miRTarBase - #MIRT661291 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LIN52   
Synonyms C14orf46, c14_5549
Description lin-52 DREAM MuvB core complex component
Transcript NM_001024674   
Putative miRNA Targets on LIN52
3'UTR of LIN52
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             |::||| |   :|||||| 
Target 5' attATGCCACT---GCACTCCa 3'
1388 - 1406 136.00 -13.60
               |||  |||  || |||| 
Target 5' gcctgACC--TGTGAACTCTCCa 3'
476 - 496 117.00 -11.80
              | ||  || ||   :|||||: 
121 - 146 114.00 -11.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13595725 12 COSMIC
COSN30145598 14 COSMIC
COSN18738094 18 COSMIC
COSN30042833 27 COSMIC
COSN30449976 33 COSMIC
COSN13595729 34 COSMIC
COSN31499550 42 COSMIC
COSN30449051 60 COSMIC
COSN30170503 101 COSMIC
COSN8849771 348 COSMIC
COSN29019045 920 COSMIC
COSN23971534 1253 COSMIC
COSN25710961 1265 COSMIC
COSN25710962 1266 COSMIC
COSN26403948 1532 COSMIC
COSN19266108 1689 COSMIC
COSN29864400 1791 COSMIC
COSN23365721 1820 COSMIC
COSN27206432 1845 COSMIC
COSN26000763 2162 COSMIC
rs45569432 546 GWAS
rs887595 962 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755893501 3 dbSNP
rs779851578 7 dbSNP
rs748886652 8 dbSNP
rs370591367 12 dbSNP
rs375113035 13 dbSNP
rs773334162 14 dbSNP
rs754794235 15 dbSNP
rs1199242723 16 dbSNP
rs747086819 17 dbSNP
rs1261549226 21 dbSNP
rs1443511836 22 dbSNP
rs1192872842 25 dbSNP
rs1345286758 27 dbSNP
rs1160319074 28 dbSNP
rs770930024 30 dbSNP
rs370334003 33 dbSNP
rs374299677 34 dbSNP
rs374719511 38 dbSNP
rs775689117 39 dbSNP
rs148971436 46 dbSNP
rs1438573621 50 dbSNP
rs1485545193 51 dbSNP
rs61738632 52 dbSNP
rs79709521 53 dbSNP
rs1346314202 54 dbSNP
rs1010362211 58 dbSNP
rs914098375 60 dbSNP
rs1333214835 63 dbSNP
rs1292927675 67 dbSNP
rs1381308628 70 dbSNP
rs751952047 72 dbSNP
rs1299488091 74 dbSNP
rs1430727068 84 dbSNP
rs945626578 97 dbSNP
rs971038812 98 dbSNP
rs140888594 102 dbSNP
rs1041233127 107 dbSNP
rs1371131316 121 dbSNP
rs1192284050 123 dbSNP
rs1428127645 129 dbSNP
rs1195895640 134 dbSNP
rs1484750086 146 dbSNP
rs113566540 150 dbSNP
rs996912159 151 dbSNP
rs1347498699 153 dbSNP
rs1249972312 157 dbSNP
rs1227235055 159 dbSNP
rs559769860 166 dbSNP
rs888468713 169 dbSNP
rs1005932382 187 dbSNP
rs930113848 195 dbSNP
rs1354280341 196 dbSNP
rs528762907 197 dbSNP
rs961318566 202 dbSNP
rs1014167352 203 dbSNP
rs1024168157 206 dbSNP
rs912593987 214 dbSNP
rs1285312262 217 dbSNP
rs377363131 218 dbSNP
rs769971029 245 dbSNP
rs969854110 246 dbSNP
rs1173132264 249 dbSNP
rs1474228301 262 dbSNP
rs1039657663 265 dbSNP
rs904127299 267 dbSNP
rs979888221 280 dbSNP
rs925658547 286 dbSNP
rs1052620052 287 dbSNP
rs1341991107 289 dbSNP
rs1196713480 290 dbSNP
rs1259519592 303 dbSNP
rs540707858 318 dbSNP
rs957060941 324 dbSNP
rs1333780198 326 dbSNP
rs1293369289 337 dbSNP
rs988920554 338 dbSNP
rs1436599520 339 dbSNP
rs912893467 340 dbSNP
rs182987312 343 dbSNP
rs45482692 348 dbSNP
rs1402200909 351 dbSNP
rs1333544628 352 dbSNP
rs922793210 364 dbSNP
rs1480443063 367 dbSNP
rs932794430 372 dbSNP
rs1375544274 375 dbSNP
rs1163877764 377 dbSNP
rs906927640 394 dbSNP
rs1049845879 403 dbSNP
rs1463379572 406 dbSNP
rs1168308058 424 dbSNP
rs888489762 429 dbSNP
rs941452259 430 dbSNP
rs1240402945 451 dbSNP
rs1037469294 452 dbSNP
rs1304818679 457 dbSNP
rs1467730202 461 dbSNP
rs995824697 470 dbSNP
rs1229488961 471 dbSNP
rs1347961372 472 dbSNP
rs1278815467 477 dbSNP
rs187102545 478 dbSNP
rs897140314 487 dbSNP
rs1014198421 495 dbSNP
rs1439943447 498 dbSNP
rs569873023 500 dbSNP
rs747020154 501 dbSNP
rs768727890 502 dbSNP
rs912666132 503 dbSNP
rs1158130485 513 dbSNP
rs1328403504 524 dbSNP
rs151157823 528 dbSNP
rs1251134656 529 dbSNP
rs1382746258 531 dbSNP
rs1192122273 532 dbSNP
rs1337776417 536 dbSNP
rs1225380613 544 dbSNP
rs45569432 546 dbSNP
rs565863761 547 dbSNP
rs1444720086 548 dbSNP
rs1490383226 555 dbSNP
rs957381045 566 dbSNP
rs534909466 577 dbSNP
rs1019933733 580 dbSNP
rs1278163643 583 dbSNP
rs1264599457 586 dbSNP
rs1368072118 587 dbSNP
rs1275606510 592 dbSNP
rs1429963403 594 dbSNP
rs1438864585 595 dbSNP
rs781550503 607 dbSNP
rs914097143 613 dbSNP
rs1317692696 623 dbSNP
rs748428251 628 dbSNP
rs976987247 629 dbSNP
rs1172351960 643 dbSNP
rs922824343 646 dbSNP
rs1193342816 647 dbSNP
rs1209076051 649 dbSNP
rs764305131 650 dbSNP
rs1001244625 659 dbSNP
rs1488995974 664 dbSNP
rs770141123 669 dbSNP
rs1055505645 671 dbSNP
rs1312766333 681 dbSNP
rs1280472705 682 dbSNP
rs752068026 684 dbSNP
rs773492477 686 dbSNP
rs140314407 689 dbSNP
rs910037834 703 dbSNP
rs145234008 713 dbSNP
rs1025966522 715 dbSNP
rs1165466432 721 dbSNP
rs941465599 723 dbSNP
rs766750931 731 dbSNP
rs1366078789 742 dbSNP
rs1311532559 744 dbSNP
rs1447928511 746 dbSNP
rs951307865 747 dbSNP
rs1037094118 756 dbSNP
rs1424149703 757 dbSNP
rs1301396518 767 dbSNP
rs1008031141 768 dbSNP
rs1382993286 769 dbSNP
rs897171641 776 dbSNP
rs1418288577 785 dbSNP
rs1170983610 793 dbSNP
rs1478476546 794 dbSNP
rs1019373301 799 dbSNP
rs191069891 805 dbSNP
rs964100224 814 dbSNP
rs1483520665 815 dbSNP
rs949995541 818 dbSNP
rs1202122060 821 dbSNP
rs1437050113 826 dbSNP
rs975466657 826 dbSNP
rs1045678070 833 dbSNP
rs905816000 841 dbSNP
rs1219496393 847 dbSNP
rs1001448813 857 dbSNP
rs1320345046 859 dbSNP
rs1325106672 863 dbSNP
rs1380498543 869 dbSNP
rs1248588889 873 dbSNP
rs925341988 881 dbSNP
rs1033290338 882 dbSNP
rs7154851 886 dbSNP
rs1400027660 889 dbSNP
rs5809655 893 dbSNP
rs750807792 893 dbSNP
rs1331536898 894 dbSNP
rs988134819 896 dbSNP
rs1415269583 900 dbSNP
rs1415827293 902 dbSNP
rs1175417763 903 dbSNP
rs1480154622 908 dbSNP
rs756512457 914 dbSNP
rs1200375637 917 dbSNP
rs562416329 919 dbSNP
rs1019964612 920 dbSNP
rs1486529638 937 dbSNP
rs965692726 939 dbSNP
rs1322435208 945 dbSNP
rs182847294 947 dbSNP
rs949579996 948 dbSNP
rs1376881273 957 dbSNP
rs542883616 958 dbSNP
rs887595 962 dbSNP
rs1463408409 965 dbSNP
rs573495817 985 dbSNP
rs1385577323 991 dbSNP
rs1457911313 1005 dbSNP
rs1351131344 1007 dbSNP
rs1156389096 1012 dbSNP
rs937105104 1020 dbSNP
rs1055541605 1021 dbSNP
rs1443963107 1026 dbSNP
rs545677575 1042 dbSNP
rs898186446 1045 dbSNP
rs910059690 1056 dbSNP
rs1365614199 1063 dbSNP
rs1488812654 1071 dbSNP
rs930992868 1072 dbSNP
rs564072323 1079 dbSNP
rs752422280 1083 dbSNP
rs1454359721 1090 dbSNP
rs1046700297 1094 dbSNP
rs1287395874 1098 dbSNP
rs187400433 1100 dbSNP
rs11159070 1102 dbSNP
rs972820271 1107 dbSNP
rs1369248049 1118 dbSNP
rs62006794 1121 dbSNP
rs1386978990 1122 dbSNP
rs1019446313 1128 dbSNP
rs899669412 1129 dbSNP
rs563343646 1143 dbSNP
rs1418616351 1144 dbSNP
rs1972565 1145 dbSNP
rs1032859040 1152 dbSNP
rs958118428 1158 dbSNP
rs1318271754 1159 dbSNP
rs988554621 1162 dbSNP
rs1239099208 1163 dbSNP
rs1454863189 1163 dbSNP
rs528974926 1167 dbSNP
rs1045793101 1176 dbSNP
rs12891922 1178 dbSNP
rs927301831 1179 dbSNP
rs971006154 1181 dbSNP
rs1219452568 1183 dbSNP
rs12892317 1201 dbSNP
rs937280977 1203 dbSNP
rs1243529530 1204 dbSNP
rs7155093 1206 dbSNP
rs1180101616 1207 dbSNP
rs1313567224 1207 dbSNP
rs1293022342 1210 dbSNP
rs1251373366 1211 dbSNP
rs892974027 1212 dbSNP
rs1482913477 1215 dbSNP
rs1252568591 1216 dbSNP
rs1277901731 1216 dbSNP
rs1010039436 1221 dbSNP
rs1419802063 1221 dbSNP
rs1158508193 1222 dbSNP
rs55851709 1223 dbSNP
rs1409803363 1224 dbSNP
rs1340598275 1225 dbSNP
rs1471083149 1229 dbSNP
rs1177347684 1230 dbSNP
rs1412838220 1232 dbSNP
rs1405882330 1233 dbSNP
rs1041451893 1235 dbSNP
rs554519280 1236 dbSNP
rs56020253 1243 dbSNP
rs56001328 1253 dbSNP
rs66590335 1264 dbSNP
rs1972564 1265 dbSNP
rs1972563 1266 dbSNP
rs1424412493 1267 dbSNP
rs1196021729 1269 dbSNP
rs1441161537 1274 dbSNP
rs397769910 1275 dbSNP
rs57198851 1275 dbSNP
rs191480363 1277 dbSNP
rs1201340442 1282 dbSNP
rs1972562 1298 dbSNP
rs58598225 1301 dbSNP
rs1322627041 1303 dbSNP
rs1207735020 1305 dbSNP
rs1252804839 1306 dbSNP
rs926804724 1307 dbSNP
rs1199416643 1308 dbSNP
rs2884498 1308 dbSNP
rs1480939238 1309 dbSNP
rs1176488231 1312 dbSNP
rs1972561 1314 dbSNP
rs1481452210 1315 dbSNP
rs1200504976 1316 dbSNP
rs938145245 1317 dbSNP
rs1394088052 1323 dbSNP
rs1413167646 1324 dbSNP
rs1330495017 1325 dbSNP
rs953050619 1328 dbSNP
rs55940708 1329 dbSNP
rs2358635 1333 dbSNP
rs551612717 1334 dbSNP
rs58627956 1335 dbSNP
rs1017152302 1340 dbSNP
rs58542055 1344 dbSNP
rs1283568753 1345 dbSNP
rs571324928 1351 dbSNP
rs972934545 1352 dbSNP
rs918748884 1361 dbSNP
rs971497902 1362 dbSNP
rs57652136 1368 dbSNP
rs59461702 1369 dbSNP
rs981508770 1370 dbSNP
rs919685212 1373 dbSNP
rs931045877 1383 dbSNP
rs927306678 1385 dbSNP
rs991379231 1386 dbSNP
rs886776249 1393 dbSNP
rs1333976022 1395 dbSNP
rs1054790849 1397 dbSNP
rs1447309433 1399 dbSNP
rs1040928047 1401 dbSNP
rs914457224 1403 dbSNP
rs1333650842 1410 dbSNP
rs1403610952 1411 dbSNP
rs1272385619 1414 dbSNP
rs55820328 1416 dbSNP
rs56349587 1423 dbSNP
rs1223291612 1427 dbSNP
rs1379042630 1428 dbSNP
rs58836574 1431 dbSNP
rs1440735452 1435 dbSNP
rs1196327999 1436 dbSNP
rs1239549244 1436 dbSNP
rs1450742219 1436 dbSNP
rs1268207462 1437 dbSNP
rs1289965960 1437 dbSNP
rs1158582012 1438 dbSNP
rs1171261975 1438 dbSNP
rs1218465712 1438 dbSNP
rs1246977910 1438 dbSNP
rs1276234346 1438 dbSNP
rs1324246262 1438 dbSNP
rs1330803771 1438 dbSNP
rs1351389652 1438 dbSNP
rs1355838269 1438 dbSNP
rs1359147036 1438 dbSNP
rs1382545598 1438 dbSNP
rs1388643725 1438 dbSNP
rs1420634550 1438 dbSNP
rs1421334927 1438 dbSNP
rs1477474327 1438 dbSNP
rs1487039621 1438 dbSNP
rs56187555 1438 dbSNP
rs567001319 1438 dbSNP
rs59209603 1438 dbSNP
rs763283531 1438 dbSNP
rs769022603 1438 dbSNP
rs769983333 1438 dbSNP
rs770055922 1438 dbSNP
rs1477179584 1439 dbSNP
rs1188435686 1440 dbSNP
rs1180353405 1441 dbSNP
rs1420682314 1442 dbSNP
rs1428271378 1443 dbSNP
rs1231040137 1445 dbSNP
rs1167332198 1446 dbSNP
rs1469579067 1449 dbSNP
rs1367964239 1450 dbSNP
rs79316673 1452 dbSNP
rs60871881 1453 dbSNP
rs12896199 1454 dbSNP
rs1425797403 1455 dbSNP
rs1303267817 1457 dbSNP
rs1348729660 1458 dbSNP
rs1423166375 1460 dbSNP
rs1433870942 1462 dbSNP
rs945966153 1464 dbSNP
rs1271557742 1467 dbSNP
rs1414281957 1467 dbSNP
rs1415290565 1468 dbSNP
rs1476521486 1470 dbSNP
rs1227360489 1471 dbSNP
rs1295381034 1473 dbSNP
rs1361529629 1474 dbSNP
rs1246569733 1479 dbSNP
rs1422269596 1480 dbSNP
rs1289248159 1485 dbSNP
rs537021994 1511 dbSNP
rs1489210369 1514 dbSNP
rs1209098563 1516 dbSNP
rs868508880 1516 dbSNP
rs529366523 1518 dbSNP
rs1279529873 1519 dbSNP
rs1316368520 1521 dbSNP
rs893884708 1521 dbSNP
rs1277611335 1529 dbSNP
rs188410964 1530 dbSNP
rs1364642199 1532 dbSNP
rs1282976612 1534 dbSNP
rs1447670298 1535 dbSNP
rs1360122291 1536 dbSNP
rs558741506 1542 dbSNP
rs1187039455 1544 dbSNP
rs1399140136 1561 dbSNP
rs888786723 1566 dbSNP
rs144853565 1573 dbSNP
rs1021406096 1576 dbSNP
rs573338181 1577 dbSNP
rs746915602 1582 dbSNP
rs1410352482 1583 dbSNP
rs1005845274 1596 dbSNP
rs1411478688 1597 dbSNP
rs1387429378 1605 dbSNP
rs970703352 1611 dbSNP
rs982386851 1612 dbSNP
rs1238988000 1630 dbSNP
rs1016338894 1636 dbSNP
rs1196575148 1644 dbSNP
rs963025331 1650 dbSNP
rs1033951627 1653 dbSNP
rs959585293 1654 dbSNP
rs192244116 1664 dbSNP
rs1199308617 1665 dbSNP
rs973990486 1688 dbSNP
rs765100357 1697 dbSNP
rs1163447341 1701 dbSNP
rs931095784 1703 dbSNP
rs971533881 1704 dbSNP
rs1412522922 1711 dbSNP
rs1445088789 1729 dbSNP
rs1375630410 1734 dbSNP
rs1331650806 1737 dbSNP
rs908245627 1740 dbSNP
rs566755986 1757 dbSNP
rs981539868 1761 dbSNP
rs943724219 1773 dbSNP
rs1319926944 1782 dbSNP
rs927367646 1790 dbSNP
rs559257995 1791 dbSNP
rs1176493069 1792 dbSNP
rs1438888785 1795 dbSNP
rs750134853 1796 dbSNP
rs1237727241 1799 dbSNP
rs184676242 1802 dbSNP
rs1481774019 1807 dbSNP
rs1263754659 1810 dbSNP
rs990207016 1811 dbSNP
rs1322822317 1813 dbSNP
rs543469455 1819 dbSNP
rs1353439837 1820 dbSNP
rs1436599453 1828 dbSNP
rs754741920 1828 dbSNP
rs1367326334 1838 dbSNP
rs1156782352 1840 dbSNP
rs563258654 1841 dbSNP
rs1265591136 1842 dbSNP
rs1329282282 1842 dbSNP
rs977290554 1842 dbSNP
rs1403142665 1843 dbSNP
rs1052159 1844 dbSNP
rs143089788 1844 dbSNP
rs1346866522 1845 dbSNP
rs147322792 1845 dbSNP
rs1283512374 1846 dbSNP
rs397839866 1846 dbSNP
rs1010093787 1847 dbSNP
rs1399317816 1847 dbSNP
rs773202862 1848 dbSNP
rs923120181 1848 dbSNP
rs1003559990 1849 dbSNP
rs1175628407 1849 dbSNP
rs1191652512 1850 dbSNP
rs749485595 1850 dbSNP
rs1033647540 1851 dbSNP
rs573701669 1851 dbSNP
rs959615865 1852 dbSNP
rs995097784 1852 dbSNP
rs1275722410 1853 dbSNP
rs57561832 1854 dbSNP
rs1050600130 1862 dbSNP
rs1285274598 1862 dbSNP
rs779788994 1866 dbSNP
rs751529178 1871 dbSNP
rs1297671999 1877 dbSNP
rs950901348 1879 dbSNP
rs1245372322 1885 dbSNP
rs1462039258 1888 dbSNP
rs982963537 1902 dbSNP
rs8003209 1904 dbSNP
rs1236199196 1916 dbSNP
rs755037900 1936 dbSNP
rs1477554741 1942 dbSNP
rs1159821132 1945 dbSNP
rs994441529 1960 dbSNP
rs1456380755 1972 dbSNP
rs1156426539 1976 dbSNP
rs965063709 1978 dbSNP
rs1255896949 1982 dbSNP
rs1204755926 1983 dbSNP
rs1408100929 1985 dbSNP
rs1255784447 1999 dbSNP
rs577769465 2000 dbSNP
rs1318002645 2002 dbSNP
rs1252941160 2013 dbSNP
rs1242498846 2016 dbSNP
rs1339847400 2017 dbSNP
rs907379269 2018 dbSNP
rs748340260 2019 dbSNP
rs1385212474 2024 dbSNP
rs1329572270 2025 dbSNP
rs1338600924 2026 dbSNP
rs1465120156 2027 dbSNP
rs1397288146 2029 dbSNP
rs932593111 2030 dbSNP
rs1053695239 2033 dbSNP
rs770053041 2040 dbSNP
rs1184536966 2041 dbSNP
rs945249107 2043 dbSNP
rs1235906872 2044 dbSNP
rs958852868 2047 dbSNP
rs1438102424 2049 dbSNP
rs906626333 2052 dbSNP
rs1207605031 2059 dbSNP
rs778081470 2065 dbSNP
rs1292449399 2070 dbSNP
rs1280217710 2074 dbSNP
rs1349888783 2076 dbSNP
rs1308339947 2079 dbSNP
rs1003592593 2082 dbSNP
rs1021651782 2090 dbSNP
rs967321533 2096 dbSNP
rs977316109 2108 dbSNP
rs1390592037 2114 dbSNP
rs1164776364 2129 dbSNP
rs1426881458 2130 dbSNP
rs1378839487 2132 dbSNP
rs538425865 2135 dbSNP
rs1470296963 2143 dbSNP
rs895140410 2146 dbSNP
rs995527308 2147 dbSNP
rs923151128 2149 dbSNP
rs1027888710 2150 dbSNP
rs1269444365 2160 dbSNP
rs7697 2162 dbSNP
rs1487307791 2168 dbSNP
rs1285009262 2169 dbSNP
rs986014624 2172 dbSNP
rs1005057976 2175 dbSNP
rs1231075712 2179 dbSNP
rs1330611499 2191 dbSNP
rs1303896836 2193 dbSNP
rs1407289992 2199 dbSNP
rs189437193 2201 dbSNP
rs575595863 2206 dbSNP
rs774703706 2212 dbSNP
rs1401682976 2221 dbSNP
rs1409621476 2223 dbSNP
rs760184562 2231 dbSNP
rs1037831344 2233 dbSNP
rs897510831 2234 dbSNP
rs928924522 2237 dbSNP
rs1047348415 2238 dbSNP
rs1440090371 2242 dbSNP
rs1429379048 2243 dbSNP
rs868032879 2247 dbSNP
rs1201009644 2256 dbSNP
rs907495343 2270 dbSNP
rs1251923411 2280 dbSNP
rs1448519376 2283 dbSNP
rs976461032 2286 dbSNP
rs551410732 2287 dbSNP
rs564866008 2289 dbSNP
rs920955946 2296 dbSNP
rs1339040893 2304 dbSNP
rs1270133571 2305 dbSNP
rs953717852 2309 dbSNP
rs1179652992 2312 dbSNP
rs1347309277 2313 dbSNP
rs192552038 2322 dbSNP
rs1413528684 2333 dbSNP
rs1406428682 2335 dbSNP
rs550604146 2337 dbSNP
rs945254147 2340 dbSNP
rs977924154 2347 dbSNP
rs1171802566 2359 dbSNP
rs567316176 2367 dbSNP
rs927782429 2368 dbSNP
rs894617219 2369 dbSNP
rs60918295 2370 dbSNP
rs1370111282 2388 dbSNP
rs184361996 2396 dbSNP
rs1055202128 2401 dbSNP
rs1461002201 2406 dbSNP
rs1264025759 2414 dbSNP
rs1408045096 2425 dbSNP
rs1011680454 2436 dbSNP
rs1272457904 2443 dbSNP
rs1021630720 2446 dbSNP
rs930680101 2447 dbSNP
rs1364751557 2479 dbSNP
rs967354231 2480 dbSNP
rs549245284 2481 dbSNP
rs547029337 2490 dbSNP
rs1383011457 2492 dbSNP
rs566965747 2501 dbSNP
rs977430995 2506 dbSNP
rs1463550308 2507 dbSNP
rs1398904489 2513 dbSNP
rs1548771 2514 dbSNP
rs1273447605 2515 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             |::||| |   :|||||| 
Target 5' auuAUGCCACU---GCACUCCa 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000555028.1 | 3UTR | AAAUUAUGCCACUGCACUCCAGCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*