047 dbSNP
rs1369255190 4051 dbSNP
rs1213258307 4114 dbSNP
rs1466915070 4118 dbSNP
rs1377405550 4119 dbSNP
rs1021197063 4122 dbSNP
rs1473714431 4131 dbSNP
rs117655742 4134 dbSNP
rs1438706299 4135 dbSNP
rs977075070 4147 dbSNP
rs1253582384 4149 dbSNP
rs1258260424 4152 dbSNP
rs149396571 4153 dbSNP
rs922477416 4162 dbSNP
rs1368532797 4164 dbSNP
rs1210314872 4165 dbSNP
rs975414953 4166 dbSNP
rs886061172 4169 dbSNP
rs1329432119 4179 dbSNP
rs1473737957 4185 dbSNP
rs1226098439 4191 dbSNP
rs571428691 4193 dbSNP
rs866630028 4194 dbSNP
rs1032593235 4195 dbSNP
rs1166026274 4197 dbSNP
rs958565746 4198 dbSNP
rs73619523 4199 dbSNP
rs193155130 4205 dbSNP
rs1301466102 4212 dbSNP
rs949596831 4219 dbSNP
rs1373936738 4230 dbSNP
rs1389736380 4237 dbSNP
rs1414394260 4238 dbSNP
rs981126443 4243 dbSNP
rs941097410 4250 dbSNP
rs755090955 4255 dbSNP
rs1037236059 4260 dbSNP
rs1342285288 4267 dbSNP
rs928394078 4271 dbSNP
rs1429270917 4272 dbSNP
rs936967142 4273 dbSNP
rs1270089023 4285 dbSNP
rs1340643516 4299 dbSNP
rs796590097 4302 dbSNP
rs1055423688 4304 dbSNP
rs897312590 4311 dbSNP
rs1278611455 4316 dbSNP
rs660153 4323 dbSNP
rs931249182 4334 dbSNP
rs72998948 4335 dbSNP
rs1311192073 4337 dbSNP
rs1256258019 4341 dbSNP
rs769705321 4344 dbSNP
rs906100640 4345 dbSNP
rs886914454 4346 dbSNP
rs1008073120 4347 dbSNP
rs1393094359 4356 dbSNP
rs1163911866 4357 dbSNP
rs1457418742 4358 dbSNP
rs1366702007 4359 dbSNP
rs560878398 4362 dbSNP
rs1449905387 4364 dbSNP
rs1019671109 4365 dbSNP
rs1241485097 4367 dbSNP
rs899957925 4369 dbSNP
rs1452981911 4374 dbSNP
rs1267543280 4375 dbSNP
rs1170329960 4378 dbSNP
rs1208787574 4387 dbSNP
rs1392964875 4396 dbSNP
rs529938065 4400 dbSNP
rs1290271294 4401 dbSNP
rs386707042 4402 dbSNP
rs879258240 4402 dbSNP
rs599339 4403 dbSNP
rs659737 4404 dbSNP
rs1324436707 4405 dbSNP
rs997998248 4414 dbSNP
rs1388644468 4420 dbSNP
rs1404486130 4425 dbSNP
rs749689021 4432 dbSNP
rs1317703913 4434 dbSNP
rs1389411111 4441 dbSNP
rs953927356 4442 dbSNP
rs988774945 4444 dbSNP
rs1377913395 4447 dbSNP
rs1197687207 4453 dbSNP
rs1449423596 4454 dbSNP
rs35209272 4461 dbSNP
rs1437892107 4464 dbSNP
rs971268223 4469 dbSNP
rs1301706130 4475 dbSNP
rs1274472447 4484 dbSNP
rs543815399 4485 dbSNP
rs1347572930 4486 dbSNP
rs116064065 4489 dbSNP
rs1232842292 4490 dbSNP
rs34257671 4502 dbSNP
rs534225787 4503 dbSNP
rs1369936529 4506 dbSNP
rs919563660 4510 dbSNP
rs146369688 4513 dbSNP
rs1282936514 4514 dbSNP
rs931009885 4517 dbSNP
rs1402618765 4522 dbSNP
rs1171729139 4524 dbSNP
rs185342498 4525 dbSNP
rs1047388971 4526 dbSNP
rs887034046 4541 dbSNP
rs886061173 4542 dbSNP
rs866995146 4543 dbSNP
rs1453534726 4545 dbSNP
rs1202995022 4546 dbSNP
rs536906067 4548 dbSNP
rs80030954 4550 dbSNP
rs1200174080 4555 dbSNP
rs1042206059 4556 dbSNP
rs374654397 4559 dbSNP
rs763425035 4560 dbSNP
rs1290431773 4570 dbSNP
rs901904891 4574 dbSNP
rs1451873053 4577 dbSNP
rs1277754500 4580 dbSNP
rs544793302 4592 dbSNP
rs139736929 4594 dbSNP
rs1029491137 4604 dbSNP
rs1032444910 4611 dbSNP
rs143064277 4618 dbSNP
rs146165286 4621 dbSNP
rs1390453186 4623 dbSNP
rs1159434166 4624 dbSNP
rs1016823011 4626 dbSNP
rs1183059989 4628 dbSNP
rs1474063601 4631 dbSNP
rs761836939 4634 dbSNP
rs1324411840 4638 dbSNP
rs1394246925 4639 dbSNP
rs962701147 4643 dbSNP
rs587713 4644 dbSNP
rs918354682 4648 dbSNP
rs1230032767 4654 dbSNP
rs529950454 4666 dbSNP
rs1283512322 4682 dbSNP
rs1033835138 4687 dbSNP
rs1287172526 4688 dbSNP
rs927463265 4689 dbSNP
rs1433948430 4692 dbSNP
rs959551671 4701 dbSNP
rs1329180616 4708 dbSNP
rs1166314523 4712 dbSNP
rs937469171 4716 dbSNP
rs1054641534 4725 dbSNP
rs914798906 4726 dbSNP
rs372840878 4729 dbSNP
rs1041701924 4731 dbSNP
rs1269201689 4732 dbSNP
rs1464616260 4739 dbSNP
rs1240516799 4741 dbSNP
rs1223941569 4747 dbSNP
rs1417565828 4750 dbSNP
rs1181290109 4757 dbSNP
rs187327061 4758 dbSNP
rs1243649634 4760 dbSNP
rs1344161898 4762 dbSNP
rs1298070752 4763 dbSNP
rs1473591939 4768 dbSNP
rs952444443 4769 dbSNP
rs1359508947 4774 dbSNP
rs1394458897 4778 dbSNP
rs1436624888 4780 dbSNP
rs982508463 4784 dbSNP
rs549632683 4789 dbSNP
rs1423331605 4791 dbSNP
rs1392498411 4795 dbSNP
rs1169636859 4810 dbSNP
rs657972 4816 dbSNP
rs532367235 4823 dbSNP
rs1040881389 4827 dbSNP
rs769005007 4831 dbSNP
rs921074264 4831 dbSNP
rs1389341389 4832 dbSNP
rs932485010 4833 dbSNP
rs1054243962 4834 dbSNP
rs1350690605 4836 dbSNP
rs552072974 4841 dbSNP
rs893892009 4844 dbSNP
rs1416481 4845 dbSNP
rs1042422600 4852 dbSNP
rs6911086 4860 dbSNP
rs1003729458 4863 dbSNP
rs1033907242 4878 dbSNP
rs753552138 4880 dbSNP
rs1245343449 4884 dbSNP
rs1227483789 4886 dbSNP
rs376791100 4888 dbSNP
rs995019457 4897 dbSNP
rs1479509661 4941 dbSNP
rs1219473066 4943 dbSNP
rs1366422931 4951 dbSNP
rs1027149401 4953 dbSNP
rs1280810552 4963 dbSNP
rs1411066861 4967 dbSNP
rs28379062 4971 dbSNP
rs59120981 4973 dbSNP
rs1204747717 4979 dbSNP
rs886061174 4991 dbSNP
rs952527240 4999 dbSNP
rs1309169933 5009 dbSNP
rs1252864633 5010 dbSNP
rs1484147066 5015 dbSNP
rs1185974169 5029 dbSNP
rs1178621934 5030 dbSNP
rs982842707 5035 dbSNP
rs1434012654 5036 dbSNP
rs1428790348 5037 dbSNP
rs1197436824 5039 dbSNP
rs1417171512 5048 dbSNP
rs1424916497 5049 dbSNP
rs567624656 5057 dbSNP
rs192634718 5060 dbSNP
rs1210482432 5061 dbSNP
rs958875984 5069 dbSNP
rs965059941 5075 dbSNP
rs1169594403 5091 dbSNP
rs976635334 5098 dbSNP
rs1289574490 5103 dbSNP
rs921188896 5106 dbSNP
rs556787130 5108 dbSNP
rs1370844853 5112 dbSNP
rs1371755779 5119 dbSNP
rs1411267596 5124 dbSNP
rs1310550889 5135 dbSNP
rs1407751954 5139 dbSNP
rs796388912 5139 dbSNP
rs932432479 5140 dbSNP
rs1314728775 5150 dbSNP
rs1458931084 5151 dbSNP
rs977861688 5155 dbSNP
rs1305664268 5170 dbSNP
rs1258108947 5176 dbSNP
rs1227456976 5177 dbSNP
rs60702386 5180 dbSNP
rs1260910229 5181 dbSNP
rs886061175 5181 dbSNP
rs1344666608 5187 dbSNP
rs933269095 5188 dbSNP
rs12528482 5195 dbSNP
rs889177003 5196 dbSNP
rs368074627 5202 dbSNP
rs539254531 5205 dbSNP
rs915301572 5208 dbSNP
rs945507624 5215 dbSNP
rs898439769 5220 dbSNP
rs994095720 5233 dbSNP
rs1042886983 5238 dbSNP
rs1158085245 5243 dbSNP
rs1451702984 5249 dbSNP
rs1370188481 5250 dbSNP
rs1165355147 5259 dbSNP
rs570123639 5260 dbSNP
rs906516893 5264 dbSNP
rs74778911 5265 dbSNP
rs572149862 5267 dbSNP
rs540676141 5275 dbSNP
rs552817305 5283 dbSNP
rs142524658 5287 dbSNP
rs1392345804 5289 dbSNP
rs1489159483 5291 dbSNP
rs1267809891 5295 dbSNP
rs995406316 5296 dbSNP
rs12208588 5297 dbSNP
rs888173554 5302 dbSNP
rs1313380456 5305 dbSNP
rs958427930 5317 dbSNP
rs1358105368 5321 dbSNP
rs886061176 5323 dbSNP
rs1015363832 5328 dbSNP
rs1380643954 5335 dbSNP
rs1392942601 5336 dbSNP
rs1466142264 5337 dbSNP
rs1304058648 5345 dbSNP
rs1383228706 5346 dbSNP
rs1359854823 5350 dbSNP
rs965007440 5356 dbSNP
rs1212577160 5363 dbSNP
rs1434275482 5374 dbSNP
rs1298078853 5376 dbSNP
rs1367030944 5381 dbSNP
rs1452930244 5383 dbSNP
rs1267480463 5399 dbSNP
rs1221001699 5410 dbSNP
rs541645362 5412 dbSNP
rs770686252 5416 dbSNP
rs1207819520 5420 dbSNP
rs150949887 5423 dbSNP
rs989703731 5426 dbSNP
rs1212404155 5434 dbSNP
rs1269878450 5435 dbSNP
rs563635255 5437 dbSNP
rs915058875 5439 dbSNP
rs1284005845 5449 dbSNP
rs968076689 5455 dbSNP
rs1464840734 5468 dbSNP
rs1363698157 5473 dbSNP
rs977707200 5477 dbSNP
rs1430224059 5484 dbSNP
rs1165903508 5485 dbSNP
rs1250318309 5493 dbSNP
rs945218739 5494 dbSNP
rs978168318 5500 dbSNP
rs1377788403 5506 dbSNP
rs1452920559 5508 dbSNP
rs532296977 5514 dbSNP
rs112289929 5522 dbSNP
rs6933986 5530 dbSNP
rs1184937750 5532 dbSNP
rs1438845795 5542 dbSNP
rs1272781952 5545 dbSNP
rs910664083 5547 dbSNP
rs942084193 5548 dbSNP
rs1263974851 5552 dbSNP
rs1433397482 5557 dbSNP
rs11962989 5559 dbSNP
rs919772024 5561 dbSNP
rs1342860666 5572 dbSNP
rs930934616 5575 dbSNP
rs1326625316 5578 dbSNP
rs929762273 5578 dbSNP
rs1415951757 5579 dbSNP
rs1402555078 5580 dbSNP
rs1175222210 5581 dbSNP
rs1467816632 5582 dbSNP
rs1413555229 5583 dbSNP
rs1321095147 5587 dbSNP
rs1390703600 5588 dbSNP
rs1182215505 5589 dbSNP
rs1438501733 5589 dbSNP
rs1470801279 5592 dbSNP
rs1046985598 5600 dbSNP
rs386707043 5601 dbSNP
rs644001 5602 dbSNP
rs6934177 5603 dbSNP
rs532553810 5609 dbSNP
rs1005469104 5613 dbSNP
rs1015312927 5616 dbSNP
rs11758050 5625 dbSNP
rs1328519717 5629 dbSNP
rs1209940955 5630 dbSNP
rs1321623161 5630 dbSNP
rs1270101053 5641 dbSNP
rs1224356949 5642 dbSNP
rs1011324319 5643 dbSNP
rs79580857 5656 dbSNP
rs967579318 5661 dbSNP
rs1335777230 5662 dbSNP
rs999400912 5668 dbSNP
rs1221372474 5671 dbSNP
rs886061177 5674 dbSNP
rs1488606249 5683 dbSNP
rs1407976489 5698 dbSNP
rs1157318967 5703 dbSNP
rs1474032448 5718 dbSNP
rs1192519213 5727 dbSNP
rs570366705 5728 dbSNP
rs1183301418 5729 dbSNP
rs538959119 5733 dbSNP
rs1472000463 5742 dbSNP
rs184619278 5744 dbSNP
rs1446472872 5755 dbSNP
rs1282121352 5767 dbSNP
rs886061178 5769 dbSNP
rs1360012337 5774 dbSNP
rs766477298 5781 dbSNP
rs1314110260 5790 dbSNP
rs117604907 5792 dbSNP
rs1366986904 5793 dbSNP
rs1289081315 5798 dbSNP
rs1429462153 5828 dbSNP
rs1403529107 5832 dbSNP
rs868064871 5843 dbSNP
rs1342949487 5847 dbSNP
rs1324909669 5853 dbSNP
rs1427117599 5854 dbSNP
rs966532782 5857 dbSNP
rs1386345812 5861 dbSNP
rs977934650 5863 dbSNP
rs1443162083 5867 dbSNP
rs928045216 5871 dbSNP
rs1421969794 5874 dbSNP
rs886061179 5882 dbSNP
rs754119199 5884 dbSNP
rs368356308 5885 dbSNP
rs1438908944 5888 dbSNP
rs1475178357 5891 dbSNP
rs990763034 5893 dbSNP
rs1296631929 5902 dbSNP
rs916561897 5920 dbSNP
rs1290928467 5922 dbSNP
rs973520291 5923 dbSNP
rs1290277726 5927 dbSNP
rs548496373 5928 dbSNP
rs765093551 5929 dbSNP
rs1359348873 5931 dbSNP
rs1291054193 5935 dbSNP
rs1405020432 5936 dbSNP
rs1453643151 5942 dbSNP
rs1366813407 5949 dbSNP
rs1303046121 5951 dbSNP
rs886693467 5967 dbSNP
rs940865103 5970 dbSNP
rs1249226463 5971 dbSNP
rs1462829630 5972 dbSNP
rs1040596910 5973 dbSNP
rs1417559945 5980 dbSNP
rs554274160 5993 dbSNP
rs564841923 5993 dbSNP
rs770239401 5994 dbSNP
rs867672340 5996 dbSNP
rs1055428616 5997 dbSNP
rs1049519775 5999 dbSNP
rs1203485646 6000 dbSNP
rs1253257062 6011 dbSNP
rs1471775178 6027 dbSNP
rs1223640567 6028 dbSNP
rs889427201 6031 dbSNP
rs1162537169 6032 dbSNP
rs574181158 6034 dbSNP
rs543056433 6036 dbSNP
rs1280749979 6037 dbSNP
rs188240608 6038 dbSNP
rs1022211737 6041 dbSNP
rs577071632 6044 dbSNP
rs1376076169 6046 dbSNP
rs545739278 6048 dbSNP
rs902910729 6052 dbSNP
rs1441915843 6059 dbSNP
rs1353045049 6060 dbSNP
rs1178811762 6061 dbSNP
rs1470371831 6081 dbSNP
rs559514437 6086 dbSNP
rs999302286 6087 dbSNP
rs1034841124 6095 dbSNP
rs960546931 6103 dbSNP
rs1244650061 6107 dbSNP
rs528267938 6108 dbSNP
rs1030493109 6110 dbSNP
rs1229632732 6116 dbSNP
rs375848289 6117 dbSNP
rs746489122 6118 dbSNP
rs1391218921 6122 dbSNP
rs542023580 6141 dbSNP
rs954979169 6144 dbSNP
rs1453663703 6159 dbSNP
rs1007816012 6169 dbSNP
rs1334864215 6174 dbSNP
rs1455408652 6186 dbSNP
rs2211106 6187 dbSNP
rs770486449 6189 dbSNP
rs886061180 6189 dbSNP
rs985235540 6210 dbSNP
rs908108942 6217 dbSNP
rs1417187330 6219 dbSNP
rs1386890604 6241 dbSNP
rs1285342919 6242 dbSNP
rs1183897678 6247 dbSNP
rs780662039 6250 dbSNP
rs139522392 6251 dbSNP
rs1213236394 6256 dbSNP
rs919372327 6257 dbSNP
rs923409034 6266 dbSNP
rs1261875113 6268 dbSNP
rs982615108 6270 dbSNP
rs932147837 6284 dbSNP
rs530206053 6293 dbSNP
rs1247157358 6294 dbSNP
rs1440161494 6301 dbSNP
rs889575379 6305 dbSNP
rs1010565233 6306 dbSNP